Starting /dee2/code/volunteer_pipeline.sh SRR9103017 current disk space = 1547890233344 free memory = 1597711936 SRR9103017 SRAfilesize a6d91635bc6659f4571b7278a8b6e2df SRR9103017.sra SRR9103017.sra file validated SRR9103017 is paired end SRR9103017 is conventional basespace SRR9103017 read1 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103017_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.019 33.0 33.0 33.0 33.0 33.0 2 32.093 33.0 33.0 33.0 27.0 33.0 3 32.7275 33.0 33.0 33.0 33.0 33.0 4 33.39575 33.0 33.0 33.0 33.0 37.0 5 34.19725 33.0 33.0 37.0 33.0 37.0 6 36.2675 37.0 37.0 37.0 37.0 37.0 7 36.51525 37.0 37.0 37.0 37.0 37.0 8 36.6195 37.0 37.0 37.0 37.0 37.0 9 36.64575 37.0 37.0 37.0 37.0 37.0 10 36.681 37.0 37.0 37.0 37.0 37.0 11 36.69325 37.0 37.0 37.0 37.0 37.0 12 36.64275 37.0 37.0 37.0 37.0 37.0 13 36.5775 37.0 37.0 37.0 37.0 37.0 14 36.628 37.0 37.0 37.0 37.0 37.0 15 36.61675 37.0 37.0 37.0 37.0 37.0 16 36.616 37.0 37.0 37.0 37.0 37.0 17 36.6085 37.0 37.0 37.0 37.0 37.0 18 36.639 37.0 37.0 37.0 37.0 37.0 19 36.61175 37.0 37.0 37.0 37.0 37.0 20 36.629 37.0 37.0 37.0 37.0 37.0 21 36.5995 37.0 37.0 37.0 37.0 37.0 22 36.611 37.0 37.0 37.0 37.0 37.0 23 36.6205 37.0 37.0 37.0 37.0 37.0 24 36.64575 37.0 37.0 37.0 37.0 37.0 25 36.57575 37.0 37.0 37.0 37.0 37.0 26 36.58675 37.0 37.0 37.0 37.0 37.0 27 36.52325 37.0 37.0 37.0 37.0 37.0 28 36.58725 37.0 37.0 37.0 37.0 37.0 29 36.5285 37.0 37.0 37.0 37.0 37.0 30 36.60775 37.0 37.0 37.0 37.0 37.0 31 36.58725 37.0 37.0 37.0 37.0 37.0 32 36.55925 37.0 37.0 37.0 37.0 37.0 33 36.5945 37.0 37.0 37.0 37.0 37.0 34 36.61725 37.0 37.0 37.0 37.0 37.0 35 36.61840460115029 37.0 37.0 37.0 37.0 37.0 36 36.63365841460365 37.0 37.0 37.0 37.0 37.0 37 36.61305652826413 37.0 37.0 37.0 37.0 37.0 38 36.58104052026013 37.0 37.0 37.0 37.0 37.0 39 36.63438438438438 37.0 37.0 37.0 37.0 37.0 40 36.69194194194194 37.0 37.0 37.0 37.0 37.0 41 36.67868770348109 37.0 37.0 37.0 37.0 37.0 42 36.58291583166333 37.0 37.0 37.0 37.0 37.0 43 36.63606721845999 37.0 37.0 37.0 37.0 37.0 44 36.64962216624685 37.0 37.0 37.0 37.0 37.0 45 36.67148288973384 37.0 37.0 37.0 37.0 37.0 46 36.67793548387097 37.0 37.0 37.0 37.0 37.0 47 36.72264150943396 37.0 37.0 37.0 37.0 37.0 48 36.81018799272286 37.0 37.0 37.0 37.0 37.0 49 36.85862206292314 37.0 37.0 37.0 37.0 37.0 50 36.92079207920792 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 3.0 26 1.0 27 9.0 28 8.0 29 15.0 30 15.0 31 23.0 32 30.0 33 59.0 34 102.0 35 261.0 36 3472.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.8 16.3 20.1 42.8 2 23.755938984746187 13.928482120530134 29.982495623905976 32.3330832708177 3 24.375 16.900000000000002 20.95 37.775 4 26.85 22.35 23.425 27.375 5 27.325 24.725 23.95 24.0 6 24.2 26.375 25.124999999999996 24.3 7 20.8 23.25 33.225 22.725 8 21.8 22.375 28.675 27.150000000000002 9 23.150000000000002 22.8 27.450000000000003 26.6 10 23.3 29.599999999999998 23.9 23.200000000000003 11 26.650000000000002 22.400000000000002 23.400000000000002 27.55 12 26.3 20.825 24.525 28.349999999999998 13 25.8 22.650000000000002 24.8 26.75 14 24.95 22.3 24.725 28.025 15 24.575 22.875 23.674999999999997 28.875 16 25.025 23.175 24.6 27.200000000000003 17 25.25 22.2 24.925 27.625 18 24.2 24.85 24.375 26.575 19 25.6 22.85 25.224999999999998 26.325 20 25.275 22.925 24.275 27.525 21 26.25 23.25 23.425 27.075 22 26.275 24.425 24.825 24.474999999999998 23 25.474999999999998 23.025000000000002 24.9 26.6 24 26.424999999999997 22.55 22.475 28.549999999999997 25 25.0 22.325 25.174999999999997 27.500000000000004 26 24.0 24.4 24.65 26.950000000000003 27 25.974999999999998 22.175 24.5 27.35 28 26.775 23.724999999999998 23.325000000000003 26.174999999999997 29 25.374999999999996 23.325000000000003 24.275 27.025 30 26.375 23.1 23.25 27.275 31 25.025 23.45 24.825 26.700000000000003 32 24.7 22.625 24.875 27.800000000000004 33 26.474999999999998 22.5 24.2 26.825 34 24.425 23.549999999999997 24.325 27.700000000000003 35 26.556639159789945 22.980745186296573 22.85571392848212 27.60690172543136 36 27.081770442610654 22.80570142535634 23.080770192548137 27.031757939484873 37 25.062531265632813 23.56178089044522 23.13656828414207 28.23911955977989 38 25.387693846923458 24.16208104052026 24.187093546773387 26.263131565782892 39 25.925925925925924 23.223223223223226 24.324324324324326 26.526526526526528 40 25.350350350350347 23.54854854854855 24.04904904904905 27.05205205205205 41 26.897069872276486 22.789882294014525 23.516153268219384 26.79689456548961 42 26.452905811623246 21.743486973947896 23.972945891783567 27.83066132264529 43 24.55480311010785 23.777276147479306 24.680210684725356 26.987710057687487 44 26.120906801007553 22.46851385390428 24.206549118387912 27.204030226700255 45 26.61596958174905 22.686945500633712 23.244613434727505 27.452471482889734 46 25.41935483870968 23.225806451612904 23.870967741935484 27.483870967741936 47 26.68463611859838 20.59299191374663 25.09433962264151 27.628032345013477 48 25.46998180715585 18.829593693147363 25.773195876288657 29.927228623408126 49 25.686977299880525 14.13779370768618 28.07646356033453 32.098765432098766 50 25.940594059405942 0.0 35.84158415841584 38.21782178217822 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.5 21 0.5 22 0.0 23 1.0 24 3.5 25 4.5 26 5.0 27 9.5 28 13.0 29 13.5 30 20.0 31 29.5 32 36.0 33 51.0 34 73.0 35 86.0 36 103.0 37 124.0 38 131.5 39 155.0 40 186.5 41 219.5 42 251.5 43 258.5 44 270.0 45 288.5 46 285.5 47 287.5 48 290.5 49 279.0 50 279.5 51 264.0 52 257.0 53 266.5 54 244.5 55 220.5 56 218.5 57 221.0 58 219.5 59 208.5 60 201.0 61 185.0 62 158.5 63 148.5 64 149.0 65 152.0 66 141.5 67 123.5 68 114.0 69 111.5 70 111.5 71 106.0 72 97.5 73 90.0 74 81.5 75 69.5 76 54.0 77 43.5 78 42.0 79 39.0 80 28.5 81 20.5 82 18.0 83 12.5 84 7.0 85 5.5 86 4.0 87 2.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 0.0 36 1.0 37 0.0 38 2.0 39 0.0 40 3.0 41 1.0 42 5.0 43 17.0 44 25.0 45 70.0 46 165.0 47 412.0 48 787.0 49 996.0 50 1515.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103017 read2 length is 37-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103017_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 37-50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.012 33.0 33.0 33.0 33.0 33.0 2 32.4205 33.0 33.0 33.0 33.0 33.0 3 32.53425 33.0 33.0 33.0 33.0 33.0 4 32.626 33.0 33.0 33.0 33.0 33.0 5 32.7385 33.0 33.0 33.0 33.0 33.0 6 36.17 37.0 37.0 37.0 37.0 37.0 7 36.1955 37.0 37.0 37.0 37.0 37.0 8 36.174 37.0 37.0 37.0 37.0 37.0 9 36.1725 37.0 37.0 37.0 37.0 37.0 10 36.02375 37.0 37.0 37.0 37.0 37.0 11 36.06275 37.0 37.0 37.0 37.0 37.0 12 35.9965 37.0 37.0 37.0 37.0 37.0 13 36.05 37.0 37.0 37.0 37.0 37.0 14 36.08975 37.0 37.0 37.0 37.0 37.0 15 36.0905 37.0 37.0 37.0 37.0 37.0 16 36.15725 37.0 37.0 37.0 37.0 37.0 17 36.09275 37.0 37.0 37.0 37.0 37.0 18 36.09925 37.0 37.0 37.0 37.0 37.0 19 36.031 37.0 37.0 37.0 37.0 37.0 20 36.0465 37.0 37.0 37.0 37.0 37.0 21 36.01325 37.0 37.0 37.0 37.0 37.0 22 35.95875 37.0 37.0 37.0 37.0 37.0 23 36.067 37.0 37.0 37.0 37.0 37.0 24 36.003 37.0 37.0 37.0 37.0 37.0 25 36.06525 37.0 37.0 37.0 37.0 37.0 26 36.10025 37.0 37.0 37.0 37.0 37.0 27 36.13025 37.0 37.0 37.0 37.0 37.0 28 36.1565 37.0 37.0 37.0 37.0 37.0 29 36.134 37.0 37.0 37.0 37.0 37.0 30 36.09825 37.0 37.0 37.0 37.0 37.0 31 36.182 37.0 37.0 37.0 37.0 37.0 32 36.1925 37.0 37.0 37.0 37.0 37.0 33 36.10125 37.0 37.0 37.0 37.0 37.0 34 36.1375 37.0 37.0 37.0 37.0 37.0 35 36.20875 37.0 37.0 37.0 37.0 37.0 36 36.15825 37.0 37.0 37.0 37.0 37.0 37 36.153 37.0 37.0 37.0 37.0 37.0 38 36.21905476369092 37.0 37.0 37.0 37.0 37.0 39 36.2454954954955 37.0 37.0 37.0 37.0 37.0 40 36.1748059103431 37.0 37.0 37.0 37.0 37.0 41 36.292126379137414 37.0 37.0 37.0 37.0 37.0 42 36.32438534872052 37.0 37.0 37.0 37.0 37.0 43 36.27441626914386 37.0 37.0 37.0 37.0 37.0 44 36.2698212937327 37.0 37.0 37.0 37.0 37.0 45 36.252211271165024 37.0 37.0 37.0 37.0 37.0 46 36.3407012195122 37.0 37.0 37.0 37.0 37.0 47 36.333247885157654 37.0 37.0 37.0 37.0 37.0 48 36.50026497085321 37.0 37.0 37.0 37.0 37.0 49 36.694032023289665 37.0 37.0 37.0 37.0 37.0 50 36.8304 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 14.0 25 6.0 26 12.0 27 20.0 28 33.0 29 38.0 30 42.0 31 49.0 32 79.0 33 109.0 34 154.0 35 346.0 36 3096.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.425 17.375 11.975 38.224999999999994 2 29.25 22.400000000000002 26.125 22.225 3 24.0 25.05 23.7 27.250000000000004 4 26.974999999999998 28.349999999999998 18.9 25.775 5 28.299999999999997 30.425 18.925 22.35 6 22.875 31.85 19.7 25.575 7 24.45 18.725 30.45 26.375 8 24.025 22.75 22.650000000000002 30.575000000000003 9 23.724999999999998 22.8 25.45 28.025 10 25.7 30.175 20.1 24.025 11 28.599999999999998 22.75 19.3 29.349999999999998 12 28.249999999999996 20.849999999999998 23.0 27.900000000000002 13 27.075 22.725 22.425 27.775 14 25.75 24.099999999999998 23.05 27.1 15 27.025 23.25 23.849999999999998 25.874999999999996 16 27.625 23.525 21.875 26.974999999999998 17 28.9 23.599999999999998 20.724999999999998 26.775 18 25.974999999999998 25.025 22.25 26.75 19 27.275 23.35 22.45 26.924999999999997 20 27.500000000000004 24.025 21.675 26.8 21 27.6 24.025 21.425 26.950000000000003 22 25.674999999999997 23.35 23.150000000000002 27.825 23 26.575 23.875 23.175 26.375 24 26.924999999999997 24.075 22.925 26.075 25 25.8 23.45 22.900000000000002 27.85 26 27.35 23.474999999999998 22.0 27.175 27 26.35 25.650000000000002 22.475 25.525 28 25.924999999999997 23.724999999999998 22.725 27.625 29 26.700000000000003 23.65 22.475 27.175 30 25.35 23.974999999999998 23.05 27.625 31 26.724999999999998 21.8 23.400000000000002 28.075 32 29.25 22.400000000000002 22.175 26.174999999999997 33 27.200000000000003 24.175 21.975 26.650000000000002 34 25.624999999999996 23.674999999999997 22.725 27.975 35 27.1 23.400000000000002 22.45 27.05 36 26.775 24.2 23.200000000000003 25.825 37 26.1 23.200000000000003 23.025000000000002 27.675 38 28.00700175043761 23.53088272068017 22.605651412853213 25.85646411602901 39 27.077077077077078 23.123123123123122 21.97197197197197 27.82782782782783 40 26.947157525669923 23.541197094916104 21.838216879539193 27.67342849987478 41 28.91173520561685 22.91875626880642 22.46740220661986 25.70210631895687 42 26.517812343201204 24.560963371801304 22.503763171098846 26.417461113898643 43 28.069294501631937 23.324127542053727 22.847100175746924 25.759477780567412 44 27.787566070979107 23.131135162345835 20.891014346841178 28.190284419833876 45 26.863785696234523 25.322213798332072 22.618145059388425 25.195855446044984 46 27.921747967479675 22.129065040650406 23.729674796747968 26.21951219512195 47 27.069982055883106 23.558062035375546 22.50704947449372 26.864906434247626 48 27.000529941706414 22.125066242713302 23.158452570217275 27.71595124536301 49 26.055312954876275 17.00145560407569 26.666666666666668 30.27656477438137 50 29.64 0.0 33.239999999999995 37.12 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 0.0 27 2.0 28 6.5 29 11.5 30 13.0 31 15.5 32 27.0 33 36.5 34 39.0 35 56.0 36 82.0 37 102.5 38 120.0 39 145.5 40 161.0 41 176.5 42 214.5 43 246.0 44 256.5 45 269.0 46 290.5 47 307.5 48 315.5 49 301.5 50 279.0 51 273.5 52 272.5 53 252.5 54 233.5 55 221.0 56 212.5 57 212.0 58 213.0 59 210.0 60 197.5 61 174.5 62 158.5 63 162.0 64 166.0 65 159.0 66 147.5 67 140.5 68 137.0 69 133.5 70 129.5 71 119.0 72 109.0 73 104.0 74 97.5 75 78.5 76 61.0 77 52.5 78 45.5 79 34.0 80 23.5 81 22.5 82 20.0 83 12.0 84 5.0 85 4.5 86 4.5 87 3.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 37 1.0 38 3.0 39 3.0 40 5.0 41 2.0 42 3.0 43 10.0 44 16.0 45 21.0 46 35.0 47 127.0 48 339.0 49 935.0 50 2500.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563167 spots for SRR9103017.sra Written 563167 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra Read 563165 spots for SRR9103017.sra Written 563165 spots for SRR9103017.sra SRR ids: ['SRR9103017.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ut8_o26 SRR9103017.sra spots: 11263302 blocks: [[1, 563165], [563166, 1126330], [1126331, 1689495], [1689496, 2252660], [2252661, 2815825], [2815826, 3378990], [3378991, 3942155], [3942156, 4505320], [4505321, 5068485], [5068486, 5631650], [5631651, 6194815], [6194816, 6757980], [6757981, 7321145], [7321146, 7884310], [7884311, 8447475], [8447476, 9010640], [9010641, 9573805], [9573806, 10136970], [10136971, 10700135], [10700136, 11263302]] SRR9103017 file size 1537554 SRR9103017 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103017 SRR9103017_1.fastq SRR9103017_2.fastq Input file: SRR9103017_1.fastq Paired file: SRR9103017_2.fastq trimmed: SRR9103017-trimmed-pair1.fastq, SRR9103017-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:04:25 2024 >> started Sat Dec 7 02:04:33 2024 >> done (8.188s) 11263302 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11263302 (100.00%) read pairs available; of these: 59 ( 0.00%) trimmed read pairs available after processing 11263243 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 34 55 0.00% 35 117 0.00% 36 235 0.00% 37 415 0.00% 38 827 0.01% 39 1728 0.02% 40 4198 0.04% 41 9359 0.08% 42 17001 0.15% 43 22792 0.20% 44 36903 0.33% 45 69068 0.61% 46 170320 1.51% 47 586513 5.21% 48 2145140 19.05% 49 5128043 45.53% 50 3070588 27.26% 11263302 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=30.23 fanout-score-rank=19 prefix-density=0.24 prefix-fanout=8.6 sequence=CTGCTGCTGCTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=13 fanout-score=276.63 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=27.2 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=132.09 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=18.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=364.58 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=20.2 sequence=CCGCCGCCGTCG SRR9103017 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:04:57 Started mapping on | Dec 07 02:04:57 Finished on | Dec 07 02:05:12 Mapping speed, Million of reads per hour | 2703.19 Number of input reads | 11263302 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 10907964 Uniquely mapped reads % | 96.85% Average mapped length | 97.98 Number of splices: Total | 3003880 Number of splices: Annotated (sjdb) | 2883377 Number of splices: GT/AG | 2966456 Number of splices: GC/AG | 33980 Number of splices: AT/AC | 2126 Number of splices: Non-canonical | 1318 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173922 % of reads mapped to multiple loci | 1.54% Number of reads mapped to too many loci | 61479 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 181416 181416 181416 N_multimapping 173922 173922 173922 N_noFeature 248072 10601097 398106 N_ambiguous 170142 1029 13560 UnstrandedReadsAssigned:10489750 PositiveStrandReadsAssigned:305838 NegativeStrandReadsAssigned:10496298 Dataset is classified negative stranded MeadianReadLen=49 20thPercentileLength=48 echo kmer=43 SRR9103017 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103017-trimmed-pair1.fastq SRR9103017-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,263,302 reads, 10,643,861 reads pseudoaligned [quant] estimated average fragment length: 162.521 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52973 SRR9103017.ke.tsv 35125 SRR9103017.se.tsv 88098 total ==> SRR9103017.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.754 28.4564 5.21172 PNS24247 1044 882.479 17.9329 2.88344 PNS24249 1928 1766.48 130.78 10.505 PNS24246 1044 882.479 17.9329 2.88344 PNS24248 1044 882.479 17.9329 2.88344 PNS24244 1471 1309.48 26.9654 2.92195 PNS24243 293 138.293 0 0 KQK14069 1603 1441.48 1160.78 114.264 KQK14071 474 314.086 70.7306 31.9539 ==> SRR9103017.se.tsv <== BRADI_1g14170v3 1245 BRADI_1g53295v3 41 BRADI_1g59795v3 44 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 491 BRADI_1g74790v3 64 BRADI_1g09890v3 0 BRADI_1g77505v3 66 BRADI_1g48960v3 0 SRR9103017 completed mapping pipeline successfully