Starting /dee2/code/volunteer_pipeline.sh SRR9103014 current disk space = 1548085784576 free memory = 1603242444 SRR9103014 SRAfilesize 1b16e443e244ad74e0c7c8f3c9688aa0 SRR9103014.sra SRR9103014.sra file validated SRR9103014 is paired end SRR9103014 is conventional basespace SRR9103014 read1 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103014_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.038 33.0 33.0 33.0 33.0 33.0 2 32.1095 33.0 33.0 33.0 27.0 33.0 3 32.20025 33.0 33.0 33.0 27.0 33.0 4 32.37625 33.0 33.0 33.0 27.0 33.0 5 33.335 33.0 33.0 33.0 33.0 37.0 6 35.91125 37.0 37.0 37.0 33.0 37.0 7 36.46575 37.0 37.0 37.0 37.0 37.0 8 36.56 37.0 37.0 37.0 37.0 37.0 9 36.569 37.0 37.0 37.0 37.0 37.0 10 36.57025 37.0 37.0 37.0 37.0 37.0 11 36.6015 37.0 37.0 37.0 37.0 37.0 12 36.617 37.0 37.0 37.0 37.0 37.0 13 36.55825 37.0 37.0 37.0 37.0 37.0 14 36.64475 37.0 37.0 37.0 37.0 37.0 15 36.53175 37.0 37.0 37.0 37.0 37.0 16 36.58675 37.0 37.0 37.0 37.0 37.0 17 36.55025 37.0 37.0 37.0 37.0 37.0 18 36.546 37.0 37.0 37.0 37.0 37.0 19 36.591 37.0 37.0 37.0 37.0 37.0 20 36.62325 37.0 37.0 37.0 37.0 37.0 21 36.61825 37.0 37.0 37.0 37.0 37.0 22 36.5895 37.0 37.0 37.0 37.0 37.0 23 36.626 37.0 37.0 37.0 37.0 37.0 24 36.58375 37.0 37.0 37.0 37.0 37.0 25 36.62875 37.0 37.0 37.0 37.0 37.0 26 36.5775 37.0 37.0 37.0 37.0 37.0 27 36.5565 37.0 37.0 37.0 37.0 37.0 28 36.60475 37.0 37.0 37.0 37.0 37.0 29 36.5385 37.0 37.0 37.0 37.0 37.0 30 36.56625 37.0 37.0 37.0 37.0 37.0 31 36.56575 37.0 37.0 37.0 37.0 37.0 32 36.5695 37.0 37.0 37.0 37.0 37.0 33 36.5815 37.0 37.0 37.0 37.0 37.0 34 36.56325 37.0 37.0 37.0 37.0 37.0 35 36.5293823455864 37.0 37.0 37.0 37.0 37.0 36 36.56703351675838 37.0 37.0 37.0 37.0 37.0 37 36.56778389194597 37.0 37.0 37.0 37.0 37.0 38 36.57103551775888 37.0 37.0 37.0 37.0 37.0 39 36.589589589589586 37.0 37.0 37.0 37.0 37.0 40 36.68035043804756 37.0 37.0 37.0 37.0 37.0 41 36.60906586526421 37.0 37.0 37.0 37.0 37.0 42 36.65580345951366 37.0 37.0 37.0 37.0 37.0 43 36.605923694779115 37.0 37.0 37.0 37.0 37.0 44 36.62531517902168 37.0 37.0 37.0 37.0 37.0 45 36.69086294416244 37.0 37.0 37.0 37.0 37.0 46 36.67682769310256 37.0 37.0 37.0 37.0 37.0 47 36.70668086239021 37.0 37.0 37.0 37.0 37.0 48 36.75168539325843 37.0 37.0 37.0 37.0 37.0 49 36.80697224015494 37.0 37.0 37.0 37.0 37.0 50 36.91025641025641 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 1.0 27 2.0 28 8.0 29 12.0 30 25.0 31 27.0 32 35.0 33 64.0 34 143.0 35 321.0 36 3356.0 37 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.275 7.375 9.65 48.699999999999996 2 24.831207801950487 14.778694673668417 29.657414353588397 30.732683170792697 3 24.825 16.6 22.775000000000002 35.8 4 29.049999999999997 21.025 20.7 29.225 5 27.950000000000003 25.85 23.75 22.45 6 22.725 28.799999999999997 24.349999999999998 24.125 7 22.925 21.975 32.225 22.875 8 23.275000000000002 21.65 27.224999999999998 27.85 9 22.900000000000002 22.55 30.175 24.375 10 25.45 26.924999999999997 22.975 24.65 11 26.424999999999997 24.0 21.5 28.075 12 25.874999999999996 21.05 24.625 28.449999999999996 13 25.224999999999998 22.25 25.2 27.325 14 25.825 23.375 24.525 26.275 15 26.424999999999997 22.725 24.0 26.85 16 26.35 21.9 22.8 28.95 17 27.55 24.099999999999998 22.400000000000002 25.95 18 24.5 22.7 24.025 28.775000000000002 19 25.174999999999997 23.1 23.95 27.775 20 26.325 24.224999999999998 22.625 26.825 21 25.15 23.425 25.05 26.375 22 25.874999999999996 22.05 23.200000000000003 28.875 23 25.825 23.3 24.3 26.575 24 25.174999999999997 22.5 24.825 27.500000000000004 25 26.1 23.0 22.85 28.050000000000004 26 25.8 24.15 23.775 26.275 27 24.7 24.65 23.875 26.775 28 25.25 21.975 25.55 27.224999999999998 29 25.900000000000002 23.325000000000003 23.549999999999997 27.224999999999998 30 25.2 23.575 23.925 27.3 31 25.95 23.0 24.05 27.0 32 26.450000000000003 22.925 24.275 26.35 33 23.95 23.65 24.625 27.775 34 27.075 22.725 23.1 27.1 35 26.03150787696924 22.930732683170792 23.830957739434858 27.206801700425103 36 24.662331165582792 23.761880940470235 24.387193596798397 27.188594297148573 37 27.43871935967984 22.536268134067033 22.311155577788895 27.71385692846423 38 26.88844422211106 22.861430715357677 22.98649324662331 27.263631815907953 39 25.350350350350347 23.773773773773772 24.04904904904905 26.826826826826828 40 27.759699624530665 22.5531914893617 24.080100125156445 25.60700876095119 41 25.895316804407713 24.993739043325817 22.71475081392437 26.3961933383421 42 24.642767610930058 23.865630483830532 24.191526698420656 27.300075206818754 43 27.133534136546185 22.966867469879517 22.640562248995984 27.259036144578314 44 26.172465960665658 23.09631870902673 23.77710539586485 26.954109934442766 45 25.32994923857868 23.223350253807105 23.98477157360406 27.461928934010153 46 25.98811676569362 22.319814001549986 22.500645827951434 29.19142340480496 47 26.404045781208414 21.373436252328986 25.4990684056428 26.7234495608198 48 24.8876404494382 20.477528089887638 27.162921348314605 27.47191011235955 49 26.95287282117495 16.236281471917366 25.887669464170433 30.92317624273725 50 28.296703296703296 0.0 34.34065934065934 37.362637362637365 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 3.5 25 5.0 26 6.0 27 6.5 28 7.5 29 8.5 30 11.5 31 16.5 32 21.5 33 32.0 34 51.5 35 76.5 36 90.5 37 103.0 38 133.0 39 168.0 40 187.0 41 208.5 42 232.5 43 239.0 44 244.0 45 255.0 46 265.5 47 264.0 48 259.0 49 275.5 50 297.0 51 300.5 52 291.0 53 265.0 54 247.0 55 247.5 56 236.5 57 203.0 58 191.5 59 201.0 60 196.0 61 193.5 62 189.0 63 172.5 64 167.5 65 166.0 66 153.0 67 143.0 68 130.0 69 111.0 70 106.5 71 113.5 72 116.5 73 106.5 74 83.5 75 64.5 76 56.0 77 48.5 78 37.5 79 28.5 80 27.0 81 22.0 82 13.0 83 8.5 84 5.5 85 5.5 86 5.5 87 3.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 1.0 36 0.0 37 0.0 38 2.0 39 1.0 40 2.0 41 4.0 42 5.0 43 18.0 44 26.0 45 69.0 46 114.0 47 197.0 48 462.0 49 914.0 50 2184.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103014 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103014_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.009 33.0 33.0 33.0 33.0 33.0 2 32.624 33.0 33.0 33.0 33.0 33.0 3 32.5635 33.0 33.0 33.0 33.0 33.0 4 32.6285 33.0 33.0 33.0 33.0 33.0 5 32.68475 33.0 33.0 33.0 33.0 33.0 6 36.20125 37.0 37.0 37.0 37.0 37.0 7 36.176 37.0 37.0 37.0 37.0 37.0 8 36.36775 37.0 37.0 37.0 37.0 37.0 9 36.30725 37.0 37.0 37.0 37.0 37.0 10 36.21275 37.0 37.0 37.0 37.0 37.0 11 36.23025 37.0 37.0 37.0 37.0 37.0 12 36.108 37.0 37.0 37.0 37.0 37.0 13 36.2055 37.0 37.0 37.0 37.0 37.0 14 36.14475 37.0 37.0 37.0 37.0 37.0 15 36.27425 37.0 37.0 37.0 37.0 37.0 16 36.2335 37.0 37.0 37.0 37.0 37.0 17 36.25175 37.0 37.0 37.0 37.0 37.0 18 36.26575 37.0 37.0 37.0 37.0 37.0 19 36.22825 37.0 37.0 37.0 37.0 37.0 20 36.206 37.0 37.0 37.0 37.0 37.0 21 36.24125 37.0 37.0 37.0 37.0 37.0 22 36.14975 37.0 37.0 37.0 37.0 37.0 23 36.229 37.0 37.0 37.0 37.0 37.0 24 36.15175 37.0 37.0 37.0 37.0 37.0 25 36.28975 37.0 37.0 37.0 37.0 37.0 26 36.26375 37.0 37.0 37.0 37.0 37.0 27 36.2815 37.0 37.0 37.0 37.0 37.0 28 36.25925 37.0 37.0 37.0 37.0 37.0 29 36.343 37.0 37.0 37.0 37.0 37.0 30 36.161 37.0 37.0 37.0 37.0 37.0 31 36.2605 37.0 37.0 37.0 37.0 37.0 32 36.37725 37.0 37.0 37.0 37.0 37.0 33 36.35875 37.0 37.0 37.0 37.0 37.0 34 36.3685 37.0 37.0 37.0 37.0 37.0 35 36.38094047023512 37.0 37.0 37.0 37.0 37.0 36 36.279029029029026 37.0 37.0 37.0 37.0 37.0 37 36.37221526908636 37.0 37.0 37.0 37.0 37.0 38 36.43801652892562 37.0 37.0 37.0 37.0 37.0 39 36.407268170426065 37.0 37.0 37.0 37.0 37.0 40 36.38700777526962 37.0 37.0 37.0 37.0 37.0 41 36.41530740276035 37.0 37.0 37.0 37.0 37.0 42 36.42674038703192 37.0 37.0 37.0 37.0 37.0 43 36.420020120724345 37.0 37.0 37.0 37.0 37.0 44 36.46589478983136 37.0 37.0 37.0 37.0 37.0 45 36.412373737373734 37.0 37.0 37.0 37.0 37.0 46 36.48693887902612 37.0 37.0 37.0 37.0 37.0 47 36.51265014055712 37.0 37.0 37.0 37.0 37.0 48 36.57109004739336 37.0 37.0 37.0 37.0 37.0 49 36.70922809053975 37.0 37.0 37.0 37.0 37.0 50 36.8244213886672 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 1.0 24 5.0 25 9.0 26 8.0 27 12.0 28 19.0 29 29.0 30 32.0 31 61.0 32 54.0 33 95.0 34 159.0 35 310.0 36 3201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.425000000000004 16.875 10.775 35.925000000000004 2 28.975 22.8 26.05 22.175 3 23.575 25.275 23.625 27.525 4 29.15 29.275000000000002 17.275 24.3 5 29.15 30.025000000000002 17.825 23.0 6 24.6 31.574999999999996 19.55 24.275 7 25.55 19.175 29.849999999999998 25.424999999999997 8 24.5 21.55 23.150000000000002 30.8 9 25.0 22.725 24.425 27.85 10 28.000000000000004 29.599999999999998 19.05 23.35 11 29.975 22.2 18.15 29.675 12 27.625 20.825 22.475 29.075 13 26.875 22.8 22.0 28.325 14 26.900000000000002 23.825 22.25 27.025 15 26.950000000000003 24.625 22.425 26.0 16 28.175 23.175 20.825 27.825 17 28.675 22.875 21.7 26.75 18 28.349999999999998 23.35 22.2 26.1 19 28.775000000000002 22.575 21.85 26.8 20 28.050000000000004 23.95 20.7 27.3 21 26.6 23.974999999999998 22.15 27.275 22 27.650000000000002 23.525 21.05 27.775 23 28.1 23.150000000000002 22.0 26.75 24 27.400000000000002 24.05 21.9 26.650000000000002 25 27.925 22.875 21.775 27.425 26 27.35 24.775 23.275000000000002 24.6 27 26.1 22.875 22.775000000000002 28.249999999999996 28 27.275 22.400000000000002 22.475 27.85 29 27.875 24.275 21.9 25.95 30 26.974999999999998 23.9 22.425 26.700000000000003 31 26.5 23.25 22.975 27.275 32 27.750000000000004 24.425 21.175 26.650000000000002 33 27.825 24.15 21.9 26.125 34 27.825 22.85 22.25 27.075 35 28.58929464732366 23.261630815407706 22.18609304652326 25.962981490745374 36 26.526526526526528 23.873873873873876 22.822822822822822 26.776776776776778 37 26.733416770963704 23.454317897371716 22.002503128911137 27.80976220275344 38 28.750313047833707 24.06711745554721 21.487603305785125 25.694966190833963 39 26.44110275689223 24.160401002506266 22.606516290726816 26.79197994987469 40 26.73689490845247 24.329069475796338 21.369450714823177 27.56458490092802 41 28.406524466750316 24.567126725219573 22.158092848180676 24.868255959849435 42 28.575018848957022 23.975873335008796 21.36215129429505 26.08695652173913 43 28.3953722334004 22.459758551307846 21.730382293762577 27.414486921529175 44 26.780770198842184 24.918197835388874 21.87264032217468 26.428391643594264 45 27.17171717171717 23.939393939393938 21.666666666666668 27.22222222222222 46 28.40476794319046 23.231042353537916 22.85062135429876 25.513568348972864 47 29.338103756708406 23.025811397904423 21.10912343470483 26.526961410682343 48 27.567140600315952 21.90626645602949 23.117430226434966 27.409162717219587 49 28.00348229831689 16.94718514219385 25.39175856065003 29.657573998839233 50 29.6488427773344 0.0 31.125299281723862 39.22585794094174 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 4.5 27 7.0 28 8.0 29 9.5 30 13.5 31 18.5 32 21.5 33 32.5 34 49.5 35 54.0 36 56.5 37 77.0 38 101.5 39 125.5 40 147.5 41 163.5 42 182.5 43 223.5 44 264.5 45 267.5 46 257.0 47 278.0 48 308.0 49 290.0 50 259.5 51 244.5 52 242.5 53 259.0 54 264.0 55 256.5 56 248.5 57 224.0 58 203.5 59 213.0 60 221.0 61 196.0 62 172.0 63 183.5 64 192.0 65 181.0 66 171.5 67 163.5 68 156.5 69 136.0 70 117.0 71 111.0 72 109.0 73 113.0 74 111.5 75 87.5 76 62.5 77 49.5 78 42.5 79 36.0 80 26.5 81 21.5 82 17.5 83 10.5 84 3.5 85 4.0 86 5.0 87 2.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 2.0 35 2.0 36 1.0 37 2.0 38 3.0 39 3.0 40 2.0 41 6.0 42 3.0 43 3.0 44 13.0 45 17.0 46 30.0 47 115.0 48 352.0 49 940.0 50 2506.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807774 spots for SRR9103014.sra Written 807774 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra Read 807766 spots for SRR9103014.sra Written 807766 spots for SRR9103014.sra SRR ids: ['SRR9103014.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_blbkatbm SRR9103014.sra spots: 16155328 blocks: [[1, 807766], [807767, 1615532], [1615533, 2423298], [2423299, 3231064], [3231065, 4038830], [4038831, 4846596], [4846597, 5654362], [5654363, 6462128], [6462129, 7269894], [7269895, 8077660], [8077661, 8885426], [8885427, 9693192], [9693193, 10500958], [10500959, 11308724], [11308725, 12116490], [12116491, 12924256], [12924257, 13732022], [13732023, 14539788], [14539789, 15347554], [15347555, 16155328]] SRR9103014 file size 2223323 SRR9103014 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103014 SRR9103014_1.fastq SRR9103014_2.fastq Input file: SRR9103014_1.fastq Paired file: SRR9103014_2.fastq trimmed: SRR9103014-trimmed-pair1.fastq, SRR9103014-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:43:59 2024 >> started Sat Dec 7 01:44:14 2024 >> done (15.700s) 16155328 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 16155328 (100.00%) read pairs available; of these: 241 ( 0.00%) trimmed read pairs available after processing 16155087 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 330 0.00% 35 470 0.00% 36 688 0.00% 37 1010 0.01% 38 1460 0.01% 39 2608 0.02% 40 5092 0.03% 41 10512 0.07% 42 20338 0.13% 43 26993 0.17% 44 42078 0.26% 45 78513 0.49% 46 187890 1.16% 47 616489 3.82% 48 2261422 14.00% 49 7249948 44.88% 50 5649485 34.97% 16155328 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=112.05 fanout-score-rank=17 prefix-density=0.48 prefix-fanout=17.3 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=340.46 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=30.3 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=132.55 fanout-score-rank=17 prefix-density=0.90 prefix-fanout=19.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=397.18 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=19.2 sequence=CGCCGCCGCCAT SRR9103014 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:44:50 Started mapping on | Dec 07 01:44:53 Finished on | Dec 07 01:45:15 Mapping speed, Million of reads per hour | 2643.60 Number of input reads | 16155328 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 15600502 Uniquely mapped reads % | 96.57% Average mapped length | 98.27 Number of splices: Total | 4185938 Number of splices: Annotated (sjdb) | 4004860 Number of splices: GT/AG | 4131049 Number of splices: GC/AG | 49693 Number of splices: AT/AC | 2895 Number of splices: Non-canonical | 2301 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264877 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 108490 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 289949 289949 289949 N_multimapping 264877 264877 264877 N_noFeature 352767 15154762 571954 N_ambiguous 245675 1555 19779 UnstrandedReadsAssigned:15002060 PositiveStrandReadsAssigned:444185 NegativeStrandReadsAssigned:15008769 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=48 echo kmer=43 SRR9103014 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103014-trimmed-pair1.fastq SRR9103014-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,155,328 reads, 15,235,672 reads pseudoaligned [quant] estimated average fragment length: 151.035 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,295 rounds 52973 SRR9103014.ke.tsv 35125 SRR9103014.se.tsv 88098 total ==> SRR9103014.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 786.231 70.8676 8.86069 PNS24247 1044 893.965 22.1277 2.43325 PNS24249 1928 1777.97 248.195 13.7227 PNS24246 1044 893.965 22.1277 2.43325 PNS24248 1044 893.965 22.1277 2.43325 PNS24244 1471 1320.97 28.5543 2.12496 PNS24243 293 149.379 0 0 KQK14069 1603 1452.97 3111.41 210.51 KQK14071 474 325.417 212.613 64.2273 ==> SRR9103014.se.tsv <== BRADI_1g14170v3 3340 BRADI_1g53295v3 48 BRADI_1g59795v3 86 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 757 BRADI_1g74790v3 62 BRADI_1g09890v3 0 BRADI_1g77505v3 149 BRADI_1g48960v3 1 SRR9103014 completed mapping pipeline successfully