Starting /dee2/code/volunteer_pipeline.sh SRR9103009 current disk space = 1548283244544 free memory = 1603567616 SRR9103009 SRAfilesize 4d292dd938ec9a44c79244c675a20964 SRR9103009.sra SRR9103009.sra file validated SRR9103009 is paired end SRR9103009 is conventional basespace SRR9103009 read1 length is 35-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103009_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-50 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.019 33.0 33.0 33.0 33.0 33.0 2 31.8425 33.0 33.0 33.0 27.0 33.0 3 32.69025 33.0 33.0 33.0 33.0 33.0 4 33.385 33.0 33.0 33.0 33.0 37.0 5 34.1275 33.0 33.0 37.0 33.0 37.0 6 36.15825 37.0 37.0 37.0 33.0 37.0 7 36.41025 37.0 37.0 37.0 37.0 37.0 8 36.57025 37.0 37.0 37.0 37.0 37.0 9 36.62275 37.0 37.0 37.0 37.0 37.0 10 36.669 37.0 37.0 37.0 37.0 37.0 11 36.62 37.0 37.0 37.0 37.0 37.0 12 36.64375 37.0 37.0 37.0 37.0 37.0 13 36.636 37.0 37.0 37.0 37.0 37.0 14 36.61075 37.0 37.0 37.0 37.0 37.0 15 36.6035 37.0 37.0 37.0 37.0 37.0 16 36.59825 37.0 37.0 37.0 37.0 37.0 17 36.591 37.0 37.0 37.0 37.0 37.0 18 36.56225 37.0 37.0 37.0 37.0 37.0 19 36.56525 37.0 37.0 37.0 37.0 37.0 20 36.594 37.0 37.0 37.0 37.0 37.0 21 36.615 37.0 37.0 37.0 37.0 37.0 22 36.5885 37.0 37.0 37.0 37.0 37.0 23 36.63725 37.0 37.0 37.0 37.0 37.0 24 36.60675 37.0 37.0 37.0 37.0 37.0 25 36.6075 37.0 37.0 37.0 37.0 37.0 26 36.5805 37.0 37.0 37.0 37.0 37.0 27 36.52475 37.0 37.0 37.0 37.0 37.0 28 36.57375 37.0 37.0 37.0 37.0 37.0 29 36.55375 37.0 37.0 37.0 37.0 37.0 30 36.6105 37.0 37.0 37.0 37.0 37.0 31 36.586 37.0 37.0 37.0 37.0 37.0 32 36.57825 37.0 37.0 37.0 37.0 37.0 33 36.6665 37.0 37.0 37.0 37.0 37.0 34 36.60625 37.0 37.0 37.0 37.0 37.0 35 36.64075 37.0 37.0 37.0 37.0 37.0 36 36.62465616404101 37.0 37.0 37.0 37.0 37.0 37 36.575537768884445 37.0 37.0 37.0 37.0 37.0 38 36.605203902927194 37.0 37.0 37.0 37.0 37.0 39 36.640980735551665 37.0 37.0 37.0 37.0 37.0 40 36.65832290362954 37.0 37.0 37.0 37.0 37.0 41 36.65071410674017 37.0 37.0 37.0 37.0 37.0 42 36.61794936074204 37.0 37.0 37.0 37.0 37.0 43 36.63510798593671 37.0 37.0 37.0 37.0 37.0 44 36.651233014594865 37.0 37.0 37.0 37.0 37.0 45 36.62572951027658 37.0 37.0 37.0 37.0 37.0 46 36.69475316619282 37.0 37.0 37.0 37.0 37.0 47 36.70624663435649 37.0 37.0 37.0 37.0 37.0 48 36.773970544033666 37.0 37.0 37.0 37.0 37.0 49 36.81487159831353 37.0 37.0 37.0 37.0 37.0 50 36.921208141825346 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 1.0 27 3.0 28 4.0 29 13.0 30 18.0 31 29.0 32 55.0 33 63.0 34 100.0 35 263.0 36 3447.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.45 20.525 19.775000000000002 39.25 2 25.081270317579396 15.178794698674668 28.707176794198553 31.032758189547387 3 25.05 17.424999999999997 21.2 36.325 4 26.174999999999997 22.575 22.05 29.2 5 26.325 25.1 24.875 23.7 6 24.875 27.400000000000002 25.35 22.375 7 20.175 25.775 32.225 21.825 8 21.0 26.375 29.275000000000002 23.35 9 20.225 26.174999999999997 28.7 24.9 10 22.775000000000002 28.95 25.45 22.825 11 24.099999999999998 24.45 24.425 27.025 12 25.45 23.025000000000002 25.15 26.375 13 23.599999999999998 25.650000000000002 26.325 24.425 14 24.325 23.0 26.025 26.650000000000002 15 24.15 24.45 24.95 26.450000000000003 16 25.924999999999997 24.224999999999998 24.775 25.074999999999996 17 24.0 25.924999999999997 23.724999999999998 26.35 18 24.125 24.925 23.849999999999998 27.1 19 23.425 25.6 24.7 26.275 20 22.650000000000002 25.324999999999996 24.975 27.05 21 24.05 24.425 24.675 26.85 22 22.45 26.200000000000003 24.75 26.6 23 23.400000000000002 24.4 24.45 27.750000000000004 24 22.2 26.05 25.75 26.0 25 24.099999999999998 25.35 24.25 26.3 26 22.925 25.25 25.174999999999997 26.650000000000002 27 24.95 24.75 24.425 25.874999999999996 28 24.7 25.0 23.599999999999998 26.700000000000003 29 24.325 24.95 24.375 26.35 30 24.8 24.95 24.175 26.075 31 24.45 25.05 25.324999999999996 25.174999999999997 32 25.224999999999998 24.75 23.925 26.1 33 23.35 24.525 25.424999999999997 26.700000000000003 34 23.849999999999998 23.95 26.0 26.200000000000003 35 23.5 24.099999999999998 25.474999999999998 26.924999999999997 36 23.055763940985248 24.33108277069267 25.506376594148538 27.106776694173547 37 24.387193596798397 25.53776888444222 23.71185592796398 26.3631815907954 38 24.768576432324245 24.34325744308231 24.618463847885916 26.26970227670753 39 23.742807105328996 24.518388791593697 23.592694520890667 28.14610958218664 40 24.080100125156445 25.3566958698373 24.23028785982478 26.33291614518148 41 24.07917815083939 25.031320471059885 25.031320471059885 25.85818090704084 42 24.717974429681625 23.464527450488845 24.893457006768614 26.92404111306092 43 23.85735811150176 25.18834756403817 24.384731290808638 26.569563033651434 44 25.591343734272776 23.905385002516354 25.06290890790136 25.44036235530951 45 23.496574473483886 23.877188530829738 23.699568637401676 28.9266683582847 46 24.373223055052986 25.303696045489794 23.468596536572758 26.854484362884467 47 24.098007539041465 22.186322024771137 25.525040387722132 28.190630048465266 48 23.98557258791704 20.619176435226933 25.36819957920048 30.027051397655548 49 24.9904177845918 17.3246454580299 28.976619394403986 28.708317362974316 50 24.95075508864084 0.0 36.63821405121471 38.41103086014445 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 5.5 24 9.5 25 11.5 26 15.5 27 16.5 28 15.5 29 22.0 30 35.5 31 47.0 32 61.0 33 77.5 34 86.5 35 98.0 36 123.0 37 157.0 38 188.5 39 214.5 40 223.0 41 226.5 42 244.5 43 278.0 44 306.5 45 301.5 46 298.0 47 322.5 48 336.5 49 326.5 50 317.5 51 293.0 52 263.5 53 244.5 54 232.5 55 236.5 56 232.5 57 206.0 58 188.0 59 180.5 60 170.5 61 154.0 62 137.0 63 132.5 64 128.5 65 127.0 66 121.5 67 105.5 68 90.0 69 83.0 70 76.5 71 65.5 72 60.5 73 52.0 74 39.5 75 34.5 76 34.5 77 31.5 78 22.5 79 19.5 80 19.0 81 13.0 82 6.5 83 4.0 84 4.5 85 3.5 86 2.0 87 2.0 88 1.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 1.0 37 1.0 38 0.0 39 2.0 40 4.0 41 2.0 42 7.0 43 8.0 44 33.0 45 72.0 46 155.0 47 387.0 48 718.0 49 1086.0 50 1523.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93536121673003 97.575 2 0.7858048162230671 1.55 3 0.25348542458808615 0.75 4 0.0 0.0 5 0.025348542458808618 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGATCCTACGTTCCAAATGCAGCGAGCTCGTATAACCCTTTAAGAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103009 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103009_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.008 33.0 33.0 33.0 33.0 33.0 2 32.5815 33.0 33.0 33.0 33.0 33.0 3 32.57075 33.0 33.0 33.0 33.0 33.0 4 32.621 33.0 33.0 33.0 33.0 33.0 5 32.721 33.0 33.0 33.0 33.0 33.0 6 36.209 37.0 37.0 37.0 37.0 37.0 7 36.20575 37.0 37.0 37.0 37.0 37.0 8 36.219 37.0 37.0 37.0 37.0 37.0 9 36.23075 37.0 37.0 37.0 37.0 37.0 10 36.2655 37.0 37.0 37.0 37.0 37.0 11 36.205 37.0 37.0 37.0 37.0 37.0 12 36.1205 37.0 37.0 37.0 37.0 37.0 13 36.25175 37.0 37.0 37.0 37.0 37.0 14 36.29125 37.0 37.0 37.0 37.0 37.0 15 36.2395 37.0 37.0 37.0 37.0 37.0 16 36.25325 37.0 37.0 37.0 37.0 37.0 17 36.327 37.0 37.0 37.0 37.0 37.0 18 36.321 37.0 37.0 37.0 37.0 37.0 19 36.14525 37.0 37.0 37.0 37.0 37.0 20 36.184 37.0 37.0 37.0 37.0 37.0 21 36.1845 37.0 37.0 37.0 37.0 37.0 22 36.245 37.0 37.0 37.0 37.0 37.0 23 36.1935 37.0 37.0 37.0 37.0 37.0 24 36.19825 37.0 37.0 37.0 37.0 37.0 25 36.17575 37.0 37.0 37.0 37.0 37.0 26 36.3185 37.0 37.0 37.0 37.0 37.0 27 36.3175 37.0 37.0 37.0 37.0 37.0 28 36.309 37.0 37.0 37.0 37.0 37.0 29 36.30425 37.0 37.0 37.0 37.0 37.0 30 36.29225 37.0 37.0 37.0 37.0 37.0 31 36.22425 37.0 37.0 37.0 37.0 37.0 32 36.29475 37.0 37.0 37.0 37.0 37.0 33 36.28525 37.0 37.0 37.0 37.0 37.0 34 36.3275 37.0 37.0 37.0 37.0 37.0 35 36.28432108027007 37.0 37.0 37.0 37.0 37.0 36 36.20335167583792 37.0 37.0 37.0 37.0 37.0 37 36.37152864648486 37.0 37.0 37.0 37.0 37.0 38 36.381631631631635 37.0 37.0 37.0 37.0 37.0 39 36.46920380570856 37.0 37.0 37.0 37.0 37.0 40 36.25470042617197 37.0 37.0 37.0 37.0 37.0 41 36.356587202007525 37.0 37.0 37.0 37.0 37.0 42 36.414909638554214 37.0 37.0 37.0 37.0 37.0 43 36.40040190906807 37.0 37.0 37.0 37.0 37.0 44 36.417211877201815 37.0 37.0 37.0 37.0 37.0 45 36.47681451612903 37.0 37.0 37.0 37.0 37.0 46 36.489997467713344 37.0 37.0 37.0 37.0 37.0 47 36.570404505888376 37.0 37.0 37.0 37.0 37.0 48 36.58585055643879 37.0 37.0 37.0 37.0 37.0 49 36.64296166227685 37.0 37.0 37.0 37.0 37.0 50 36.86725309876049 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 3.0 24 8.0 25 13.0 26 10.0 27 18.0 28 15.0 29 30.0 30 25.0 31 47.0 32 69.0 33 87.0 34 143.0 35 303.0 36 3226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.599999999999994 17.724999999999998 12.4 35.275 2 28.95 24.55 25.874999999999996 20.625 3 25.974999999999998 24.3 24.7 25.025 4 28.425 27.825 18.75 25.0 5 29.599999999999998 29.125 20.925 20.349999999999998 6 25.575 33.025 20.150000000000002 21.25 7 23.9 19.275000000000002 32.6 24.224999999999998 8 24.425 23.3 23.5 28.775000000000002 9 24.25 21.3 26.75 27.700000000000003 10 25.974999999999998 29.349999999999998 21.75 22.925 11 28.375 23.125 20.7 27.800000000000004 12 27.650000000000002 21.675 22.725 27.950000000000003 13 25.35 24.675 23.325000000000003 26.650000000000002 14 26.424999999999997 26.05 23.45 24.075 15 27.05 24.65 23.225 25.074999999999996 16 26.950000000000003 23.925 22.175 26.950000000000003 17 28.525 23.724999999999998 23.225 24.525 18 26.650000000000002 24.875 23.075000000000003 25.4 19 28.1 24.425 22.025 25.45 20 26.8 24.175 23.7 25.324999999999996 21 26.625 24.45 23.275000000000002 25.650000000000002 22 27.125 24.55 23.525 24.8 23 27.025 24.825 22.900000000000002 25.25 24 26.924999999999997 24.55 22.85 25.674999999999997 25 26.400000000000002 24.2 22.525000000000002 26.875 26 27.250000000000004 23.625 23.775 25.35 27 27.85 24.05 23.65 24.45 28 25.724999999999998 22.975 23.65 27.650000000000002 29 26.875 25.825 21.95 25.35 30 27.825 24.6 23.075000000000003 24.5 31 27.325 23.575 22.75 26.35 32 28.175 25.424999999999997 22.075 24.325 33 25.924999999999997 24.5 23.799999999999997 25.775 34 25.35 24.525 24.525 25.6 35 26.081520380095025 24.50612653163291 24.85621405351338 24.55613903475869 36 26.21310655327664 23.81190595297649 23.736868434217108 26.23811905952976 37 28.446334751063297 22.91718789091819 23.317488116087066 25.31898924193145 38 26.651651651651655 24.874874874874877 22.44744744744745 26.026026026026027 39 27.666499749624435 25.41311967951928 22.8843264897346 24.036054081121684 40 26.548007019303082 24.291802456756077 22.93807971922788 26.222110804712962 41 27.076537013801754 24.441656210790462 22.534504391468005 25.947302383939775 42 26.93273092369478 25.301204819277107 22.816265060240966 24.949799196787147 43 27.20422004521477 23.86335091685506 24.74252700326551 24.189902034664655 44 28.183190739808754 23.07498741821842 23.477604428787117 25.26421741318571 45 26.184475806451612 24.29435483870968 24.269153225806452 25.252016129032256 46 25.829323879463157 23.778171689035197 23.62623448974424 26.766269941757407 47 27.700972862263185 23.14388120839734 23.886328725038403 25.268817204301076 48 26.974032856385797 23.105458399576044 23.767885532591414 26.15262321144674 49 25.81211589113257 17.968978636230613 26.455955516534974 29.762949956101842 50 28.18872451019592 0.0 34.986005597760894 36.82526989204318 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 5.0 26 8.0 27 10.0 28 7.5 29 10.5 30 19.0 31 23.0 32 25.0 33 34.5 34 50.0 35 69.0 36 88.5 37 105.0 38 129.0 39 160.5 40 173.5 41 198.0 42 232.5 43 245.0 44 263.0 45 295.0 46 311.0 47 314.5 48 321.0 49 309.5 50 297.5 51 300.0 52 306.0 53 286.5 54 257.5 55 251.0 56 245.5 57 235.0 58 238.5 59 222.0 60 186.5 61 176.5 62 171.0 63 151.0 64 135.0 65 133.5 66 130.0 67 114.5 68 105.0 69 97.5 70 85.5 71 85.5 72 88.5 73 74.0 74 56.0 75 50.5 76 48.0 77 39.5 78 29.0 79 20.5 80 14.5 81 12.0 82 10.0 83 8.5 84 6.5 85 4.0 86 2.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 1.0 36 1.0 37 1.0 38 2.0 39 5.0 40 4.0 41 1.0 42 3.0 43 7.0 44 6.0 45 19.0 46 43.0 47 132.0 48 357.0 49 916.0 50 2501.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03258655804481 97.25 2 0.5855397148676171 1.15 3 0.07637474541751527 0.22499999999999998 4 0.20366598778004072 0.8 5 0.05091649694501018 0.25 6 0.02545824847250509 0.15 7 0.02545824847250509 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCCATCTG 7 0.17500000000000002 No Hit GGGGGATCCTACGTTCCAAATGCAGCGAGCTCGTATAACCCTTTAAGAGT 6 0.15 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCTCGACG 5 0.125 No Hit GGGGGATCCTAGAGACCATTCGCGATTCCATGAGACTCCAAGGGTTCTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677129 spots for SRR9103009.sra Written 677129 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra Read 677118 spots for SRR9103009.sra Written 677118 spots for SRR9103009.sra SRR ids: ['SRR9103009.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zu2khx8a SRR9103009.sra spots: 13542371 blocks: [[1, 677118], [677119, 1354236], [1354237, 2031354], [2031355, 2708472], [2708473, 3385590], [3385591, 4062708], [4062709, 4739826], [4739827, 5416944], [5416945, 6094062], [6094063, 6771180], [6771181, 7448298], [7448299, 8125416], [8125417, 8802534], [8802535, 9479652], [9479653, 10156770], [10156771, 10833888], [10833889, 11511006], [11511007, 12188124], [12188125, 12865242], [12865243, 13542371]] SRR9103009 file size 1852061 SRR9103009 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103009 SRR9103009_1.fastq SRR9103009_2.fastq Input file: SRR9103009_1.fastq Paired file: SRR9103009_2.fastq trimmed: SRR9103009-trimmed-pair1.fastq, SRR9103009-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:25:00 2024 >> started Sat Dec 7 01:25:13 2024 >> done (13.583s) 13542371 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 13542371 (100.00%) read pairs available; of these: 394 ( 0.00%) trimmed read pairs available after processing 13541977 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 2 0.00% 34 362 0.00% 35 609 0.00% 36 861 0.01% 37 1142 0.01% 38 1742 0.01% 39 3121 0.02% 40 5972 0.04% 41 11382 0.08% 42 19031 0.14% 43 25768 0.19% 44 40876 0.30% 45 77160 0.57% 46 195384 1.44% 47 703812 5.20% 48 2616767 19.32% 49 6166341 45.53% 50 3672039 27.12% 13542371 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=24 prefix-density=1.38 prefix-fanout=1.0 sequence=ATCGCGGCCGCTCGACGTAGAACTCAATCTAAAACTTCGATTTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=310.96 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=30.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=36 prefix-density=1.82 prefix-fanout=1.0 sequence=ATCGCGGCCGCTCGACGTAGAACTCAATCTAAAACTTCGATTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=242.39 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=15.7 sequence=CGCCGCCGCCGA SRR9103009 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:25:37 Started mapping on | Dec 07 01:25:37 Finished on | Dec 07 01:26:16 Mapping speed, Million of reads per hour | 1250.07 Number of input reads | 13542371 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 12305933 Uniquely mapped reads % | 90.87% Average mapped length | 97.85 Number of splices: Total | 3345479 Number of splices: Annotated (sjdb) | 3195563 Number of splices: GT/AG | 3299617 Number of splices: GC/AG | 40862 Number of splices: AT/AC | 2536 Number of splices: Non-canonical | 2464 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236440 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 292669 % of reads mapped to too many loci | 2.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.40% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 999998 999998 999998 N_multimapping 236440 236440 236440 N_noFeature 294345 11908294 468436 N_ambiguous 242708 1347 19601 UnstrandedReadsAssigned:11768880 PositiveStrandReadsAssigned:396292 NegativeStrandReadsAssigned:11817896 Dataset is classified negative stranded MeadianReadLen=49 20thPercentileLength=48 echo kmer=43 SRR9103009 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103009-trimmed-pair1.fastq SRR9103009-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,542,371 reads, 12,007,563 reads pseudoaligned [quant] estimated average fragment length: 159.794 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR9103009.ke.tsv 35125 SRR9103009.se.tsv 88098 total ==> SRR9103009.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 777.387 177.078 26.7833 PNS24247 1044 885.206 0 0 PNS24249 1928 1769.21 116.449 7.73916 PNS24246 1044 885.206 0 0 PNS24248 1044 885.206 0 0 PNS24244 1471 1312.21 43.4733 3.89545 PNS24243 293 142.666 0 0 KQK14069 1603 1444.21 6858.97 558.427 KQK14071 474 316.658 179.264 66.5639 ==> SRR9103009.se.tsv <== BRADI_1g14170v3 7159 BRADI_1g53295v3 56 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 749 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 171 BRADI_1g48960v3 0 SRR9103009 completed mapping pipeline successfully