Starting /dee2/code/volunteer_pipeline.sh SRR9103012 current disk space = 1548135047168 free memory = 1599253628 SRR9103012 SRAfilesize c4940d2df71217de9f8b4347c1ec0637 SRR9103012.sra SRR9103012.sra file validated SRR9103012 is paired end SRR9103012 is conventional basespace SRR9103012 read1 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103012_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.087 33.0 33.0 33.0 33.0 33.0 2 30.98025 33.0 27.0 33.0 27.0 37.0 3 31.8975 33.0 27.0 37.0 27.0 37.0 4 33.68625 33.0 33.0 37.0 33.0 37.0 5 34.70375 37.0 33.0 37.0 33.0 37.0 6 36.168 37.0 37.0 37.0 33.0 37.0 7 36.38875 37.0 37.0 37.0 37.0 37.0 8 36.42375 37.0 37.0 37.0 37.0 37.0 9 36.55625 37.0 37.0 37.0 37.0 37.0 10 36.5755 37.0 37.0 37.0 37.0 37.0 11 36.5935 37.0 37.0 37.0 37.0 37.0 12 36.625 37.0 37.0 37.0 37.0 37.0 13 36.52175 37.0 37.0 37.0 37.0 37.0 14 36.56275 37.0 37.0 37.0 37.0 37.0 15 36.556 37.0 37.0 37.0 37.0 37.0 16 36.55525 37.0 37.0 37.0 37.0 37.0 17 36.6195 37.0 37.0 37.0 37.0 37.0 18 36.611 37.0 37.0 37.0 37.0 37.0 19 36.597 37.0 37.0 37.0 37.0 37.0 20 36.587 37.0 37.0 37.0 37.0 37.0 21 36.59725 37.0 37.0 37.0 37.0 37.0 22 36.56325 37.0 37.0 37.0 37.0 37.0 23 36.55225 37.0 37.0 37.0 37.0 37.0 24 36.6225 37.0 37.0 37.0 37.0 37.0 25 36.552 37.0 37.0 37.0 37.0 37.0 26 36.613 37.0 37.0 37.0 37.0 37.0 27 36.58975 37.0 37.0 37.0 37.0 37.0 28 36.602 37.0 37.0 37.0 37.0 37.0 29 36.577 37.0 37.0 37.0 37.0 37.0 30 36.59675 37.0 37.0 37.0 37.0 37.0 31 36.5955 37.0 37.0 37.0 37.0 37.0 32 36.5875 37.0 37.0 37.0 37.0 37.0 33 36.6355 37.0 37.0 37.0 37.0 37.0 34 36.59675 37.0 37.0 37.0 37.0 37.0 35 36.645661415353835 37.0 37.0 37.0 37.0 37.0 36 36.6081520380095 37.0 37.0 37.0 37.0 37.0 37 36.6254063515879 37.0 37.0 37.0 37.0 37.0 38 36.61205602801401 37.0 37.0 37.0 37.0 37.0 39 36.60720540405304 37.0 37.0 37.0 37.0 37.0 40 36.632632632632635 37.0 37.0 37.0 37.0 37.0 41 36.642284569138276 37.0 37.0 37.0 37.0 37.0 42 36.70697441043653 37.0 37.0 37.0 37.0 37.0 43 36.65961199294533 37.0 37.0 37.0 37.0 37.0 44 36.600813628273585 37.0 37.0 37.0 37.0 37.0 45 36.69607077803799 37.0 37.0 37.0 37.0 37.0 46 36.70106761565836 37.0 37.0 37.0 37.0 37.0 47 36.73482635507952 37.0 37.0 37.0 37.0 37.0 48 36.76332622601279 37.0 37.0 37.0 37.0 37.0 49 36.86629526462396 37.0 37.0 37.0 37.0 37.0 50 36.90092879256966 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 1.0 26 4.0 27 3.0 28 10.0 29 6.0 30 23.0 31 29.0 32 41.0 33 57.0 34 123.0 35 384.0 36 3296.0 37 22.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.7 16.7 11.200000000000001 32.4 2 26.813406703351678 18.55927963981991 24.937468734367183 29.689844922461226 3 23.674999999999997 20.65 24.125 31.55 4 27.35 21.925 23.9 26.825 5 24.8 25.2 25.525 24.474999999999998 6 23.150000000000002 26.025 27.425 23.400000000000002 7 23.974999999999998 23.724999999999998 28.625 23.674999999999997 8 23.825 22.925 27.775 25.474999999999998 9 23.425 23.275000000000002 26.325 26.974999999999998 10 25.15 26.900000000000002 22.975 24.975 11 26.75 22.95 23.225 27.075 12 25.674999999999997 21.45 24.55 28.325 13 24.825 23.150000000000002 23.775 28.249999999999996 14 25.650000000000002 24.0 24.6 25.75 15 26.825 22.875 23.35 26.950000000000003 16 26.200000000000003 23.95 22.05 27.800000000000004 17 25.650000000000002 24.625 24.275 25.45 18 24.75 23.35 24.5 27.400000000000002 19 26.525 23.200000000000003 23.225 27.05 20 25.674999999999997 23.025000000000002 24.525 26.775 21 25.0 24.0 24.4 26.6 22 26.424999999999997 22.900000000000002 23.325000000000003 27.35 23 25.05 24.025 23.65 27.275 24 24.7 24.425 23.925 26.950000000000003 25 26.424999999999997 22.925 23.275000000000002 27.375 26 25.35 23.400000000000002 25.05 26.200000000000003 27 25.35 23.0 25.074999999999996 26.575 28 27.500000000000004 22.650000000000002 23.200000000000003 26.650000000000002 29 25.7 23.974999999999998 24.025 26.3 30 26.375 23.1 23.25 27.275 31 25.4 24.275 22.525000000000002 27.800000000000004 32 25.25 24.2 24.925 25.624999999999996 33 25.974999999999998 22.025 24.025 27.975 34 26.474999999999998 22.875 22.0 28.65 35 25.78144536134033 23.55588897224306 23.85596399099775 26.806701675418854 36 26.356589147286826 23.13078269567392 24.281070267566893 26.231557889472366 37 26.78169542385596 22.85571392848212 22.85571392848212 27.506876719179797 38 24.83741870935468 24.362181090545274 24.23711855927964 26.563281640820406 39 26.695021265949464 23.01726294721041 23.592694520890667 26.695021265949464 40 26.101101101101097 23.773773773773772 22.772772772772772 27.352352352352355 41 24.549098196392784 23.271543086172343 25.851703406813627 26.327655310621246 42 25.990968389362767 21.851480180632212 24.460612142498743 27.69693928750627 43 26.958931720836482 22.17183169564122 22.978080120937264 27.89115646258503 44 25.146198830409354 23.72234935163997 24.586829392321384 26.54462242562929 45 25.318761384335154 21.935987509758 24.564142596929482 28.18110850897736 46 26.416643854366274 19.2718313714755 23.5696687653983 30.74185600875992 47 25.868224602401817 18.760142810775722 26.32262252515417 29.04901006166829 48 25.5863539445629 18.592750533049042 27.633262260127932 28.187633262260125 49 24.011142061281337 12.144846796657381 30.362116991643457 33.48189415041783 50 26.212590299277604 0.0 35.500515995872036 38.286893704850364 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 1.5 24 3.0 25 2.5 26 4.5 27 10.5 28 14.0 29 19.0 30 31.5 31 40.5 32 40.0 33 44.5 34 69.5 35 97.0 36 106.0 37 110.0 38 122.5 39 146.0 40 173.0 41 209.5 42 238.0 43 250.5 44 261.5 45 272.5 46 287.5 47 302.5 48 308.5 49 299.0 50 303.5 51 303.5 52 276.0 53 253.0 54 248.0 55 243.5 56 227.0 57 211.0 58 207.5 59 215.5 60 204.5 61 176.0 62 153.0 63 142.0 64 152.0 65 156.5 66 142.5 67 137.0 68 138.5 69 133.0 70 126.5 71 109.0 72 90.0 73 83.0 74 78.0 75 71.0 76 61.0 77 48.5 78 38.5 79 32.5 80 26.0 81 21.0 82 17.5 83 13.5 84 10.5 85 9.0 86 5.0 87 2.0 88 2.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 0.0 36 0.0 37 1.0 38 1.0 39 1.0 40 4.0 41 6.0 42 17.0 43 36.0 44 90.0 45 190.0 46 572.0 47 736.0 48 550.0 49 826.0 50 969.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103012 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103012_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.011 33.0 33.0 33.0 33.0 33.0 2 32.62825 33.0 33.0 33.0 33.0 33.0 3 32.643 33.0 33.0 33.0 33.0 33.0 4 32.6765 33.0 33.0 33.0 33.0 33.0 5 32.78825 33.0 33.0 33.0 33.0 33.0 6 36.35325 37.0 37.0 37.0 37.0 37.0 7 36.23575 37.0 37.0 37.0 37.0 37.0 8 36.32875 37.0 37.0 37.0 37.0 37.0 9 36.2185 37.0 37.0 37.0 37.0 37.0 10 36.24425 37.0 37.0 37.0 37.0 37.0 11 36.10375 37.0 37.0 37.0 37.0 37.0 12 36.16225 37.0 37.0 37.0 37.0 37.0 13 36.21825 37.0 37.0 37.0 37.0 37.0 14 36.22975 37.0 37.0 37.0 37.0 37.0 15 36.28325 37.0 37.0 37.0 37.0 37.0 16 36.31925 37.0 37.0 37.0 37.0 37.0 17 36.24375 37.0 37.0 37.0 37.0 37.0 18 36.28425 37.0 37.0 37.0 37.0 37.0 19 36.19825 37.0 37.0 37.0 37.0 37.0 20 36.154 37.0 37.0 37.0 37.0 37.0 21 36.15925 37.0 37.0 37.0 37.0 37.0 22 36.26825 37.0 37.0 37.0 37.0 37.0 23 36.3335 37.0 37.0 37.0 37.0 37.0 24 36.1675 37.0 37.0 37.0 37.0 37.0 25 36.2485 37.0 37.0 37.0 37.0 37.0 26 36.21675 37.0 37.0 37.0 37.0 37.0 27 36.2555 37.0 37.0 37.0 37.0 37.0 28 36.22175 37.0 37.0 37.0 37.0 37.0 29 36.367 37.0 37.0 37.0 37.0 37.0 30 36.35675 37.0 37.0 37.0 37.0 37.0 31 36.32875 37.0 37.0 37.0 37.0 37.0 32 36.39875 37.0 37.0 37.0 37.0 37.0 33 36.3845 37.0 37.0 37.0 37.0 37.0 34 36.3385 37.0 37.0 37.0 37.0 37.0 35 36.413413413413416 37.0 37.0 37.0 37.0 37.0 36 36.318807913849234 37.0 37.0 37.0 37.0 37.0 37 36.33725883237284 37.0 37.0 37.0 37.0 37.0 38 36.37678616194535 37.0 37.0 37.0 37.0 37.0 39 36.42026078234704 37.0 37.0 37.0 37.0 37.0 40 36.394981179422835 37.0 37.0 37.0 37.0 37.0 41 36.43348393574297 37.0 37.0 37.0 37.0 37.0 42 36.445589344056295 37.0 37.0 37.0 37.0 37.0 43 36.43658782083543 37.0 37.0 37.0 37.0 37.0 44 36.45337701612903 37.0 37.0 37.0 37.0 37.0 45 36.511262971399645 37.0 37.0 37.0 37.0 37.0 46 36.444811800610374 37.0 37.0 37.0 37.0 37.0 47 36.57362750128271 37.0 37.0 37.0 37.0 37.0 48 36.58066239316239 37.0 37.0 37.0 37.0 37.0 49 36.72795605666378 37.0 37.0 37.0 37.0 37.0 50 36.8313158922296 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 7.0 25 6.0 26 12.0 27 16.0 28 23.0 29 27.0 30 36.0 31 42.0 32 65.0 33 81.0 34 137.0 35 318.0 36 3228.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.449999999999996 16.875 11.3 37.375 2 29.2 22.725 26.5 21.575 3 24.775 24.675 23.1 27.450000000000003 4 28.575 27.625 18.025 25.775 5 30.099999999999998 30.15 18.325 21.425 6 24.675 31.5 20.349999999999998 23.474999999999998 7 25.4 19.475 29.7 25.424999999999997 8 24.25 22.25 23.05 30.45 9 23.474999999999998 23.400000000000002 27.0 26.125 10 27.750000000000004 27.400000000000002 21.375 23.474999999999998 11 28.575 22.875 18.875 29.675 12 27.675 20.474999999999998 23.125 28.725 13 26.1 21.95 23.1 28.849999999999998 14 27.0 24.9 21.349999999999998 26.75 15 25.974999999999998 24.75 22.425 26.85 16 27.3 22.775000000000002 22.875 27.05 17 28.7 23.674999999999997 20.75 26.875 18 26.3 23.375 23.575 26.75 19 26.1 22.725 23.7 27.474999999999998 20 29.225 23.5 21.5 25.775 21 26.5 24.275 21.875 27.35 22 26.85 23.200000000000003 22.45 27.500000000000004 23 26.8 24.474999999999998 22.375 26.35 24 26.6 23.9 22.45 27.05 25 26.924999999999997 23.375 21.75 27.950000000000003 26 27.900000000000002 22.95 24.0 25.15 27 26.575 24.2 21.375 27.85 28 27.175 23.35 22.725 26.75 29 27.725 24.6 22.3 25.374999999999996 30 25.55 23.925 24.025 26.5 31 28.075 23.35 21.275 27.3 32 27.875 22.975 22.225 26.924999999999997 33 25.324999999999996 24.65 23.7 26.325 34 27.224999999999998 22.650000000000002 22.05 28.075 35 27.802802802802802 23.823823823823822 22.02202202202202 26.351351351351347 36 26.045579764588027 24.61808164287503 23.59128474830954 25.7450538442274 37 27.110999749436232 23.227261338010525 21.949386118767226 27.712352793786017 38 27.550764602657306 24.918525946352467 20.75708197543244 26.77362747555778 39 27.031093279839517 24.297893681043128 23.044132397191575 25.626880641925776 40 26.85069008782936 23.764115432873275 21.63111668757842 27.754077791718945 41 27.28413654618474 23.31827309236948 23.09236947791165 26.305220883534137 42 26.011560693641616 23.799949736114602 23.221915054033676 26.966574516210102 43 26.57272269753397 22.87367891293407 22.546552591847004 28.007045797684953 44 28.125 23.941532258064516 21.774193548387096 26.159274193548388 45 26.75272083016958 25.107567704378635 22.90559352062769 25.234117944824096 46 27.87385554425229 22.634791454730415 21.719226856561548 27.77212614445575 47 28.424833247819393 23.422267829656235 23.31965110312981 24.83324781939456 48 25.988247863247864 23.157051282051285 23.557692307692307 27.297008547008545 49 27.291124602486267 16.79676206996242 25.585429314830876 30.32668401272044 50 30.534947286216322 0.0 32.17493166731745 37.290121046466226 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 0.5 27 2.0 28 4.0 29 8.5 30 14.0 31 19.0 32 28.5 33 42.5 34 50.0 35 55.5 36 66.5 37 87.0 38 107.0 39 121.0 40 144.0 41 190.0 42 224.0 43 240.5 44 261.5 45 266.0 46 265.0 47 280.0 48 296.5 49 308.5 50 311.5 51 297.0 52 291.5 53 270.5 54 242.0 55 239.0 56 235.0 57 210.5 58 191.5 59 194.5 60 192.5 61 183.0 62 178.0 63 165.0 64 155.5 65 166.0 66 168.5 67 159.0 68 148.5 69 132.0 70 119.5 71 112.5 72 103.5 73 93.5 74 84.5 75 69.5 76 59.5 77 51.0 78 37.0 79 29.5 80 26.5 81 19.0 82 10.0 83 9.5 84 10.0 85 8.5 86 7.5 87 6.0 88 4.0 89 2.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 4.0 35 3.0 36 2.0 37 2.0 38 1.0 39 3.0 40 1.0 41 5.0 42 5.0 43 6.0 44 17.0 45 19.0 46 34.0 47 154.0 48 285.0 49 898.0 50 2561.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210077 spots for SRR9103012.sra Written 1210077 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra Read 1210066 spots for SRR9103012.sra Written 1210066 spots for SRR9103012.sra SRR ids: ['SRR9103012.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uiyvr9q4 SRR9103012.sra spots: 24201331 blocks: [[1, 1210066], [1210067, 2420132], [2420133, 3630198], [3630199, 4840264], [4840265, 6050330], [6050331, 7260396], [7260397, 8470462], [8470463, 9680528], [9680529, 10890594], [10890595, 12100660], [12100661, 13310726], [13310727, 14520792], [14520793, 15730858], [15730859, 16940924], [16940925, 18150990], [18150991, 19361056], [19361057, 20571122], [20571123, 21781188], [21781189, 22991254], [22991255, 24201331]] SRR9103012 file size 3304731 SRR9103012 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103012 SRR9103012_1.fastq SRR9103012_2.fastq Input file: SRR9103012_1.fastq Paired file: SRR9103012_2.fastq trimmed: SRR9103012-trimmed-pair1.fastq, SRR9103012-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:31:53 2024 >> started Sat Dec 7 01:32:14 2024 >> done (20.784s) 24201331 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 24201331 (100.00%) read pairs available; of these: 1122 ( 0.00%) trimmed read pairs available after processing 24200209 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 4 0.00% 34 486 0.00% 35 824 0.00% 36 1256 0.01% 37 1797 0.01% 38 2957 0.01% 39 5158 0.02% 40 10488 0.04% 41 19699 0.08% 42 33538 0.14% 43 47386 0.20% 44 80676 0.33% 45 177918 0.74% 46 569767 2.35% 47 2221443 9.18% 48 6241254 25.79% 49 9667297 39.95% 50 5119383 21.15% 24201331 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=105.13 fanout-score-rank=14 prefix-density=0.38 prefix-fanout=16.3 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=342.04 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=30.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=118.72 fanout-score-rank=16 prefix-density=0.86 prefix-fanout=18.1 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=382.59 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=20.4 sequence=CCGCCGCCGTCG SRR9103012 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:32:41 Started mapping on | Dec 07 01:32:41 Finished on | Dec 07 01:33:12 Mapping speed, Million of reads per hour | 2810.48 Number of input reads | 24201331 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 23160574 Uniquely mapped reads % | 95.70% Average mapped length | 97.51 Number of splices: Total | 6462505 Number of splices: Annotated (sjdb) | 6178047 Number of splices: GT/AG | 6377590 Number of splices: GC/AG | 77343 Number of splices: AT/AC | 4424 Number of splices: Non-canonical | 3148 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401525 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 288112 % of reads mapped to too many loci | 1.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.05% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 639232 639232 639232 N_multimapping 401525 401525 401525 N_noFeature 504209 22301386 1001600 N_ambiguous 392806 2698 31455 UnstrandedReadsAssigned:22263559 PositiveStrandReadsAssigned:856490 NegativeStrandReadsAssigned:22127519 Dataset is classified negative stranded MeadianReadLen=49 20thPercentileLength=47 echo kmer=43 SRR9103012 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103012-trimmed-pair1.fastq SRR9103012-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,201,331 reads, 22,478,393 reads pseudoaligned [quant] estimated average fragment length: 148.578 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR9103012.ke.tsv 35125 SRR9103012.se.tsv 88098 total ==> SRR9103012.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 788.606 163.758 13.3683 PNS24247 1044 896.422 36.8334 2.64522 PNS24249 1928 1780.42 294.549 10.6504 PNS24246 1044 896.422 36.8334 2.64522 PNS24248 1044 896.422 36.8334 2.64522 PNS24244 1471 1323.42 36.1928 1.76058 PNS24243 293 151.677 0 0 KQK14069 1603 1455.42 13563.7 599.958 KQK14071 474 328.08 1169.8 229.543 ==> SRR9103012.se.tsv <== BRADI_1g14170v3 14863 BRADI_1g53295v3 54 BRADI_1g59795v3 207 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 1135 BRADI_1g74790v3 87 BRADI_1g09890v3 0 BRADI_1g77505v3 251 BRADI_1g48960v3 0 SRR9103012 completed mapping pipeline successfully