Starting /dee2/code/volunteer_pipeline.sh SRR9103015 current disk space = 1548033761280 free memory = 1598528988 SRR9103015 SRAfilesize 6439a8acc31233cec6d39121331e2764 SRR9103015.sra SRR9103015.sra file validated SRR9103015 is paired end SRR9103015 is conventional basespace SRR9103015 read1 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103015_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.018 33.0 33.0 33.0 33.0 33.0 2 32.082 33.0 33.0 33.0 33.0 33.0 3 32.548 33.0 33.0 33.0 33.0 33.0 4 32.85075 33.0 33.0 33.0 33.0 33.0 5 33.14025 33.0 33.0 33.0 33.0 37.0 6 36.22575 37.0 37.0 37.0 37.0 37.0 7 36.4615 37.0 37.0 37.0 37.0 37.0 8 36.471 37.0 37.0 37.0 37.0 37.0 9 36.554 37.0 37.0 37.0 37.0 37.0 10 36.5495 37.0 37.0 37.0 37.0 37.0 11 36.5965 37.0 37.0 37.0 37.0 37.0 12 36.54225 37.0 37.0 37.0 37.0 37.0 13 36.486 37.0 37.0 37.0 37.0 37.0 14 36.6085 37.0 37.0 37.0 37.0 37.0 15 36.50575 37.0 37.0 37.0 37.0 37.0 16 36.5575 37.0 37.0 37.0 37.0 37.0 17 36.5615 37.0 37.0 37.0 37.0 37.0 18 36.50325 37.0 37.0 37.0 37.0 37.0 19 36.57925 37.0 37.0 37.0 37.0 37.0 20 36.5515 37.0 37.0 37.0 37.0 37.0 21 36.57575 37.0 37.0 37.0 37.0 37.0 22 36.5985 37.0 37.0 37.0 37.0 37.0 23 36.5645 37.0 37.0 37.0 37.0 37.0 24 36.578 37.0 37.0 37.0 37.0 37.0 25 36.59675 37.0 37.0 37.0 37.0 37.0 26 36.6115 37.0 37.0 37.0 37.0 37.0 27 36.55925 37.0 37.0 37.0 37.0 37.0 28 36.5655 37.0 37.0 37.0 37.0 37.0 29 36.545 37.0 37.0 37.0 37.0 37.0 30 36.53275 37.0 37.0 37.0 37.0 37.0 31 36.54475 37.0 37.0 37.0 37.0 37.0 32 36.45325 37.0 37.0 37.0 37.0 37.0 33 36.55425 37.0 37.0 37.0 37.0 37.0 34 36.525 37.0 37.0 37.0 37.0 37.0 35 36.56439109777445 37.0 37.0 37.0 37.0 37.0 36 36.5659244433325 37.0 37.0 37.0 37.0 37.0 37 36.5806855141356 37.0 37.0 37.0 37.0 37.0 38 36.53289967475607 37.0 37.0 37.0 37.0 37.0 39 36.53041301627034 37.0 37.0 37.0 37.0 37.0 40 36.570105157736606 37.0 37.0 37.0 37.0 37.0 41 36.63051102204409 37.0 37.0 37.0 37.0 37.0 42 36.52944124279629 37.0 37.0 37.0 37.0 37.0 43 36.590065228299046 37.0 37.0 37.0 37.0 37.0 44 36.63874213836478 37.0 37.0 37.0 37.0 37.0 45 36.60443995963673 37.0 37.0 37.0 37.0 37.0 46 36.651996947341644 37.0 37.0 37.0 37.0 37.0 47 36.61929460580913 37.0 37.0 37.0 37.0 37.0 48 36.699701330437144 37.0 37.0 37.0 37.0 37.0 49 36.840852904820764 37.0 37.0 37.0 37.0 37.0 50 36.890387124836884 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 2.0 27 7.0 28 10.0 29 18.0 30 17.0 31 36.0 32 53.0 33 69.0 34 122.0 35 277.0 36 3387.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.425000000000004 10.125 11.4 30.049999999999997 2 28.80720180045011 11.952988247061766 28.95723930982746 30.282570642660666 3 25.275 14.224999999999998 22.225 38.275 4 28.65 18.4 22.375 30.575000000000003 5 27.500000000000004 21.8 25.674999999999997 25.025 6 26.075 26.3 25.474999999999998 22.15 7 22.525000000000002 23.75 34.575 19.15 8 20.775 26.700000000000003 29.25 23.275000000000002 9 22.1 23.575 30.675 23.65 10 23.7 29.049999999999997 26.375 20.875 11 24.575 27.325 24.45 23.65 12 25.275 23.1 25.674999999999997 25.95 13 25.324999999999996 24.175 26.25 24.25 14 25.224999999999998 25.224999999999998 25.3 24.25 15 24.2 24.425 25.275 26.1 16 25.424999999999997 24.55 24.85 25.174999999999997 17 25.8 23.9 25.124999999999996 25.174999999999997 18 24.675 24.099999999999998 25.25 25.974999999999998 19 24.375 24.325 24.7 26.6 20 24.925 25.45 25.124999999999996 24.5 21 25.25 25.025 24.224999999999998 25.5 22 23.75 24.75 24.65 26.85 23 22.825 25.45 25.724999999999998 26.0 24 22.95 23.825 26.700000000000003 26.525 25 24.2 24.975 23.425 27.400000000000002 26 25.8 23.724999999999998 25.55 24.925 27 24.5 24.349999999999998 24.75 26.400000000000002 28 24.9 24.175 23.35 27.575 29 24.775 26.900000000000002 24.125 24.2 30 25.775 23.25 24.025 26.950000000000003 31 23.974999999999998 23.799999999999997 25.275 26.950000000000003 32 26.575 25.5 24.325 23.599999999999998 33 24.725 23.7 25.974999999999998 25.6 34 24.8 24.5 24.5 26.200000000000003 35 23.43085771442861 25.156289072268066 25.831457864466117 25.581395348837212 36 24.86865148861646 22.9672254190643 24.69352014010508 27.47060295221416 37 25.544158118588946 23.217413059794847 24.69352014010508 26.54490868151113 38 24.7935951963973 23.642732049036777 24.06805103827871 27.495621716287218 39 25.556946182728414 24.130162703379224 24.30538172715895 26.007509386733418 40 25.81372058087131 25.137706559839764 22.70906359539309 26.339509263895845 41 23.79759519038076 24.123246492985974 25.30060120240481 26.77855711422846 42 24.154347281383114 23.452768729641694 25.90829366073666 26.48459032823854 43 24.9372804816859 23.582538886101354 24.109382839939787 27.370797792272956 44 23.547169811320753 24.57861635220126 24.30188679245283 27.572327044025158 45 24.62159434914228 23.86478304742684 24.470232088799193 27.04339051463169 46 24.497583312134317 23.58178580513864 24.751971508522004 27.168659374205035 47 24.740663900414937 24.221991701244814 25.051867219917014 25.98547717842324 48 23.594895465653 22.291610100461583 25.82134129785501 28.29215313603041 49 24.134734239802224 18.665018541409147 27.966625463535227 29.2336217552534 50 26.141800782949108 0.0 35.406698564593306 38.45150065245759 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 3.5 23 5.5 24 6.0 25 5.5 26 8.0 27 13.5 28 18.0 29 24.5 30 31.0 31 36.5 32 48.0 33 60.5 34 74.0 35 91.5 36 109.5 37 144.0 38 184.0 39 206.0 40 219.5 41 229.5 42 229.5 43 249.0 44 291.0 45 310.0 46 308.0 47 302.5 48 291.0 49 285.5 50 287.0 51 285.0 52 282.5 53 271.5 54 265.0 55 252.0 56 220.0 57 205.0 58 207.5 59 181.0 60 149.0 61 139.5 62 138.0 63 145.0 64 142.0 65 121.0 66 108.0 67 106.5 68 99.5 69 89.5 70 86.0 71 84.0 72 74.5 73 68.5 74 63.5 75 52.0 76 44.0 77 39.0 78 32.5 79 22.5 80 15.5 81 14.5 82 10.0 83 6.5 84 6.0 85 4.0 86 2.0 87 2.5 88 3.0 89 1.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 2.0 36 0.0 37 0.0 38 2.0 39 1.0 40 2.0 41 1.0 42 5.0 43 11.0 44 11.0 45 33.0 46 75.0 47 173.0 48 447.0 49 937.0 50 2299.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.05828455077628 97.3 2 0.5853906846525834 1.15 3 0.10180707559175363 0.3 4 0.10180707559175363 0.4 5 0.10180707559175363 0.5 6 0.025451768897938407 0.15 7 0.0 0.0 8 0.025451768897938407 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCCATCTG 8 0.2 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCTCGACG 6 0.15 No Hit GGGGGATCCGTATACGTTTCTAATTTGTAGTTAACGGTTGGATACCACTT 5 0.125 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCTCTAA 5 0.125 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCGTCTTC 5 0.125 No Hit GGGGGATCCGTTAGCTATCGTTCGCGAGAAAGTTAGTAGACACACAGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103015 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103015_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.011 33.0 33.0 33.0 33.0 33.0 2 32.51725 33.0 33.0 33.0 33.0 33.0 3 32.456 33.0 33.0 33.0 33.0 33.0 4 32.58725 33.0 33.0 33.0 33.0 33.0 5 32.6965 33.0 33.0 33.0 33.0 33.0 6 36.23025 37.0 37.0 37.0 37.0 37.0 7 36.265 37.0 37.0 37.0 37.0 37.0 8 36.21475 37.0 37.0 37.0 37.0 37.0 9 36.2145 37.0 37.0 37.0 37.0 37.0 10 36.13725 37.0 37.0 37.0 37.0 37.0 11 36.0895 37.0 37.0 37.0 37.0 37.0 12 36.1215 37.0 37.0 37.0 37.0 37.0 13 36.08425 37.0 37.0 37.0 37.0 37.0 14 36.092 37.0 37.0 37.0 37.0 37.0 15 36.13475 37.0 37.0 37.0 37.0 37.0 16 36.10925 37.0 37.0 37.0 37.0 37.0 17 36.2395 37.0 37.0 37.0 37.0 37.0 18 36.21425 37.0 37.0 37.0 37.0 37.0 19 36.07475 37.0 37.0 37.0 37.0 37.0 20 36.07675 37.0 37.0 37.0 37.0 37.0 21 36.1315 37.0 37.0 37.0 37.0 37.0 22 36.1705 37.0 37.0 37.0 37.0 37.0 23 36.099 37.0 37.0 37.0 37.0 37.0 24 36.11 37.0 37.0 37.0 37.0 37.0 25 36.17075 37.0 37.0 37.0 37.0 37.0 26 36.2895 37.0 37.0 37.0 37.0 37.0 27 36.2665 37.0 37.0 37.0 37.0 37.0 28 36.25275 37.0 37.0 37.0 37.0 37.0 29 36.21975 37.0 37.0 37.0 37.0 37.0 30 36.29225 37.0 37.0 37.0 37.0 37.0 31 36.17 37.0 37.0 37.0 37.0 37.0 32 36.2475 37.0 37.0 37.0 37.0 37.0 33 36.233 37.0 37.0 37.0 37.0 37.0 34 36.21825 37.0 37.0 37.0 37.0 37.0 35 36.17058529264632 37.0 37.0 37.0 37.0 37.0 36 36.2002002002002 37.0 37.0 37.0 37.0 37.0 37 36.28088198446505 37.0 37.0 37.0 37.0 37.0 38 36.29832038104788 37.0 37.0 37.0 37.0 37.0 39 36.33893206317373 37.0 37.0 37.0 37.0 37.0 40 36.256963613550816 37.0 37.0 37.0 37.0 37.0 41 36.32889447236181 37.0 37.0 37.0 37.0 37.0 42 36.40548703750314 37.0 37.0 37.0 37.0 37.0 43 36.35340050377834 37.0 37.0 37.0 37.0 37.0 44 36.39106286291341 37.0 37.0 37.0 37.0 37.0 45 36.393916349809885 37.0 37.0 37.0 37.0 37.0 46 36.43676695563488 37.0 37.0 37.0 37.0 37.0 47 36.420944028888314 37.0 37.0 37.0 37.0 37.0 48 36.53642914331465 37.0 37.0 37.0 37.0 37.0 49 36.66481589713618 37.0 37.0 37.0 37.0 37.0 50 36.83993399339934 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 5.0 23 2.0 24 9.0 25 7.0 26 18.0 27 19.0 28 28.0 29 35.0 30 41.0 31 45.0 32 57.0 33 100.0 34 148.0 35 304.0 36 3182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.375 19.475 11.725 32.425 2 28.1 26.35 24.75 20.8 3 23.525 27.175 23.474999999999998 25.825 4 27.800000000000004 29.25 19.575 23.375 5 26.150000000000002 30.75 20.775 22.325 6 24.175 33.725 21.275 20.825 7 23.775 19.400000000000002 32.574999999999996 24.25 8 24.85 22.5 23.674999999999997 28.975 9 24.125 21.675 26.174999999999997 28.025 10 24.875 29.15 22.8 23.175 11 27.85 24.575 19.875 27.700000000000003 12 27.725 21.0 23.599999999999998 27.675 13 25.650000000000002 23.3 24.25 26.8 14 25.224999999999998 26.424999999999997 23.474999999999998 24.875 15 25.374999999999996 23.375 24.025 27.224999999999998 16 26.424999999999997 22.95 24.175 26.450000000000003 17 27.625 24.4 22.0 25.974999999999998 18 25.974999999999998 25.25 23.0 25.775 19 27.1 24.05 22.900000000000002 25.95 20 26.525 25.424999999999997 22.875 25.174999999999997 21 25.374999999999996 27.075 22.225 25.324999999999996 22 26.450000000000003 24.175 22.475 26.900000000000002 23 26.275 25.4 22.125 26.200000000000003 24 24.375 25.474999999999998 24.675 25.474999999999998 25 26.325 24.2 22.85 26.625 26 25.624999999999996 24.5 24.075 25.8 27 26.474999999999998 25.374999999999996 22.95 25.2 28 26.5 24.45 23.1 25.95 29 25.974999999999998 24.125 23.875 26.025 30 26.35 24.2 23.150000000000002 26.3 31 27.675 23.549999999999997 22.925 25.85 32 26.0 25.3 22.325 26.375 33 25.75 25.525 23.825 24.9 34 27.1 25.0 23.45 24.45 35 26.013006503251624 25.71285642821411 23.81190595297649 24.462231115557778 36 25.55055055055055 24.2992992992993 24.04904904904905 26.101101101101097 37 26.609872212478074 24.680531195189175 22.976697569531446 25.732899022801302 38 26.698420656806217 24.56756079217849 23.113562296314864 25.620456254700425 39 26.071697167209827 24.717974429681625 24.592629731762347 24.617698671346204 40 26.14805520702635 23.914680050188206 23.83939774153074 26.097867001254706 41 25.27638190954774 25.100502512562816 22.135678391959797 27.487437185929647 42 25.069217216209417 25.220236597029956 23.986911653662222 25.723634533098416 43 25.31486146095718 24.030226700251887 24.5088161209068 26.146095717884133 44 25.39762686190356 24.943196162585206 23.17596566523605 26.483211310275184 45 24.993662864385296 24.05576679340938 25.373891001267427 25.576679340937897 46 26.61907190209077 22.692503824579298 24.93625701172871 25.752167261601222 47 26.231622388444677 23.832860459117875 22.981686871292236 26.953830281145212 48 25.24686415799306 23.058446757405925 24.63303976514545 27.061649319455565 49 26.125073056691996 18.468731735827003 26.35885447106955 29.047340736411453 50 28.877887788778878 0.0 35.10726072607261 36.01485148514851 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 1.5 22 0.0 23 2.0 24 4.0 25 6.0 26 8.5 27 10.0 28 14.5 29 18.0 30 18.0 31 26.0 32 36.0 33 41.5 34 56.5 35 82.0 36 96.5 37 115.5 38 145.5 39 169.5 40 192.0 41 224.5 42 256.5 43 271.0 44 277.0 45 300.5 46 322.0 47 315.0 48 307.0 49 314.0 50 313.5 51 296.0 52 294.0 53 279.0 54 251.5 55 236.5 56 219.5 57 204.5 58 202.0 59 195.5 60 174.0 61 162.0 62 165.5 63 151.0 64 128.5 65 118.5 66 110.5 67 102.0 68 94.5 69 95.0 70 90.0 71 83.5 72 78.5 73 66.0 74 60.0 75 61.0 76 57.5 77 41.5 78 27.0 79 23.0 80 20.5 81 18.5 82 14.5 83 8.5 84 4.5 85 4.0 86 3.0 87 2.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 2.0 35 2.0 36 5.0 37 2.0 38 0.0 39 4.0 40 5.0 41 7.0 42 3.0 43 9.0 44 16.0 45 23.0 46 45.0 47 130.0 48 325.0 49 998.0 50 2424.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.00839054157132 97.35000000000001 2 0.5847953216374269 1.15 3 0.2288329519450801 0.675 4 0.07627765064836003 0.3 5 0.07627765064836003 0.375 6 0.02542588354945334 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGATCCGTTAGCTATCGTTCGCGAGAAAGTTAGTAGACACACAGGAC 6 0.15 No Hit GGGGGATCCTTATCTGTCAAAACCGCTAATGTCCGTTCTAAGACCGTCTG 5 0.125 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCTCTAA 5 0.125 No Hit GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064688 spots for SRR9103015.sra Written 1064688 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra Read 1064677 spots for SRR9103015.sra Written 1064677 spots for SRR9103015.sra SRR ids: ['SRR9103015.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_locadarq SRR9103015.sra spots: 21293551 blocks: [[1, 1064677], [1064678, 2129354], [2129355, 3194031], [3194032, 4258708], [4258709, 5323385], [5323386, 6388062], [6388063, 7452739], [7452740, 8517416], [8517417, 9582093], [9582094, 10646770], [10646771, 11711447], [11711448, 12776124], [12776125, 13840801], [13840802, 14905478], [14905479, 15970155], [15970156, 17034832], [17034833, 18099509], [18099510, 19164186], [19164187, 20228863], [20228864, 21293551]] SRR9103015 file size 2942246 SRR9103015 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103015 SRR9103015_1.fastq SRR9103015_2.fastq Input file: SRR9103015_1.fastq Paired file: SRR9103015_2.fastq trimmed: SRR9103015-trimmed-pair1.fastq, SRR9103015-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:54:23 2024 >> started Sat Dec 7 01:54:43 2024 >> done (19.975s) 21293551 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 21293551 (100.00%) read pairs available; of these: 183 ( 0.00%) trimmed read pairs available after processing 21293368 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 4 0.00% 34 145 0.00% 35 322 0.00% 36 496 0.00% 37 857 0.00% 38 1652 0.01% 39 3082 0.01% 40 6990 0.03% 41 15863 0.07% 42 33359 0.16% 43 42857 0.20% 44 65790 0.31% 45 113134 0.53% 46 237073 1.11% 47 690443 3.24% 48 2744651 12.89% 49 9674772 45.44% 50 7662061 35.98% 21293551 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=44 prefix-density=0.00 prefix-fanout=1.0 sequence=GGGCCATACTAGTACTGGATGCATCTGCAGGATATCGCGGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=257.32 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=25.5 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=31 prefix-density=1.96 prefix-fanout=1.0 sequence=ATCGCGGCCGCTCGACGTAGAACTCAATCTAAAACTTCGATTTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=252.72 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=17.5 sequence=CGCCGCCGCCACC SRR9103015 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:55:02 Started mapping on | Dec 07 01:55:03 Finished on | Dec 07 01:55:53 Mapping speed, Million of reads per hour | 1533.14 Number of input reads | 21293551 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 19679712 Uniquely mapped reads % | 92.42% Average mapped length | 98.02 Number of splices: Total | 5470604 Number of splices: Annotated (sjdb) | 5215165 Number of splices: GT/AG | 5392566 Number of splices: GC/AG | 66668 Number of splices: AT/AC | 3631 Number of splices: Non-canonical | 7739 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.28 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323089 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 93585 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.47% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1290750 1290750 1290750 N_multimapping 323089 323089 323089 N_noFeature 650164 19091937 882689 N_ambiguous 391572 2861 37628 UnstrandedReadsAssigned:18637976 PositiveStrandReadsAssigned:584914 NegativeStrandReadsAssigned:18759395 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=49 echo kmer=45 SRR9103015 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103015-trimmed-pair1.fastq SRR9103015-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,293,551 reads, 18,991,986 reads pseudoaligned [quant] estimated average fragment length: 178.02 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR9103015.ke.tsv 35125 SRR9103015.se.tsv 88098 total ==> SRR9103015.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 759.178 0 0 PNS24247 1044 866.98 93.9801 8.42464 PNS24249 1928 1750.98 198.425 8.80723 PNS24246 1044 866.98 93.9801 8.42464 PNS24248 1044 866.98 93.9801 8.42464 PNS24244 1471 1293.98 12.6347 0.75886 PNS24243 293 128.107 0 0 KQK14069 1603 1425.98 9190.3 500.888 KQK14071 474 298.7 516.039 134.267 ==> SRR9103015.se.tsv <== BRADI_1g14170v3 9896 BRADI_1g53295v3 152 BRADI_1g59795v3 245 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 660 BRADI_1g74790v3 67 BRADI_1g09890v3 0 BRADI_1g77505v3 134 BRADI_1g48960v3 0 SRR9103015 completed mapping pipeline successfully