Starting /dee2/code/volunteer_pipeline.sh SRR9103016 current disk space = 1547882508288 free memory = 1599478080 SRR9103016 SRAfilesize f0d997732df42734b1c1872bedf0ae4d SRR9103016.sra SRR9103016.sra file validated SRR9103016 is paired end SRR9103016 is conventional basespace SRR9103016 read1 length is 35-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103016_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.018 33.0 33.0 33.0 33.0 33.0 2 32.50325 33.0 33.0 33.0 33.0 33.0 3 32.63325 33.0 33.0 33.0 33.0 33.0 4 32.978 33.0 33.0 33.0 33.0 33.0 5 33.968 33.0 33.0 37.0 33.0 37.0 6 36.38075 37.0 37.0 37.0 37.0 37.0 7 36.5 37.0 37.0 37.0 37.0 37.0 8 36.522 37.0 37.0 37.0 37.0 37.0 9 36.58525 37.0 37.0 37.0 37.0 37.0 10 36.63475 37.0 37.0 37.0 37.0 37.0 11 36.6705 37.0 37.0 37.0 37.0 37.0 12 36.5465 37.0 37.0 37.0 37.0 37.0 13 36.61775 37.0 37.0 37.0 37.0 37.0 14 36.575 37.0 37.0 37.0 37.0 37.0 15 36.538 37.0 37.0 37.0 37.0 37.0 16 36.58 37.0 37.0 37.0 37.0 37.0 17 36.58525 37.0 37.0 37.0 37.0 37.0 18 36.58375 37.0 37.0 37.0 37.0 37.0 19 36.62625 37.0 37.0 37.0 37.0 37.0 20 36.589 37.0 37.0 37.0 37.0 37.0 21 36.693 37.0 37.0 37.0 37.0 37.0 22 36.62075 37.0 37.0 37.0 37.0 37.0 23 36.64225 37.0 37.0 37.0 37.0 37.0 24 36.627 37.0 37.0 37.0 37.0 37.0 25 36.597 37.0 37.0 37.0 37.0 37.0 26 36.5965 37.0 37.0 37.0 37.0 37.0 27 36.59075 37.0 37.0 37.0 37.0 37.0 28 36.60125 37.0 37.0 37.0 37.0 37.0 29 36.624 37.0 37.0 37.0 37.0 37.0 30 36.5845 37.0 37.0 37.0 37.0 37.0 31 36.55325 37.0 37.0 37.0 37.0 37.0 32 36.56875 37.0 37.0 37.0 37.0 37.0 33 36.5505 37.0 37.0 37.0 37.0 37.0 34 36.60125 37.0 37.0 37.0 37.0 37.0 35 36.622 37.0 37.0 37.0 37.0 37.0 36 36.607401850462615 37.0 37.0 37.0 37.0 37.0 37 36.57514378594649 37.0 37.0 37.0 37.0 37.0 38 36.605203902927194 37.0 37.0 37.0 37.0 37.0 39 36.586586586586584 37.0 37.0 37.0 37.0 37.0 40 36.66207759699625 37.0 37.0 37.0 37.0 37.0 41 36.59589384076114 37.0 37.0 37.0 37.0 37.0 42 36.61998997995992 37.0 37.0 37.0 37.0 37.0 43 36.61845073953372 37.0 37.0 37.0 37.0 37.0 44 36.65033911077619 37.0 37.0 37.0 37.0 37.0 45 36.637991927346114 37.0 37.0 37.0 37.0 37.0 46 36.67737821984188 37.0 37.0 37.0 37.0 37.0 47 36.759665621734584 37.0 37.0 37.0 37.0 37.0 48 36.792197011621475 37.0 37.0 37.0 37.0 37.0 49 36.84640522875817 37.0 37.0 37.0 37.0 37.0 50 36.89542483660131 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 4.0 28 5.0 29 12.0 30 20.0 31 38.0 32 40.0 33 65.0 34 95.0 35 246.0 36 3471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.025000000000002 10.95 16.575 42.449999999999996 2 23.336668334167083 15.657828914457228 27.113556778389196 33.89194597298649 3 24.975 18.125 21.9 35.0 4 27.625 24.224999999999998 22.05 26.1 5 26.075 27.0 23.45 23.474999999999998 6 23.200000000000003 28.625 25.8 22.375 7 19.85 22.775000000000002 33.975 23.400000000000002 8 20.849999999999998 23.625 29.25 26.275 9 22.400000000000002 24.775 28.4 24.425 10 24.175 27.875 23.7 24.25 11 26.375 23.45 22.55 27.625 12 25.650000000000002 22.525000000000002 24.45 27.375 13 23.225 24.275 25.224999999999998 27.275 14 25.324999999999996 24.474999999999998 24.725 25.474999999999998 15 24.25 22.975 24.525 28.249999999999996 16 24.675 23.799999999999997 23.474999999999998 28.050000000000004 17 24.675 24.474999999999998 24.775 26.075 18 25.55 23.724999999999998 25.124999999999996 25.6 19 25.124999999999996 24.575 24.325 25.974999999999998 20 25.35 24.8 24.0 25.85 21 25.724999999999998 24.425 22.575 27.275 22 25.074999999999996 24.55 24.425 25.95 23 24.825 25.525 22.575 27.075 24 25.25 24.2 23.25 27.3 25 25.3 24.175 23.599999999999998 26.924999999999997 26 24.575 25.15 25.124999999999996 25.15 27 25.95 23.175 23.549999999999997 27.325 28 24.275 24.099999999999998 23.35 28.275 29 25.15 24.9 23.375 26.575 30 25.974999999999998 23.5 23.7 26.825 31 24.825 23.974999999999998 24.349999999999998 26.85 32 24.7 23.95 24.175 27.175 33 25.0 23.225 23.875 27.900000000000002 34 25.85 23.674999999999997 22.875 27.6 35 25.424999999999997 23.325000000000003 25.025 26.224999999999998 36 26.38159539884971 24.031007751937985 23.280820205051263 26.30657664416104 37 25.131282820705174 23.355838959739934 23.23080770192548 28.28207051762941 38 24.893670252689517 24.11808856642482 24.26820115086315 26.720040030022517 39 24.54954954954955 24.64964964964965 23.44844844844845 27.352352352352355 40 24.85607008760951 23.329161451814766 25.281602002503128 26.533166458072593 41 25.863795693540307 24.336504757135703 23.660490736104155 26.139208813219827 42 25.025050100200403 23.021042084168336 23.321643286573146 28.632264529058116 43 25.69566307345199 23.66507896715969 23.915768362998246 26.72348959639007 44 26.29992464204974 23.185129364481284 23.86335091685506 26.651595076613916 45 25.126135216952573 23.41069626639758 22.830474268415742 28.63269424823411 46 25.325172149961745 24.04998724815098 23.335883703136957 27.288956898750317 47 26.07105538140021 21.9435736677116 24.921630094043888 27.063740856844305 48 25.539568345323744 19.92252351964582 24.266740453790813 30.271167681239625 49 25.751633986928102 14.607843137254903 29.215686274509807 30.424836601307188 50 26.19825708061002 0.0 35.62091503267974 38.18082788671024 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 4.5 26 7.5 27 11.0 28 15.0 29 16.0 30 18.0 31 32.0 32 49.0 33 59.5 34 67.0 35 73.5 36 90.0 37 119.5 38 136.0 39 151.0 40 181.0 41 209.0 42 222.5 43 246.0 44 278.5 45 286.5 46 288.5 47 306.5 48 326.5 49 336.5 50 349.0 51 353.0 52 316.0 53 259.0 54 242.0 55 239.0 56 222.5 57 196.5 58 176.5 59 180.5 60 177.0 61 161.0 62 143.5 63 140.0 64 145.0 65 134.5 66 124.0 67 116.0 68 107.5 69 100.0 70 86.5 71 77.5 72 75.0 73 73.5 74 67.5 75 59.5 76 56.5 77 55.5 78 51.0 79 35.5 80 22.0 81 17.0 82 13.0 83 8.0 84 4.5 85 5.5 86 5.0 87 2.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 0.0 37 2.0 38 1.0 39 1.0 40 1.0 41 2.0 42 3.0 43 8.0 44 17.0 45 43.0 46 93.0 47 214.0 48 554.0 49 1224.0 50 1836.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103016 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103016_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01 33.0 33.0 33.0 33.0 33.0 2 32.56975 33.0 33.0 33.0 33.0 33.0 3 32.60775 33.0 33.0 33.0 33.0 33.0 4 32.6515 33.0 33.0 33.0 33.0 33.0 5 32.776 33.0 33.0 33.0 33.0 33.0 6 36.35425 37.0 37.0 37.0 37.0 37.0 7 36.276 37.0 37.0 37.0 37.0 37.0 8 36.2545 37.0 37.0 37.0 37.0 37.0 9 36.37875 37.0 37.0 37.0 37.0 37.0 10 36.3145 37.0 37.0 37.0 37.0 37.0 11 36.30525 37.0 37.0 37.0 37.0 37.0 12 36.1955 37.0 37.0 37.0 37.0 37.0 13 36.18425 37.0 37.0 37.0 37.0 37.0 14 36.224 37.0 37.0 37.0 37.0 37.0 15 36.206 37.0 37.0 37.0 37.0 37.0 16 36.30575 37.0 37.0 37.0 37.0 37.0 17 36.18975 37.0 37.0 37.0 37.0 37.0 18 36.26375 37.0 37.0 37.0 37.0 37.0 19 36.299 37.0 37.0 37.0 37.0 37.0 20 36.30075 37.0 37.0 37.0 37.0 37.0 21 36.3095 37.0 37.0 37.0 37.0 37.0 22 36.2405 37.0 37.0 37.0 37.0 37.0 23 36.25125 37.0 37.0 37.0 37.0 37.0 24 36.19525 37.0 37.0 37.0 37.0 37.0 25 36.21825 37.0 37.0 37.0 37.0 37.0 26 36.206 37.0 37.0 37.0 37.0 37.0 27 36.26625 37.0 37.0 37.0 37.0 37.0 28 36.3395 37.0 37.0 37.0 37.0 37.0 29 36.36 37.0 37.0 37.0 37.0 37.0 30 36.3225 37.0 37.0 37.0 37.0 37.0 31 36.256 37.0 37.0 37.0 37.0 37.0 32 36.31125 37.0 37.0 37.0 37.0 37.0 33 36.39325 37.0 37.0 37.0 37.0 37.0 34 36.383 37.0 37.0 37.0 37.0 37.0 35 36.41060265066267 37.0 37.0 37.0 37.0 37.0 36 36.373216520650814 37.0 37.0 37.0 37.0 37.0 37 36.327409261576975 37.0 37.0 37.0 37.0 37.0 38 36.43562124248497 37.0 37.0 37.0 37.0 37.0 39 36.43322475570032 37.0 37.0 37.0 37.0 37.0 40 36.37628478315367 37.0 37.0 37.0 37.0 37.0 41 36.47743229689067 37.0 37.0 37.0 37.0 37.0 42 36.41520321123934 37.0 37.0 37.0 37.0 37.0 43 36.47638190954774 37.0 37.0 37.0 37.0 37.0 44 36.56212273641851 37.0 37.0 37.0 37.0 37.0 45 36.5074438556649 37.0 37.0 37.0 37.0 37.0 46 36.51358902717806 37.0 37.0 37.0 37.0 37.0 47 36.51477010017981 37.0 37.0 37.0 37.0 37.0 48 36.579867549668876 37.0 37.0 37.0 37.0 37.0 49 36.73670520231214 37.0 37.0 37.0 37.0 37.0 50 36.84291497975708 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 2.0 25 7.0 26 12.0 27 18.0 28 22.0 29 31.0 30 35.0 31 49.0 32 67.0 33 67.0 34 134.0 35 272.0 36 3279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.475 18.375 11.95 33.2 2 30.2 23.7 24.75 21.349999999999998 3 24.65 25.45 24.45 25.45 4 28.299999999999997 28.599999999999998 19.275000000000002 23.825 5 28.449999999999996 31.1 19.775000000000002 20.674999999999997 6 24.15 31.15 20.525 24.175 7 24.775 19.2 30.525000000000002 25.5 8 23.925 22.325 23.1 30.65 9 25.074999999999996 23.075000000000003 25.174999999999997 26.674999999999997 10 26.525 29.799999999999997 20.025000000000002 23.65 11 28.999999999999996 23.225 19.3 28.475 12 28.825 21.7 22.575 26.900000000000002 13 27.800000000000004 22.525000000000002 22.1 27.575 14 26.1 25.05 22.7 26.150000000000002 15 27.450000000000003 23.724999999999998 22.75 26.075 16 28.275 23.65 22.875 25.2 17 29.075 23.45 21.875 25.6 18 25.974999999999998 25.05 22.400000000000002 26.575 19 26.900000000000002 23.974999999999998 23.375 25.75 20 28.125 23.875 23.05 24.95 21 27.200000000000003 24.474999999999998 22.55 25.775 22 27.425 24.275 22.7 25.6 23 27.625 23.825 23.3 25.25 24 26.924999999999997 23.599999999999998 22.900000000000002 26.575 25 27.500000000000004 23.425 21.975 27.1 26 26.474999999999998 25.025 23.599999999999998 24.9 27 27.150000000000002 24.85 22.3 25.7 28 27.0 23.325000000000003 22.725 26.950000000000003 29 26.025 25.224999999999998 23.3 25.45 30 26.25 25.124999999999996 23.375 25.25 31 27.250000000000004 24.474999999999998 21.975 26.3 32 26.974999999999998 23.875 23.400000000000002 25.75 33 25.674999999999997 23.200000000000003 25.074999999999996 26.05 34 27.375 24.175 22.325 26.125 35 26.38159539884971 25.081270317579396 23.10577644411103 25.431357839459867 36 27.083854818523157 23.329161451814766 23.379224030037545 26.207759699624532 37 28.060075093867333 23.879849812265334 21.70212765957447 26.357947434292868 38 27.75551102204409 25.475951903807616 22.11923847695391 24.649298597194388 39 27.060886995740418 23.101979453770983 23.202204961162614 26.634928589325984 40 28.07721233391828 23.66507896715969 21.985460015041365 26.272248683880672 41 26.855566700100304 24.398194583751255 23.82146439317954 24.924774322968908 42 25.865529352734573 23.733065730055195 24.13447064726543 26.26693426994481 43 27.914572864321606 23.09045226130653 23.29145728643216 25.7035175879397 44 27.691146881287725 22.912474849094565 24.19517102615694 25.201207243460765 45 26.318445622003534 23.74463790058037 22.836235175372195 27.100681302043906 46 27.711455422910845 23.520447040894084 22.83464566929134 25.933451866903734 47 25.1477010017981 24.659645517595685 22.476239404058568 27.71641407654765 48 26.86092715231788 22.887417218543046 24.52980132450331 25.721854304635762 49 26.61849710982659 18.23699421965318 25.491329479768787 29.653179190751445 50 30.688259109311737 0.0 32.18623481781376 37.125506072874494 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 3.5 25 3.5 26 2.5 27 2.5 28 5.0 29 9.5 30 11.0 31 15.0 32 26.5 33 36.5 34 46.5 35 65.0 36 83.0 37 99.0 38 115.0 39 143.0 40 178.5 41 211.5 42 234.0 43 252.0 44 281.5 45 305.0 46 316.0 47 323.0 48 323.5 49 296.0 50 276.5 51 282.5 52 272.5 53 258.5 54 247.0 55 220.5 56 207.0 57 203.0 58 198.5 59 191.0 60 177.0 61 177.5 62 175.5 63 166.0 64 168.0 65 166.0 66 150.5 67 135.5 68 129.5 69 128.0 70 120.5 71 103.0 72 87.5 73 74.0 74 59.5 75 52.5 76 52.0 77 48.0 78 40.0 79 31.5 80 25.0 81 19.5 82 14.0 83 9.0 84 3.5 85 3.5 86 4.0 87 2.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 4.0 36 0.0 37 3.0 38 1.0 39 2.0 40 1.0 41 2.0 42 6.0 43 4.0 44 13.0 45 26.0 46 44.0 47 118.0 48 315.0 49 990.0 50 2470.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89982469321312 99.725 2 0.07513148009015778 0.15 3 0.0 0.0 4 0.0 0.0 5 0.025043826696719257 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359752 spots for SRR9103016.sra Written 1359752 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra Read 1359745 spots for SRR9103016.sra Written 1359745 spots for SRR9103016.sra SRR ids: ['SRR9103016.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jyd2pxft SRR9103016.sra spots: 27194907 blocks: [[1, 1359745], [1359746, 2719490], [2719491, 4079235], [4079236, 5438980], [5438981, 6798725], [6798726, 8158470], [8158471, 9518215], [9518216, 10877960], [10877961, 12237705], [12237706, 13597450], [13597451, 14957195], [14957196, 16316940], [16316941, 17676685], [17676686, 19036430], [19036431, 20396175], [20396176, 21755920], [21755921, 23115665], [23115666, 24475410], [24475411, 25835155], [25835156, 27194907]] SRR9103016 file size 3751139 SRR9103016 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103016 SRR9103016_1.fastq SRR9103016_2.fastq Input file: SRR9103016_1.fastq Paired file: SRR9103016_2.fastq trimmed: SRR9103016-trimmed-pair1.fastq, SRR9103016-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:05:15 2024 >> started Sat Dec 7 02:05:56 2024 >> done (41.567s) 27194907 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 27194907 (100.00%) read pairs available; of these: 160 ( 0.00%) trimmed read pairs available after processing 27194747 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 32 1 0.00% 33 2 0.00% 34 197 0.00% 35 376 0.00% 36 599 0.00% 37 995 0.00% 38 1783 0.01% 39 3400 0.01% 40 7582 0.03% 41 17657 0.06% 42 33185 0.12% 43 44163 0.16% 44 70228 0.26% 45 129935 0.48% 46 311576 1.15% 47 1064446 3.91% 48 4247099 15.62% 49 13464400 49.51% 50 7797283 28.67% 27194907 reads passed initial QC criterion=sequence-density sequence-density=0.06 sequence-density-rank=1 fanout-score=104.68 fanout-score-rank=14 prefix-density=0.36 prefix-fanout=16.4 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=370.11 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=30.5 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=113.61 fanout-score-rank=16 prefix-density=0.77 prefix-fanout=17.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=341.66 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=17.7 sequence=CGCCGCCGCCACC SRR9103016 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:06:16 Started mapping on | Dec 07 02:06:16 Finished on | Dec 07 02:06:48 Mapping speed, Million of reads per hour | 3059.43 Number of input reads | 27194907 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 26229667 Uniquely mapped reads % | 96.45% Average mapped length | 98.17 Number of splices: Total | 7211606 Number of splices: Annotated (sjdb) | 6894410 Number of splices: GT/AG | 7115183 Number of splices: GC/AG | 87675 Number of splices: AT/AC | 5031 Number of splices: Non-canonical | 3717 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456022 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 175670 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.03% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 509218 509218 509218 N_multimapping 456022 456022 456022 N_noFeature 607007 25436312 976069 N_ambiguous 460801 2904 37630 UnstrandedReadsAssigned:25161859 PositiveStrandReadsAssigned:790451 NegativeStrandReadsAssigned:25215968 Dataset is classified negative stranded MeadianReadLen=49 20thPercentileLength=48 echo kmer=43 SRR9103016 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103016-trimmed-pair1.fastq SRR9103016-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,194,907 reads, 25,608,791 reads pseudoaligned [quant] estimated average fragment length: 155.736 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR9103016.ke.tsv 35125 SRR9103016.se.tsv 88098 total ==> SRR9103016.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 781.569 159.139 11.6045 PNS24247 1044 889.264 46.5478 2.98324 PNS24249 1928 1773.26 376.029 12.0856 PNS24246 1044 889.264 46.5478 2.98324 PNS24248 1044 889.264 46.5478 2.98324 PNS24244 1471 1316.26 19.1894 0.830878 PNS24243 293 145.37 0 0 KQK14069 1603 1448.26 9638.29 379.29 KQK14071 474 320.864 384.467 68.2901 ==> SRR9103016.se.tsv <== BRADI_1g14170v3 10129 BRADI_1g53295v3 82 BRADI_1g59795v3 277 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1416 BRADI_1g74790v3 97 BRADI_1g09890v3 0 BRADI_1g77505v3 295 BRADI_1g48960v3 2 SRR9103016 completed mapping pipeline successfully