Starting /dee2/code/volunteer_pipeline.sh SRR9103011 current disk space = 1548137955328 free memory = 1597133448 SRR9103011 SRAfilesize 6f65f52e3e1abc7ea5e033c4677473e1 SRR9103011.sra SRR9103011.sra file validated SRR9103011 is paired end SRR9103011 is conventional basespace SRR9103011 read1 length is 35-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103011_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.041 33.0 33.0 33.0 33.0 33.0 2 28.87725 33.0 27.0 33.0 14.0 33.0 3 31.30325 33.0 33.0 33.0 27.0 33.0 4 32.617 33.0 33.0 33.0 27.0 37.0 5 33.256 33.0 33.0 33.0 33.0 37.0 6 35.5095 37.0 37.0 37.0 33.0 37.0 7 36.06475 37.0 37.0 37.0 33.0 37.0 8 36.363 37.0 37.0 37.0 37.0 37.0 9 36.4715 37.0 37.0 37.0 37.0 37.0 10 36.44 37.0 37.0 37.0 37.0 37.0 11 36.50825 37.0 37.0 37.0 37.0 37.0 12 36.443 37.0 37.0 37.0 37.0 37.0 13 36.4805 37.0 37.0 37.0 37.0 37.0 14 36.353 37.0 37.0 37.0 37.0 37.0 15 36.38325 37.0 37.0 37.0 37.0 37.0 16 36.4155 37.0 37.0 37.0 37.0 37.0 17 36.45625 37.0 37.0 37.0 37.0 37.0 18 36.5485 37.0 37.0 37.0 37.0 37.0 19 36.46225 37.0 37.0 37.0 37.0 37.0 20 36.441 37.0 37.0 37.0 37.0 37.0 21 36.50675 37.0 37.0 37.0 37.0 37.0 22 36.4895 37.0 37.0 37.0 37.0 37.0 23 36.55625 37.0 37.0 37.0 37.0 37.0 24 36.491 37.0 37.0 37.0 37.0 37.0 25 36.45625 37.0 37.0 37.0 37.0 37.0 26 36.505 37.0 37.0 37.0 37.0 37.0 27 36.41225 37.0 37.0 37.0 37.0 37.0 28 36.426 37.0 37.0 37.0 37.0 37.0 29 36.34775 37.0 37.0 37.0 37.0 37.0 30 36.40175 37.0 37.0 37.0 37.0 37.0 31 36.463 37.0 37.0 37.0 37.0 37.0 32 36.43225 37.0 37.0 37.0 37.0 37.0 33 36.4235 37.0 37.0 37.0 37.0 37.0 34 36.45275 37.0 37.0 37.0 37.0 37.0 35 36.40925 37.0 37.0 37.0 37.0 37.0 36 36.4706176544136 37.0 37.0 37.0 37.0 37.0 37 36.46136534133533 37.0 37.0 37.0 37.0 37.0 38 36.50625312656328 37.0 37.0 37.0 37.0 37.0 39 36.532516258129064 37.0 37.0 37.0 37.0 37.0 40 36.452565707133914 37.0 37.0 37.0 37.0 37.0 41 36.48084147257701 37.0 37.0 37.0 37.0 37.0 42 36.50814740536475 37.0 37.0 37.0 37.0 37.0 43 36.4948375723999 37.0 37.0 37.0 37.0 37.0 44 36.511274385609326 37.0 37.0 37.0 37.0 37.0 45 36.55331117361289 37.0 37.0 37.0 37.0 37.0 46 36.56828885400314 37.0 37.0 37.0 37.0 37.0 47 36.53778023802934 37.0 37.0 37.0 37.0 37.0 48 36.68847447263834 37.0 37.0 37.0 37.0 37.0 49 36.77841520258157 37.0 37.0 37.0 37.0 37.0 50 36.8616480162767 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 5.0 27 12.0 28 14.0 29 16.0 30 30.0 31 54.0 32 51.0 33 99.0 34 163.0 35 477.0 36 3075.0 37 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 65.85 6.950000000000001 8.575000000000001 18.625 2 23.43085771442861 14.57864466116529 28.08202050512628 33.908477119279816 3 23.799999999999997 20.175 24.175 31.85 4 28.95 22.55 22.275 26.224999999999998 5 25.324999999999996 25.624999999999996 25.775 23.275000000000002 6 21.925 27.0 26.724999999999998 24.349999999999998 7 22.6 23.849999999999998 30.125 23.425 8 20.25 22.400000000000002 29.425 27.925 9 21.95 23.65 29.525000000000002 24.875 10 26.05 26.400000000000002 23.45 24.099999999999998 11 26.224999999999998 22.8 23.125 27.85 12 23.724999999999998 22.650000000000002 25.5 28.125 13 26.55 22.45 24.425 26.575 14 23.925 23.925 26.25 25.900000000000002 15 25.2 22.475 24.7 27.625 16 25.974999999999998 23.775 23.025000000000002 27.224999999999998 17 23.625 25.55 24.975 25.85 18 24.325 24.075 24.45 27.150000000000002 19 25.85 24.0 23.875 26.275 20 25.275 24.075 24.975 25.674999999999997 21 24.325 24.175 25.15 26.35 22 25.624999999999996 24.2 23.150000000000002 27.025 23 25.074999999999996 23.674999999999997 24.975 26.275 24 24.15 23.599999999999998 25.124999999999996 27.125 25 26.525 23.1 23.175 27.200000000000003 26 24.325 25.275 23.799999999999997 26.6 27 24.875 24.0 24.525 26.6 28 26.150000000000002 25.15 23.375 25.324999999999996 29 25.674999999999997 23.974999999999998 24.224999999999998 26.125 30 25.3 23.150000000000002 24.2 27.35 31 25.0 23.9 24.8 26.3 32 24.8 23.575 25.424999999999997 26.200000000000003 33 26.375 23.275000000000002 24.275 26.075 34 26.474999999999998 24.5 22.225 26.8 35 24.3 24.825 24.25 26.625 36 25.006251562890725 24.456114028507127 23.005751437859466 27.53188297074269 37 25.206301575393848 23.23080770192548 24.831207801950487 26.731682920730183 38 25.212606303151574 25.03751875937969 23.861930965482742 25.887943971985994 39 24.062031015507753 24.262131065532767 24.787393696848426 26.88844422211106 40 27.2090112640801 23.103879849812266 23.879849812265334 25.807259073842303 41 25.870272977710997 24.94365138993238 23.56624092161282 25.6198347107438 42 24.893457006768614 24.442216094259212 25.169215342191027 25.495111556781147 43 26.013598589775878 22.261395114580708 25.48476454293629 26.240241752707128 44 23.28350646060299 23.33417785659995 25.51304788446922 27.869267798327847 45 25.620046024034774 22.98644847864996 24.367169521861417 27.026335975453847 46 26.63526949241235 21.08843537414966 24.620617477760334 27.655677655677657 47 24.079712150567396 22.80653196789372 25.24218101300858 27.871574868530306 48 25.252216447569552 19.749312136961176 26.16936716600428 28.829104249464994 49 27.393330942990318 16.636787378988885 26.138400860523486 29.831480817497315 50 25.68667344862665 0.0 36.876907426246184 37.43641912512716 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 2.0 24 1.0 25 4.5 26 9.5 27 13.0 28 13.0 29 18.5 30 30.0 31 36.0 32 41.0 33 50.5 34 63.5 35 81.5 36 98.0 37 115.5 38 130.0 39 148.5 40 170.0 41 195.5 42 226.5 43 265.0 44 290.0 45 285.0 46 289.5 47 306.0 48 320.0 49 330.5 50 326.5 51 298.5 52 281.5 53 280.0 54 265.0 55 240.5 56 220.0 57 209.5 58 206.5 59 190.5 60 167.0 61 165.0 62 172.0 63 157.0 64 141.0 65 143.5 66 140.5 67 129.5 68 122.0 69 115.5 70 108.0 71 95.0 72 83.0 73 73.0 74 58.5 75 50.0 76 48.0 77 33.5 78 17.5 79 17.0 80 17.0 81 13.5 82 10.0 83 8.0 84 6.5 85 4.5 86 2.5 87 2.0 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 1.0 38 0.0 39 3.0 40 2.0 41 4.0 42 18.0 43 24.0 44 36.0 45 89.0 46 209.0 47 342.0 48 482.0 49 823.0 50 1966.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103011 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103011_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01 33.0 33.0 33.0 33.0 33.0 2 32.37725 33.0 33.0 33.0 33.0 33.0 3 32.3305 33.0 33.0 33.0 33.0 33.0 4 32.433 33.0 33.0 33.0 33.0 33.0 5 32.42825 33.0 33.0 33.0 33.0 33.0 6 35.7985 37.0 37.0 37.0 33.0 37.0 7 35.80425 37.0 37.0 37.0 33.0 37.0 8 35.7975 37.0 37.0 37.0 33.0 37.0 9 35.89975 37.0 37.0 37.0 33.0 37.0 10 35.6465 37.0 37.0 37.0 33.0 37.0 11 35.83375 37.0 37.0 37.0 33.0 37.0 12 35.7505 37.0 37.0 37.0 33.0 37.0 13 35.783 37.0 37.0 37.0 33.0 37.0 14 35.81275 37.0 37.0 37.0 33.0 37.0 15 35.86375 37.0 37.0 37.0 33.0 37.0 16 35.84425 37.0 37.0 37.0 37.0 37.0 17 35.79075 37.0 37.0 37.0 33.0 37.0 18 35.8665 37.0 37.0 37.0 33.0 37.0 19 35.80475 37.0 37.0 37.0 37.0 37.0 20 35.75725 37.0 37.0 37.0 33.0 37.0 21 35.81175 37.0 37.0 37.0 33.0 37.0 22 35.6785 37.0 37.0 37.0 33.0 37.0 23 35.75775 37.0 37.0 37.0 33.0 37.0 24 35.72575 37.0 37.0 37.0 33.0 37.0 25 35.79825 37.0 37.0 37.0 33.0 37.0 26 35.76625 37.0 37.0 37.0 33.0 37.0 27 35.81525 37.0 37.0 37.0 33.0 37.0 28 35.8045 37.0 37.0 37.0 33.0 37.0 29 35.8765 37.0 37.0 37.0 37.0 37.0 30 35.885 37.0 37.0 37.0 33.0 37.0 31 35.816 37.0 37.0 37.0 33.0 37.0 32 35.858 37.0 37.0 37.0 33.0 37.0 33 35.95925 37.0 37.0 37.0 37.0 37.0 34 35.8925 37.0 37.0 37.0 37.0 37.0 35 35.9072036018009 37.0 37.0 37.0 37.0 37.0 36 35.80515902829952 37.0 37.0 37.0 33.0 37.0 37 35.94783044895912 37.0 37.0 37.0 37.0 37.0 38 35.97514436354507 37.0 37.0 37.0 37.0 37.0 39 36.006782215523735 37.0 37.0 37.0 37.0 37.0 40 36.08999497234792 37.0 37.0 37.0 37.0 37.0 41 36.10085728693898 37.0 37.0 37.0 37.0 37.0 42 36.0532693764201 37.0 37.0 37.0 37.0 37.0 43 36.16641375821953 37.0 37.0 37.0 37.0 37.0 44 36.10502283105023 37.0 37.0 37.0 37.0 37.0 45 36.16819338422392 37.0 37.0 37.0 37.0 37.0 46 36.24923076923077 37.0 37.0 37.0 37.0 37.0 47 36.32328482328482 37.0 37.0 37.0 37.0 37.0 48 36.390977443609025 37.0 37.0 37.0 37.0 37.0 49 36.55591619946887 37.0 37.0 37.0 37.0 37.0 50 36.80064308681672 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 7.0 23 13.0 24 18.0 25 26.0 26 24.0 27 34.0 28 53.0 29 52.0 30 50.0 31 63.0 32 88.0 33 83.0 34 132.0 35 308.0 36 3045.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.55 18.3 10.45 18.7 2 24.3 22.400000000000002 24.375 28.925 3 24.925 25.45 25.174999999999997 24.45 4 29.375 27.925 17.474999999999998 25.224999999999998 5 26.525 32.25 19.650000000000002 21.575 6 23.375 27.075 23.7 25.85 7 26.424999999999997 21.0 25.8 26.775 8 21.75 21.75 26.05 30.45 9 24.4 23.7 24.7 27.200000000000003 10 27.400000000000002 26.525 20.625 25.45 11 28.325 23.075000000000003 20.674999999999997 27.925 12 27.500000000000004 23.025000000000002 22.25 27.224999999999998 13 28.325 23.775 21.375 26.525 14 25.900000000000002 23.825 24.6 25.674999999999997 15 26.5 24.099999999999998 23.075000000000003 26.325 16 28.199999999999996 23.05 21.875 26.875 17 27.075 24.6 23.150000000000002 25.174999999999997 18 27.075 23.175 22.675 27.075 19 28.799999999999997 22.025 22.325 26.85 20 26.85 23.474999999999998 24.125 25.55 21 27.450000000000003 23.025000000000002 23.05 26.474999999999998 22 27.450000000000003 23.200000000000003 21.55 27.800000000000004 23 26.25 24.8 22.325 26.625 24 27.725 23.875 22.775000000000002 25.624999999999996 25 28.4 23.275000000000002 22.275 26.05 26 27.775 25.374999999999996 21.975 24.875 27 27.275 24.675 22.725 25.324999999999996 28 27.900000000000002 24.0 21.025 27.075 29 26.974999999999998 24.925 22.75 25.35 30 26.6 23.525 24.65 25.224999999999998 31 28.449999999999996 22.15 21.8 27.6 32 26.85 24.325 22.125 26.700000000000003 33 26.35 24.025 23.400000000000002 26.224999999999998 34 29.349999999999998 23.25 22.2 25.2 35 27.01350675337669 23.861930965482742 23.111555777888945 26.013006503251624 36 25.79514149762084 25.19408965689958 22.99023290758828 26.02053593789131 37 27.514421871081012 23.325808878856282 24.003009781790823 25.156759468271883 38 26.86417273412001 23.801154908360534 23.675621390911374 25.65905096660808 39 26.249686008540568 23.411203215272543 23.059532780708363 27.279577995478522 40 25.917546505781804 23.30316742081448 23.78079436902966 26.998491704374057 41 26.39939485627837 23.2476046394352 23.701462430660616 26.65153807362582 42 25.044180762433726 24.21105781368341 23.75662711436506 26.988134309517797 43 27.718765806777945 23.26757713707638 22.812341932220537 26.20131512392514 44 27.397260273972602 24.759005580923386 22.628107559614406 25.2156265854896 45 25.87786259541985 23.435114503816795 24.12213740458015 26.564885496183205 46 26.846153846153847 24.205128205128204 22.358974358974358 26.58974358974359 47 27.494802494802496 24.87006237006237 22.55717255717256 25.077962577962577 48 27.09452201933405 21.40171858216971 25.02685284640172 26.47690655209452 49 28.179403953968723 16.907642372381236 25.46473886102095 29.448214812629093 50 28.536977491961412 0.0 34.565916398713824 36.89710610932476 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 3.0 26 6.0 27 5.5 28 6.0 29 12.5 30 18.0 31 22.0 32 25.5 33 29.0 34 37.5 35 55.5 36 76.0 37 93.5 38 114.5 39 148.5 40 176.0 41 185.5 42 197.0 43 241.5 44 284.5 45 284.0 46 285.5 47 303.5 48 318.5 49 324.5 50 312.5 51 279.5 52 254.0 53 256.5 54 266.5 55 246.0 56 221.5 57 211.0 58 200.0 59 206.5 60 213.5 61 193.5 62 168.5 63 163.0 64 159.5 65 148.5 66 143.0 67 139.0 68 133.5 69 125.5 70 114.0 71 105.5 72 99.5 73 83.5 74 68.5 75 64.0 76 60.5 77 53.0 78 45.0 79 30.0 80 17.0 81 18.5 82 18.0 83 10.0 84 2.5 85 4.5 86 7.0 87 4.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 2.0 35 5.0 36 6.0 37 4.0 38 2.0 39 3.0 40 12.0 41 5.0 42 7.0 43 12.0 44 12.0 45 30.0 46 52.0 47 124.0 48 335.0 49 901.0 50 2488.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537206 spots for SRR9103011.sra Written 537206 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra Read 537192 spots for SRR9103011.sra Written 537192 spots for SRR9103011.sra SRR ids: ['SRR9103011.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z6564d8_ SRR9103011.sra spots: 10743854 blocks: [[1, 537192], [537193, 1074384], [1074385, 1611576], [1611577, 2148768], [2148769, 2685960], [2685961, 3223152], [3223153, 3760344], [3760345, 4297536], [4297537, 4834728], [4834729, 5371920], [5371921, 5909112], [5909113, 6446304], [6446305, 6983496], [6983497, 7520688], [7520689, 8057880], [8057881, 8595072], [8595073, 9132264], [9132265, 9669456], [9669457, 10206648], [10206649, 10743854]] SRR9103011 file size 1468710 SRR9103011 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103011 SRR9103011_1.fastq SRR9103011_2.fastq Input file: SRR9103011_1.fastq Paired file: SRR9103011_2.fastq trimmed: SRR9103011-trimmed-pair1.fastq, SRR9103011-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:33:04 2024 >> started Sat Dec 7 01:33:14 2024 >> done (9.656s) 10743854 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 10743854 (100.00%) read pairs available; of these: 229 ( 0.00%) trimmed read pairs available after processing 10743625 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 2 0.00% 34 134 0.00% 35 238 0.00% 36 399 0.00% 37 630 0.01% 38 1076 0.01% 39 2096 0.02% 40 4766 0.04% 41 11797 0.11% 42 27014 0.25% 43 33708 0.31% 44 48994 0.46% 45 87324 0.81% 46 197586 1.84% 47 545308 5.08% 48 1667801 15.52% 49 4568349 42.52% 50 3546632 33.01% 10743854 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=95.76 fanout-score-rank=11 prefix-density=0.33 prefix-fanout=15.3 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=219.84 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=20.5 sequence=GCGGCGGCGGAGG criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=119.12 fanout-score-rank=15 prefix-density=0.70 prefix-fanout=18.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=337.16 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=18.1 sequence=CGCCGCCGCCACC SRR9103011 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:33:31 Started mapping on | Dec 07 01:33:32 Finished on | Dec 07 01:33:48 Mapping speed, Million of reads per hour | 2417.37 Number of input reads | 10743854 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 9849847 Uniquely mapped reads % | 91.68% Average mapped length | 98.06 Number of splices: Total | 2781769 Number of splices: Annotated (sjdb) | 2666741 Number of splices: GT/AG | 2744750 Number of splices: GC/AG | 33652 Number of splices: AT/AC | 1780 Number of splices: Non-canonical | 1587 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 175255 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 74545 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.79% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718752 718752 718752 N_multimapping 175255 175255 175255 N_noFeature 217797 9562768 346106 N_ambiguous 172930 1118 14507 UnstrandedReadsAssigned:9459120 PositiveStrandReadsAssigned:285961 NegativeStrandReadsAssigned:9489234 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=48 echo kmer=43 SRR9103011 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103011-trimmed-pair1.fastq SRR9103011-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,743,854 reads, 9,719,920 reads pseudoaligned [quant] estimated average fragment length: 158.411 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR9103011.ke.tsv 35125 SRR9103011.se.tsv 88098 total ==> SRR9103011.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 778.817 55.0456 10.7533 PNS24247 1044 886.589 10.8673 1.8649 PNS24249 1928 1770.59 139.563 11.9925 PNS24246 1044 886.589 10.8673 1.8649 PNS24248 1044 886.589 10.8673 1.8649 PNS24244 1471 1313.59 48.789 5.65089 PNS24243 293 142.478 2 2.13569 KQK14069 1603 1445.59 3419.59 359.902 KQK14071 474 318.203 198.541 94.9295 ==> SRR9103011.se.tsv <== BRADI_1g14170v3 3614 BRADI_1g53295v3 27 BRADI_1g59795v3 79 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 466 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 90 BRADI_1g48960v3 1 SRR9103011 completed mapping pipeline successfully