Starting /dee2/code/volunteer_pipeline.sh SRR9103013 current disk space = 1548039696384 free memory = 1600566424 SRR9103013 SRAfilesize 94e67a0a3df4080c8ea19add10c111d1 SRR9103013.sra SRR9103013.sra file validated SRR9103013 is paired end SRR9103013 is conventional basespace SRR9103013 read1 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103013_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.014 33.0 33.0 33.0 33.0 33.0 2 32.548 33.0 33.0 33.0 33.0 33.0 3 32.66775 33.0 33.0 33.0 33.0 33.0 4 32.71875 33.0 33.0 33.0 33.0 33.0 5 33.271 33.0 33.0 33.0 33.0 37.0 6 35.966 37.0 37.0 37.0 33.0 37.0 7 36.24925 37.0 37.0 37.0 37.0 37.0 8 36.41675 37.0 37.0 37.0 37.0 37.0 9 36.5435 37.0 37.0 37.0 37.0 37.0 10 36.57775 37.0 37.0 37.0 37.0 37.0 11 36.604 37.0 37.0 37.0 37.0 37.0 12 36.52625 37.0 37.0 37.0 37.0 37.0 13 36.52875 37.0 37.0 37.0 37.0 37.0 14 36.514 37.0 37.0 37.0 37.0 37.0 15 36.58 37.0 37.0 37.0 37.0 37.0 16 36.5565 37.0 37.0 37.0 37.0 37.0 17 36.511 37.0 37.0 37.0 37.0 37.0 18 36.505 37.0 37.0 37.0 37.0 37.0 19 36.57575 37.0 37.0 37.0 37.0 37.0 20 36.5815 37.0 37.0 37.0 37.0 37.0 21 36.5985 37.0 37.0 37.0 37.0 37.0 22 36.6015 37.0 37.0 37.0 37.0 37.0 23 36.5935 37.0 37.0 37.0 37.0 37.0 24 36.659 37.0 37.0 37.0 37.0 37.0 25 36.5875 37.0 37.0 37.0 37.0 37.0 26 36.625 37.0 37.0 37.0 37.0 37.0 27 36.64125 37.0 37.0 37.0 37.0 37.0 28 36.6275 37.0 37.0 37.0 37.0 37.0 29 36.58525 37.0 37.0 37.0 37.0 37.0 30 36.578 37.0 37.0 37.0 37.0 37.0 31 36.59425 37.0 37.0 37.0 37.0 37.0 32 36.6 37.0 37.0 37.0 37.0 37.0 33 36.64625 37.0 37.0 37.0 37.0 37.0 34 36.6735 37.0 37.0 37.0 37.0 37.0 35 36.64391097774443 37.0 37.0 37.0 37.0 37.0 36 36.65091272818204 37.0 37.0 37.0 37.0 37.0 37 36.6124031007752 37.0 37.0 37.0 37.0 37.0 38 36.660830415207606 37.0 37.0 37.0 37.0 37.0 39 36.66033016508254 37.0 37.0 37.0 37.0 37.0 40 36.738053540155114 37.0 37.0 37.0 37.0 37.0 41 36.64981226533166 37.0 37.0 37.0 37.0 37.0 42 36.65689957425494 37.0 37.0 37.0 37.0 37.0 43 36.63248934570068 37.0 37.0 37.0 37.0 37.0 44 36.66273525721456 37.0 37.0 37.0 37.0 37.0 45 36.72129909365559 37.0 37.0 37.0 37.0 37.0 46 36.752216873574866 37.0 37.0 37.0 37.0 37.0 47 36.74070247933884 37.0 37.0 37.0 37.0 37.0 48 36.79531376245623 37.0 37.0 37.0 37.0 37.0 49 36.85833076686172 37.0 37.0 37.0 37.0 37.0 50 36.907514450867055 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 4.0 28 5.0 29 15.0 30 18.0 31 33.0 32 43.0 33 70.0 34 117.0 35 254.0 36 3437.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.425 10.7 13.350000000000001 41.525 2 24.15603900975244 15.128782195548887 29.207301825456366 31.50787696924231 3 24.675 17.424999999999997 21.875 36.025 4 27.05 23.150000000000002 20.7 29.099999999999998 5 24.725 28.15 23.1 24.025 6 24.175 27.800000000000004 26.6 21.425 7 19.575 25.124999999999996 34.0 21.3 8 21.925 24.05 28.999999999999996 25.025 9 21.25 24.099999999999998 30.025000000000002 24.625 10 23.35 30.65 22.7 23.3 11 25.275 25.7 22.625 26.400000000000002 12 24.3 23.375 25.874999999999996 26.450000000000003 13 24.575 24.7 25.55 25.174999999999997 14 24.025 26.3 23.799999999999997 25.874999999999996 15 23.325000000000003 24.75 25.3 26.625 16 24.05 25.324999999999996 23.45 27.175 17 24.925 24.575 25.0 25.5 18 24.775 24.474999999999998 24.25 26.5 19 24.025 25.775 24.6 25.6 20 25.2 25.45 24.474999999999998 24.875 21 23.875 24.85 24.349999999999998 26.924999999999997 22 24.85 25.75 23.625 25.775 23 24.875 24.349999999999998 24.575 26.200000000000003 24 22.2 25.45 25.474999999999998 26.875 25 24.525 24.0 24.349999999999998 27.125 26 23.375 27.35 24.575 24.7 27 23.95 26.1 24.175 25.775 28 25.174999999999997 24.775 24.175 25.874999999999996 29 24.625 26.174999999999997 23.674999999999997 25.525 30 23.625 25.45 24.575 26.35 31 24.425 24.25 25.5 25.825 32 23.825 25.900000000000002 24.6 25.674999999999997 33 24.125 26.05 23.849999999999998 25.974999999999998 34 24.425 24.825 24.25 26.5 35 24.8062015503876 24.85621405351338 24.706176544136035 25.63140785196299 36 25.10627656914228 24.5311327831958 23.93098274568642 26.431607901975497 37 24.006001500375092 24.93123280820205 24.281070267566893 26.78169542385596 38 23.51175587793897 26.013006503251624 24.16208104052026 26.313156578289142 39 23.986993496748372 25.337668834417208 24.487243621810904 26.18809404702351 40 25.068801601200903 24.718538904178132 23.492619464598448 26.720040030022517 41 24.380475594493117 24.80600750938673 24.405506883604506 26.408010012515643 42 25.093914350112694 23.816679188580014 25.043826696719258 26.045579764588027 43 23.640010027575833 25.14414640260717 24.642767610930058 26.57307595888694 44 23.462986198243414 24.391468005018822 25.370138017565875 26.775407779171896 45 24.194360523665658 25.151057401812686 24.773413897280967 25.88116817724068 46 25.259690904484415 25.13301241449202 23.56219913858627 26.045097542437297 47 23.24380165289256 24.819214876033058 25.0 26.936983471074385 48 23.862106113654725 21.94990573660113 26.232157285214114 27.95583086453003 49 26.024022174314755 16.78472436094857 27.286726208808133 29.90452725592855 50 25.43352601156069 0.0 35.69364161849711 38.872832369942195 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.0 21 1.0 22 2.5 23 2.5 24 2.5 25 5.0 26 11.0 27 16.0 28 17.0 29 21.0 30 23.5 31 25.5 32 39.5 33 59.5 34 77.5 35 104.0 36 141.5 37 173.5 38 187.5 39 193.0 40 205.5 41 231.5 42 247.0 43 258.0 44 281.0 45 309.5 46 324.5 47 333.5 48 357.0 49 347.5 50 308.5 51 266.0 52 254.5 53 272.0 54 258.5 55 229.5 56 220.0 57 211.5 58 188.5 59 156.5 60 144.5 61 147.5 62 135.0 63 126.0 64 128.5 65 120.0 66 102.5 67 91.5 68 87.0 69 85.0 70 81.0 71 77.0 72 73.0 73 64.5 74 53.5 75 44.5 76 39.0 77 34.0 78 26.0 79 16.5 80 9.5 81 7.5 82 7.0 83 6.5 84 7.0 85 6.0 86 3.0 87 1.5 88 1.5 89 2.0 90 1.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 0.0 36 0.0 37 1.0 38 0.0 39 1.0 40 2.0 41 2.0 42 4.0 43 4.0 44 13.0 45 25.0 46 75.0 47 159.0 48 466.0 49 1171.0 50 2076.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103013 read2 length is 35-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103013_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.008 33.0 33.0 33.0 33.0 33.0 2 32.716 33.0 33.0 33.0 33.0 33.0 3 32.687 33.0 33.0 33.0 33.0 33.0 4 32.70575 33.0 33.0 33.0 33.0 33.0 5 32.748 33.0 33.0 33.0 33.0 33.0 6 36.305 37.0 37.0 37.0 37.0 37.0 7 36.374 37.0 37.0 37.0 37.0 37.0 8 36.36775 37.0 37.0 37.0 37.0 37.0 9 36.32 37.0 37.0 37.0 37.0 37.0 10 36.33675 37.0 37.0 37.0 37.0 37.0 11 36.35575 37.0 37.0 37.0 37.0 37.0 12 36.283 37.0 37.0 37.0 37.0 37.0 13 36.29375 37.0 37.0 37.0 37.0 37.0 14 36.29875 37.0 37.0 37.0 37.0 37.0 15 36.32025 37.0 37.0 37.0 37.0 37.0 16 36.301 37.0 37.0 37.0 37.0 37.0 17 36.29875 37.0 37.0 37.0 37.0 37.0 18 36.46175 37.0 37.0 37.0 37.0 37.0 19 36.3715 37.0 37.0 37.0 37.0 37.0 20 36.35375 37.0 37.0 37.0 37.0 37.0 21 36.34525 37.0 37.0 37.0 37.0 37.0 22 36.337 37.0 37.0 37.0 37.0 37.0 23 36.33625 37.0 37.0 37.0 37.0 37.0 24 36.1715 37.0 37.0 37.0 37.0 37.0 25 36.35525 37.0 37.0 37.0 37.0 37.0 26 36.346 37.0 37.0 37.0 37.0 37.0 27 36.42325 37.0 37.0 37.0 37.0 37.0 28 36.4195 37.0 37.0 37.0 37.0 37.0 29 36.4245 37.0 37.0 37.0 37.0 37.0 30 36.40275 37.0 37.0 37.0 37.0 37.0 31 36.344 37.0 37.0 37.0 37.0 37.0 32 36.3245 37.0 37.0 37.0 37.0 37.0 33 36.4575 37.0 37.0 37.0 37.0 37.0 34 36.39725 37.0 37.0 37.0 37.0 37.0 35 36.4355 37.0 37.0 37.0 37.0 37.0 36 36.49974987493747 37.0 37.0 37.0 37.0 37.0 37 36.487487487487485 37.0 37.0 37.0 37.0 37.0 38 36.539058587881826 37.0 37.0 37.0 37.0 37.0 39 36.55360721442886 37.0 37.0 37.0 37.0 37.0 40 36.48295739348371 37.0 37.0 37.0 37.0 37.0 41 36.53497117071948 37.0 37.0 37.0 37.0 37.0 42 36.47905693503888 37.0 37.0 37.0 37.0 37.0 43 36.49109159347553 37.0 37.0 37.0 37.0 37.0 44 36.56295551646142 37.0 37.0 37.0 37.0 37.0 45 36.499748110831234 37.0 37.0 37.0 37.0 37.0 46 36.502652184895176 37.0 37.0 37.0 37.0 37.0 47 36.54874936191935 37.0 37.0 37.0 37.0 37.0 48 36.64283830123978 37.0 37.0 37.0 37.0 37.0 49 36.686830680173664 37.0 37.0 37.0 37.0 37.0 50 36.88910891089109 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 3.0 24 5.0 25 7.0 26 5.0 27 14.0 28 17.0 29 27.0 30 34.0 31 43.0 32 47.0 33 74.0 34 98.0 35 264.0 36 3358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 18.675 11.35 32.9 2 28.725 24.05 25.6 21.625 3 23.925 25.374999999999996 25.85 24.85 4 27.6 28.599999999999998 20.125 23.674999999999997 5 29.65 30.049999999999997 19.650000000000002 20.65 6 24.575 32.574999999999996 21.3 21.55 7 24.175 19.575 31.624999999999996 24.625 8 25.224999999999998 22.675 22.7 29.4 9 24.65 24.125 24.725 26.5 10 25.6 30.525000000000002 21.875 22.0 11 29.275000000000002 23.925 19.925 26.875 12 27.3 21.099999999999998 23.75 27.85 13 25.525 23.799999999999997 24.375 26.3 14 26.85 24.65 23.400000000000002 25.1 15 26.224999999999998 24.55 23.75 25.474999999999998 16 27.425 22.625 23.275000000000002 26.674999999999997 17 27.650000000000002 23.825 22.525000000000002 26.0 18 26.5 24.975 23.175 25.35 19 27.925 23.825 23.225 25.025 20 27.675 26.075 21.95 24.3 21 25.974999999999998 24.7 23.849999999999998 25.474999999999998 22 26.400000000000002 24.175 23.775 25.650000000000002 23 27.800000000000004 23.200000000000003 22.925 26.075 24 25.900000000000002 26.575 22.3 25.224999999999998 25 26.275 23.35 23.849999999999998 26.525 26 29.075 23.599999999999998 22.85 24.474999999999998 27 27.3 25.05 22.925 24.725 28 26.424999999999997 24.099999999999998 23.25 26.224999999999998 29 27.800000000000004 24.349999999999998 23.0 24.85 30 26.724999999999998 25.75 23.65 23.875 31 27.125 23.724999999999998 22.95 26.200000000000003 32 27.650000000000002 25.35 21.75 25.25 33 25.124999999999996 24.9 24.75 25.224999999999998 34 27.35 25.174999999999997 22.7 24.775 35 27.55 24.45 23.65 24.349999999999998 36 25.6128064032016 25.287643821910955 24.61230615307654 24.487243621810904 37 27.87787787787788 23.573573573573572 23.3983983983984 25.150150150150154 38 27.190786179268905 24.887330996494743 23.00951427140711 24.912368552829246 39 27.029058116232463 24.473947895791586 23.922845691382765 24.574148296593187 40 27.669172932330827 25.31328320802005 21.553884711779446 25.46365914786967 41 28.428177488092253 25.770869892203557 22.46176986713462 23.339182752569563 42 24.931025833960373 26.285427639829447 22.87434161023326 25.909204915976925 43 27.42785445420326 23.613550815558344 22.45922208281054 26.499372647427855 44 27.142498115104296 25.408394068861522 22.54335260115607 24.905755214878113 45 26.070528967254408 24.43324937027708 24.357682619647356 25.138539042821158 46 27.3806516797171 24.22328870927002 22.90982571356403 25.48623389744885 47 28.483920367534456 24.0684022460439 23.302705461970394 24.14497192445125 48 26.14085993141651 22.711685571089422 24.74281192297547 26.404642574518594 49 26.743849493487698 19.131693198263385 27.004341534008685 27.120115774240233 50 30.297029702970296 0.0 32.475247524752476 37.227722772277225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 0.5 24 1.0 25 3.0 26 5.0 27 6.5 28 8.0 29 13.5 30 20.5 31 22.5 32 24.0 33 41.0 34 60.5 35 75.5 36 91.0 37 101.0 38 112.5 39 139.0 40 166.5 41 205.5 42 248.0 43 285.0 44 315.5 45 321.0 46 321.0 47 323.0 48 320.5 49 311.5 50 312.5 51 300.5 52 276.0 53 263.5 54 253.5 55 241.5 56 228.0 57 203.0 58 187.0 59 187.5 60 181.5 61 169.5 62 157.5 63 155.0 64 156.0 65 143.0 66 125.0 67 122.0 68 120.0 69 97.5 70 79.0 71 73.5 72 69.0 73 70.0 74 66.0 75 52.0 76 44.5 77 43.5 78 38.5 79 30.0 80 24.5 81 18.0 82 10.0 83 7.5 84 6.0 85 3.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 2.0 36 2.0 37 2.0 38 2.0 39 2.0 40 1.0 41 2.0 42 2.0 43 6.0 44 9.0 45 11.0 46 41.0 47 127.0 48 336.0 49 930.0 50 2525.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277606 spots for SRR9103013.sra Written 1277606 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra Read 1277589 spots for SRR9103013.sra Written 1277589 spots for SRR9103013.sra SRR ids: ['SRR9103013.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4pww2wru SRR9103013.sra spots: 25551797 blocks: [[1, 1277589], [1277590, 2555178], [2555179, 3832767], [3832768, 5110356], [5110357, 6387945], [6387946, 7665534], [7665535, 8943123], [8943124, 10220712], [10220713, 11498301], [11498302, 12775890], [12775891, 14053479], [14053480, 15331068], [15331069, 16608657], [16608658, 17886246], [17886247, 19163835], [19163836, 20441424], [20441425, 21719013], [21719014, 22996602], [22996603, 24274191], [24274192, 25551797]] SRR9103013 file size 3529700 SRR9103013 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103013 SRR9103013_1.fastq SRR9103013_2.fastq Input file: SRR9103013_1.fastq Paired file: SRR9103013_2.fastq trimmed: SRR9103013-trimmed-pair1.fastq, SRR9103013-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:39:37 2024 >> started Sat Dec 7 01:39:57 2024 >> done (19.516s) 25551797 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 25551797 (100.00%) read pairs available; of these: 206 ( 0.00%) trimmed read pairs available after processing 25551591 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 3 0.00% 34 323 0.00% 35 518 0.00% 36 776 0.00% 37 1051 0.00% 38 1762 0.01% 39 3104 0.01% 40 6144 0.02% 41 14328 0.06% 42 27599 0.11% 43 36463 0.14% 44 57555 0.23% 45 105879 0.41% 46 242548 0.95% 47 817114 3.20% 48 3489261 13.66% 49 12516602 48.99% 50 8230767 32.21% 25551797 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=1.0 sequence=ATCGCGGCCGCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=241.01 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=14.4 sequence=CCGCCGCCGCGCCGACCTCCTCCGCGATCTTGTGCCTGTGCGCGTTTTCCGGGTCCTTCTTTGCCTCGTGCTTCTCGTAGAGGGCGAAGGCGCCGGCGGCGACG criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=109.40 fanout-score-rank=15 prefix-density=0.68 prefix-fanout=17.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=332.53 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=17.4 sequence=CGCCGCCGCCACC SRR9103013 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:40:16 Started mapping on | Dec 07 01:40:17 Finished on | Dec 07 01:40:46 Mapping speed, Million of reads per hour | 3171.95 Number of input reads | 25551797 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24523510 Uniquely mapped reads % | 95.98% Average mapped length | 98.27 Number of splices: Total | 6790493 Number of splices: Annotated (sjdb) | 6497798 Number of splices: GT/AG | 6699821 Number of splices: GC/AG | 81798 Number of splices: AT/AC | 4917 Number of splices: Non-canonical | 3957 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422553 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 203059 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 605734 605734 605734 N_multimapping 422553 422553 422553 N_noFeature 591215 23669235 998359 N_ambiguous 482284 3004 36018 UnstrandedReadsAssigned:23450011 PositiveStrandReadsAssigned:851271 NegativeStrandReadsAssigned:23489133 Dataset is classified negative stranded MeadianReadLen=49 20thPercentileLength=48 echo kmer=43 SRR9103013 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103013-trimmed-pair1.fastq SRR9103013-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,551,797 reads, 23,840,214 reads pseudoaligned [quant] estimated average fragment length: 152.254 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR9103013.ke.tsv 35125 SRR9103013.se.tsv 88098 total ==> SRR9103013.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 784.91 122.02 9.64781 PNS24247 1044 892.746 51.3233 3.56782 PNS24249 1928 1776.75 282.091 9.85325 PNS24246 1044 892.746 51.3233 3.56782 PNS24248 1044 892.746 51.3233 3.56782 PNS24244 1471 1319.75 68.9193 3.24091 PNS24243 293 149.267 0 0 KQK14069 1603 1451.75 7776.85 332.453 KQK14071 474 324.51 194.351 37.1686 ==> SRR9103013.se.tsv <== BRADI_1g14170v3 8198 BRADI_1g53295v3 77 BRADI_1g59795v3 305 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 1016 BRADI_1g74790v3 52 BRADI_1g09890v3 0 BRADI_1g77505v3 283 BRADI_1g48960v3 1 SRR9103013 completed mapping pipeline successfully