Starting /dee2/code/volunteer_pipeline.sh SRR9103010 current disk space = 1548127318016 free memory = 1598984448 SRR9103010 SRAfilesize 6983be6e52d55e6444d6352a3a79dc8a SRR9103010.sra SRR9103010.sra file validated SRR9103010 is paired end SRR9103010 is conventional basespace SRR9103010 read1 length is 36-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103010_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.032 33.0 33.0 33.0 33.0 33.0 2 29.597 33.0 27.0 33.0 14.0 33.0 3 31.723 33.0 33.0 33.0 27.0 33.0 4 33.04375 33.0 33.0 33.0 33.0 37.0 5 33.4 33.0 33.0 33.0 33.0 37.0 6 35.741 37.0 37.0 37.0 33.0 37.0 7 36.079 37.0 37.0 37.0 33.0 37.0 8 36.22925 37.0 37.0 37.0 37.0 37.0 9 36.4285 37.0 37.0 37.0 37.0 37.0 10 36.467 37.0 37.0 37.0 37.0 37.0 11 36.53 37.0 37.0 37.0 37.0 37.0 12 36.51325 37.0 37.0 37.0 37.0 37.0 13 36.5535 37.0 37.0 37.0 37.0 37.0 14 36.584 37.0 37.0 37.0 37.0 37.0 15 36.51475 37.0 37.0 37.0 37.0 37.0 16 36.58075 37.0 37.0 37.0 37.0 37.0 17 36.56875 37.0 37.0 37.0 37.0 37.0 18 36.538 37.0 37.0 37.0 37.0 37.0 19 36.55675 37.0 37.0 37.0 37.0 37.0 20 36.6405 37.0 37.0 37.0 37.0 37.0 21 36.58925 37.0 37.0 37.0 37.0 37.0 22 36.56075 37.0 37.0 37.0 37.0 37.0 23 36.5765 37.0 37.0 37.0 37.0 37.0 24 36.5835 37.0 37.0 37.0 37.0 37.0 25 36.63025 37.0 37.0 37.0 37.0 37.0 26 36.58475 37.0 37.0 37.0 37.0 37.0 27 36.63975 37.0 37.0 37.0 37.0 37.0 28 36.54175 37.0 37.0 37.0 37.0 37.0 29 36.50125 37.0 37.0 37.0 37.0 37.0 30 36.5505 37.0 37.0 37.0 37.0 37.0 31 36.51475 37.0 37.0 37.0 37.0 37.0 32 36.54 37.0 37.0 37.0 37.0 37.0 33 36.59225 37.0 37.0 37.0 37.0 37.0 34 36.6285 37.0 37.0 37.0 37.0 37.0 35 36.57825 37.0 37.0 37.0 37.0 37.0 36 36.60375 37.0 37.0 37.0 37.0 37.0 37 36.63781890945473 37.0 37.0 37.0 37.0 37.0 38 36.597747183979976 37.0 37.0 37.0 37.0 37.0 39 36.64230287859825 37.0 37.0 37.0 37.0 37.0 40 36.68887775551102 37.0 37.0 37.0 37.0 37.0 41 36.63732129420617 37.0 37.0 37.0 37.0 37.0 42 36.67277749874435 37.0 37.0 37.0 37.0 37.0 43 36.63087754588886 37.0 37.0 37.0 37.0 37.0 44 36.659268600252204 37.0 37.0 37.0 37.0 37.0 45 36.74342609139648 37.0 37.0 37.0 37.0 37.0 46 36.705497382198956 37.0 37.0 37.0 37.0 37.0 47 36.66787103946637 37.0 37.0 37.0 37.0 37.0 48 36.77661859466094 37.0 37.0 37.0 37.0 37.0 49 36.84453781512605 37.0 37.0 37.0 37.0 37.0 50 36.90077519379845 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 7.0 28 7.0 29 12.0 30 23.0 31 35.0 32 44.0 33 74.0 34 137.0 35 423.0 36 3236.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.625 8.674999999999999 11.1 50.6 2 23.325000000000003 16.8 30.325000000000003 29.549999999999997 3 24.575 19.2 24.175 32.05 4 26.8 22.675 21.125 29.4 5 25.05 27.200000000000003 25.0 22.75 6 22.5 28.725 25.224999999999998 23.549999999999997 7 19.725 24.7 33.025 22.55 8 22.05 24.9 27.975 25.074999999999996 9 21.925 23.200000000000003 29.875 25.0 10 23.549999999999997 28.775000000000002 24.15 23.525 11 24.075 25.575 23.549999999999997 26.8 12 24.675 23.7 23.974999999999998 27.650000000000002 13 24.625 24.95 24.95 25.474999999999998 14 23.674999999999997 25.1 25.05 26.174999999999997 15 24.625 24.775 24.05 26.55 16 24.975 24.75 23.375 26.900000000000002 17 25.174999999999997 25.074999999999996 24.725 25.025 18 24.85 24.275 24.925 25.95 19 23.549999999999997 24.975 24.725 26.75 20 23.849999999999998 25.424999999999997 24.975 25.75 21 24.45 23.875 25.674999999999997 26.0 22 24.075 25.2 23.625 27.1 23 24.2 25.4 24.975 25.424999999999997 24 22.875 26.35 24.375 26.400000000000002 25 24.95 24.625 23.225 27.200000000000003 26 24.05 26.1 22.775000000000002 27.075 27 24.175 25.25 24.275 26.3 28 25.775 23.799999999999997 23.200000000000003 27.224999999999998 29 23.75 26.575 23.75 25.924999999999997 30 23.849999999999998 25.0 24.5 26.650000000000002 31 24.224999999999998 25.424999999999997 23.5 26.85 32 24.175 24.8 25.95 25.074999999999996 33 23.575 24.725 25.025 26.674999999999997 34 24.5 26.35 24.325 24.825 35 24.474999999999998 24.65 24.425 26.450000000000003 36 24.474999999999998 24.5 23.775 27.250000000000004 37 25.86293146573287 25.41270635317659 24.037018509254626 24.68734367183592 38 24.755944931163956 24.405506883604506 24.25531914893617 26.583229036295368 39 23.979974968710888 23.85481852315394 25.256570713391742 26.90863579474343 40 26.252505010020037 23.79759519038076 22.995991983967937 26.95390781563126 41 24.329069475796338 25.482819162277405 23.6267870579383 26.56132430398796 42 24.208940231039676 24.610748367654445 24.886991461577097 26.293319939728782 43 25.320593412119692 23.686195624842846 23.88735227558461 27.105858687452855 44 24.79192938209332 25.321563682219423 23.60655737704918 26.279949558638084 45 24.840439111564976 23.997957620628032 25.606331376053106 25.555271891753893 46 25.70680628272251 23.115183246073297 23.272251308900525 27.905759162303667 47 25.041689827682045 23.235130628126736 25.208449138410227 26.51473040578099 48 24.363301626265727 21.08008591592513 25.06903958269408 29.487572875115063 49 23.914565826330534 18.977591036414566 26.57563025210084 30.532212885154063 50 26.098191214470283 0.0 36.07235142118863 37.82945736434108 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 3.0 22 2.5 23 5.5 24 10.5 25 9.0 26 5.5 27 5.5 28 12.5 29 24.5 30 34.5 31 43.5 32 46.5 33 56.0 34 81.5 35 113.0 36 141.0 37 157.0 38 171.0 39 191.0 40 196.5 41 206.0 42 239.5 43 265.5 44 274.0 45 285.0 46 296.5 47 305.5 48 313.0 49 321.0 50 330.0 51 301.5 52 254.5 53 249.5 54 259.0 55 240.5 56 224.5 57 221.0 58 217.5 59 193.5 60 160.0 61 146.5 62 140.0 63 141.5 64 146.5 65 136.5 66 122.5 67 112.0 68 98.5 69 91.5 70 91.0 71 88.0 72 77.0 73 57.5 74 47.5 75 43.0 76 35.5 77 31.0 78 26.5 79 21.5 80 15.5 81 12.0 82 9.0 83 6.0 84 4.5 85 4.0 86 3.5 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36 2.0 37 3.0 38 0.0 39 3.0 40 5.0 41 5.0 42 5.0 43 12.0 44 48.0 45 97.0 46 222.0 47 339.0 48 403.0 49 921.0 50 1935.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90613075553294 97.2 2 0.7122869498855253 1.4000000000000001 3 0.2035105571101501 0.6 4 0.10175527855507505 0.4 5 0.05087763927753752 0.25 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCTCGACG 6 0.15 No Hit CTAGTATGGCCCGGGGGATCCTTATCTGTCAAAACCGCTAATGTCCGTTC 5 0.125 No Hit GGGGGATCCTACGTTCCAAATGCAGCGAGCTCGTATAACCCTTTAAGAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103010 read2 length is 35-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103010_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.009 33.0 33.0 33.0 33.0 33.0 2 32.5705 33.0 33.0 33.0 33.0 33.0 3 32.57525 33.0 33.0 33.0 33.0 33.0 4 32.65575 33.0 33.0 33.0 33.0 33.0 5 32.73875 33.0 33.0 33.0 33.0 33.0 6 36.293 37.0 37.0 37.0 37.0 37.0 7 36.28125 37.0 37.0 37.0 37.0 37.0 8 36.3585 37.0 37.0 37.0 37.0 37.0 9 36.32975 37.0 37.0 37.0 37.0 37.0 10 36.259 37.0 37.0 37.0 37.0 37.0 11 36.2595 37.0 37.0 37.0 37.0 37.0 12 36.2135 37.0 37.0 37.0 37.0 37.0 13 36.25525 37.0 37.0 37.0 37.0 37.0 14 36.28525 37.0 37.0 37.0 37.0 37.0 15 36.36925 37.0 37.0 37.0 37.0 37.0 16 36.318 37.0 37.0 37.0 37.0 37.0 17 36.341 37.0 37.0 37.0 37.0 37.0 18 36.3425 37.0 37.0 37.0 37.0 37.0 19 36.23875 37.0 37.0 37.0 37.0 37.0 20 36.268 37.0 37.0 37.0 37.0 37.0 21 36.30025 37.0 37.0 37.0 37.0 37.0 22 36.21675 37.0 37.0 37.0 37.0 37.0 23 36.2645 37.0 37.0 37.0 37.0 37.0 24 36.166 37.0 37.0 37.0 37.0 37.0 25 36.2835 37.0 37.0 37.0 37.0 37.0 26 36.28525 37.0 37.0 37.0 37.0 37.0 27 36.26 37.0 37.0 37.0 37.0 37.0 28 36.328 37.0 37.0 37.0 37.0 37.0 29 36.3595 37.0 37.0 37.0 37.0 37.0 30 36.38025 37.0 37.0 37.0 37.0 37.0 31 36.44725 37.0 37.0 37.0 37.0 37.0 32 36.34625 37.0 37.0 37.0 37.0 37.0 33 36.442 37.0 37.0 37.0 37.0 37.0 34 36.3625 37.0 37.0 37.0 37.0 37.0 35 36.41325 37.0 37.0 37.0 37.0 37.0 36 36.33358339584896 37.0 37.0 37.0 37.0 37.0 37 36.42978723404255 37.0 37.0 37.0 37.0 37.0 38 36.476584022038566 37.0 37.0 37.0 37.0 37.0 39 36.51052631578948 37.0 37.0 37.0 37.0 37.0 40 36.426028084252756 37.0 37.0 37.0 37.0 37.0 41 36.49535759096612 37.0 37.0 37.0 37.0 37.0 42 36.532898041185334 37.0 37.0 37.0 37.0 37.0 43 36.484041216386025 37.0 37.0 37.0 37.0 37.0 44 36.546941857538386 37.0 37.0 37.0 37.0 37.0 45 36.47916140439505 37.0 37.0 37.0 37.0 37.0 46 36.43951306112098 37.0 37.0 37.0 37.0 37.0 47 36.50346420323326 37.0 37.0 37.0 37.0 37.0 48 36.55699893955461 37.0 37.0 37.0 37.0 37.0 49 36.6913257905425 37.0 37.0 37.0 37.0 37.0 50 36.873448137765315 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 9.0 25 10.0 26 6.0 27 12.0 28 22.0 29 23.0 30 33.0 31 47.0 32 56.0 33 72.0 34 141.0 35 274.0 36 3292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 19.175 10.975 31.8 2 28.425 25.674999999999997 25.15 20.75 3 24.9 25.924999999999997 25.8 23.375 4 26.8 29.525000000000002 19.275000000000002 24.4 5 28.9 30.75 18.325 22.025 6 24.4 32.300000000000004 21.349999999999998 21.95 7 24.875 19.05 30.475 25.6 8 24.349999999999998 22.15 22.925 30.575000000000003 9 23.375 23.425 24.9 28.299999999999997 10 26.575 29.075 20.724999999999998 23.625 11 28.675 22.35 21.475 27.500000000000004 12 26.85 20.775 23.549999999999997 28.825 13 25.825 22.325 24.55 27.3 14 26.525 24.825 23.225 25.424999999999997 15 25.25 23.75 24.5 26.5 16 28.65 23.025000000000002 22.075 26.25 17 27.625 24.05 23.225 25.1 18 26.924999999999997 25.775 22.175 25.124999999999996 19 27.950000000000003 24.0 22.900000000000002 25.15 20 26.075 25.324999999999996 24.075 24.525 21 25.55 24.75 23.65 26.05 22 26.400000000000002 24.099999999999998 23.1 26.400000000000002 23 26.325 24.775 22.775000000000002 26.125 24 26.55 23.9 25.15 24.4 25 28.025 22.925 23.200000000000003 25.85 26 28.575 23.599999999999998 24.425 23.400000000000002 27 27.900000000000002 23.325000000000003 23.95 24.825 28 27.275 23.075000000000003 22.525000000000002 27.125 29 25.55 26.200000000000003 23.325000000000003 24.925 30 26.625 25.05 23.7 24.625 31 27.575 23.400000000000002 22.8 26.224999999999998 32 27.800000000000004 24.075 22.975 25.15 33 26.55 24.9 23.425 25.124999999999996 34 27.250000000000004 23.200000000000003 23.549999999999997 26.0 35 27.825 22.375 23.724999999999998 26.075 36 26.431607901975497 24.58114528632158 23.455863965991497 25.531382845711427 37 28.86107634543179 22.503128911138923 22.528160200250312 26.107634543178975 38 26.84698221888305 24.61808164287503 22.28900576008014 26.245930378161788 39 25.664160401002505 24.561403508771928 23.809523809523807 25.964912280701753 40 27.181544633901705 23.696088264794383 23.319959879638915 25.802407221664996 41 26.17314930991217 23.03638644918444 23.41279799247177 27.37766624843162 42 26.519337016574585 23.932697137117025 23.95781014565545 25.59015570065294 43 27.670268911786884 23.045991455139482 23.121387283236995 26.16235234983664 44 26.5794110244148 23.986911653662222 23.231814749559526 26.201862572363453 45 26.294518817883304 21.94998737054812 26.572366759282644 25.18312705228593 46 28.45549074308902 22.875982754248035 23.433933553132132 25.234592949530814 47 27.79060816012317 22.91506286887349 23.50526045676161 25.789068514241727 48 26.80275715800636 22.985153764581124 23.462354188759278 26.749734888653236 49 28.140411952422394 18.102697998259355 25.558456628952715 28.198433420365536 50 29.034841810172207 0.0 36.16339607529035 34.801762114537446 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.0 25 2.5 26 6.0 27 9.5 28 10.5 29 9.5 30 9.5 31 14.0 32 23.0 33 37.0 34 55.5 35 65.5 36 72.0 37 106.5 38 135.5 39 146.5 40 173.5 41 215.5 42 243.0 43 253.0 44 265.0 45 280.5 46 300.0 47 319.0 48 336.0 49 339.0 50 335.5 51 321.5 52 283.5 53 245.5 54 236.0 55 231.5 56 214.5 57 215.0 58 223.5 59 200.0 60 175.5 61 169.5 62 160.5 63 146.0 64 135.0 65 144.0 66 154.0 67 144.0 68 133.0 69 116.0 70 93.5 71 83.0 72 77.5 73 69.0 74 58.5 75 48.5 76 40.5 77 38.0 78 37.0 79 31.0 80 23.5 81 17.0 82 11.5 83 9.5 84 8.0 85 4.5 86 1.5 87 2.5 88 3.0 89 2.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 4.0 37 2.0 38 3.0 39 2.0 40 3.0 41 3.0 42 3.0 43 6.0 44 14.0 45 16.0 46 46.0 47 125.0 48 325.0 49 950.0 50 2497.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0023023791251 96.75 2 0.5372217958557176 1.05 3 0.17907393195190585 0.525 4 0.051163980557687394 0.2 5 0.07674597083653108 0.375 6 0.051163980557687394 0.3 7 0.051163980557687394 0.35000000000000003 8 0.0 0.0 9 0.051163980557687394 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGATCCTTATCTGTCAAAACCGCTAATGTCCGTTCTAAGACCGTCTG 9 0.22499999999999998 No Hit GGGGGATCCTAGAGACCATTCGCGATTCCATGAGACTCCAAGGGTTCTGC 9 0.22499999999999998 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCTCGACG 7 0.17500000000000002 No Hit ACTGGATGCATCTGCAGGATATCGCGGCCGCCATCTGCCCTACGTTTG 7 0.17500000000000002 No Hit GGGGGATCCGTATACGTTTCTAATTTGTAGTTAACGGTTGGATACCACTT 6 0.15 No Hit GGGGGATCCTACGTTCCAAATGCAGCGAGCTCGTATAACCCTTTAAGAGT 6 0.15 No Hit CTGCAGGATATCGCGGCCGCGTCTTCAGAGGGGGATAGCATGACCTCACG 5 0.125 No Hit GATCCGTTAGCTATCGTTCGCGAGAAAGTTAGTAGACACACAGGACCC 5 0.125 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCCATCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827640 spots for SRR9103010.sra Written 827640 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra Read 827629 spots for SRR9103010.sra Written 827629 spots for SRR9103010.sra SRR ids: ['SRR9103010.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tqq7mbct SRR9103010.sra spots: 16552591 blocks: [[1, 827629], [827630, 1655258], [1655259, 2482887], [2482888, 3310516], [3310517, 4138145], [4138146, 4965774], [4965775, 5793403], [5793404, 6621032], [6621033, 7448661], [7448662, 8276290], [8276291, 9103919], [9103920, 9931548], [9931549, 10759177], [10759178, 11586806], [11586807, 12414435], [12414436, 13242064], [13242065, 14069693], [14069694, 14897322], [14897323, 15724951], [15724952, 16552591]] SRR9103010 file size 2272250 SRR9103010 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103010 SRR9103010_1.fastq SRR9103010_2.fastq Input file: SRR9103010_1.fastq Paired file: SRR9103010_2.fastq trimmed: SRR9103010-trimmed-pair1.fastq, SRR9103010-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:31:07 2024 >> started Sat Dec 7 01:31:21 2024 >> done (14.152s) 16552591 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 16552591 (100.00%) read pairs available; of these: 197 ( 0.00%) trimmed read pairs available after processing 16552394 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 3 0.00% 34 323 0.00% 35 415 0.00% 36 598 0.00% 37 912 0.01% 38 1521 0.01% 39 2954 0.02% 40 6189 0.04% 41 12480 0.08% 42 23809 0.14% 43 32161 0.19% 44 51938 0.31% 45 101971 0.62% 46 258657 1.56% 47 867779 5.24% 48 2851229 17.23% 49 7023757 42.43% 50 5315895 32.12% 16552591 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=32 prefix-density=1.81 prefix-fanout=1.0 sequence=ATCGCGGCCGCTCGACGTAGAACTCAATCTAAAACTTCGATTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=343.30 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=30.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=34 prefix-density=2.27 prefix-fanout=1.0 sequence=ATCGCGGCCGCTCGACGTAGAACTCAATCTAAAACTTCGATTTGCAAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=301.31 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=16.0 sequence=CGCCGCCGCCGG SRR9103010 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:31:51 Started mapping on | Dec 07 01:31:52 Finished on | Dec 07 01:32:29 Mapping speed, Million of reads per hour | 1610.52 Number of input reads | 16552591 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 15147897 Uniquely mapped reads % | 91.51% Average mapped length | 98.03 Number of splices: Total | 4179169 Number of splices: Annotated (sjdb) | 4004093 Number of splices: GT/AG | 4123459 Number of splices: GC/AG | 49562 Number of splices: AT/AC | 3197 Number of splices: Non-canonical | 2951 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285874 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 123414 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.79% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1118820 1118820 1118820 N_multimapping 285874 285874 285874 N_noFeature 328368 14736135 490689 N_ambiguous 269242 1387 20334 UnstrandedReadsAssigned:14550287 PositiveStrandReadsAssigned:410375 NegativeStrandReadsAssigned:14636874 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=48 echo kmer=43 SRR9103010 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103010-trimmed-pair1.fastq SRR9103010-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,552,591 reads, 14,873,685 reads pseudoaligned [quant] estimated average fragment length: 161.083 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,310 rounds 52973 SRR9103010.ke.tsv 35125 SRR9103010.se.tsv 88098 total ==> SRR9103010.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.058 0 0 PNS24247 1044 883.917 37.6057 4.03467 PNS24249 1928 1767.92 210.546 11.2941 PNS24246 1044 883.917 37.6057 4.03467 PNS24248 1044 883.917 37.6057 4.03467 PNS24244 1471 1310.92 30.6372 2.21635 PNS24243 293 140.765 0 0 KQK14069 1603 1442.92 4781.87 314.284 KQK14071 474 315.625 84.0846 25.2645 ==> SRR9103010.se.tsv <== BRADI_1g14170v3 4952 BRADI_1g53295v3 9 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 980 BRADI_1g74790v3 23 BRADI_1g09890v3 0 BRADI_1g77505v3 170 BRADI_1g48960v3 0 SRR9103010 completed mapping pipeline successfully