Starting /dee2/code/volunteer_pipeline.sh SRR9103018 current disk space = 1547894996992 free memory = 1602071080 SRR9103018 SRAfilesize dcc402121b05cb48f4ea547fada074fe SRR9103018.sra SRR9103018.sra file validated SRR9103018 is paired end SRR9103018 is conventional basespace SRR9103018 read1 length is 35-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103018_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.023 33.0 33.0 33.0 33.0 33.0 2 29.73025 33.0 27.0 33.0 27.0 33.0 3 31.592 33.0 33.0 33.0 27.0 33.0 4 32.91225 33.0 33.0 33.0 33.0 37.0 5 33.32825 33.0 33.0 33.0 33.0 37.0 6 35.84275 37.0 37.0 37.0 33.0 37.0 7 36.14375 37.0 37.0 37.0 33.0 37.0 8 36.335 37.0 37.0 37.0 37.0 37.0 9 36.56225 37.0 37.0 37.0 37.0 37.0 10 36.61775 37.0 37.0 37.0 37.0 37.0 11 36.59175 37.0 37.0 37.0 37.0 37.0 12 36.63075 37.0 37.0 37.0 37.0 37.0 13 36.59325 37.0 37.0 37.0 37.0 37.0 14 36.56675 37.0 37.0 37.0 37.0 37.0 15 36.573 37.0 37.0 37.0 37.0 37.0 16 36.61125 37.0 37.0 37.0 37.0 37.0 17 36.6625 37.0 37.0 37.0 37.0 37.0 18 36.58575 37.0 37.0 37.0 37.0 37.0 19 36.65525 37.0 37.0 37.0 37.0 37.0 20 36.684 37.0 37.0 37.0 37.0 37.0 21 36.663 37.0 37.0 37.0 37.0 37.0 22 36.6625 37.0 37.0 37.0 37.0 37.0 23 36.6195 37.0 37.0 37.0 37.0 37.0 24 36.65425 37.0 37.0 37.0 37.0 37.0 25 36.6855 37.0 37.0 37.0 37.0 37.0 26 36.635 37.0 37.0 37.0 37.0 37.0 27 36.62575 37.0 37.0 37.0 37.0 37.0 28 36.6095 37.0 37.0 37.0 37.0 37.0 29 36.61775 37.0 37.0 37.0 37.0 37.0 30 36.598 37.0 37.0 37.0 37.0 37.0 31 36.61825 37.0 37.0 37.0 37.0 37.0 32 36.59275 37.0 37.0 37.0 37.0 37.0 33 36.6435 37.0 37.0 37.0 37.0 37.0 34 36.6835 37.0 37.0 37.0 37.0 37.0 35 36.66175 37.0 37.0 37.0 37.0 37.0 36 36.6479119779945 37.0 37.0 37.0 37.0 37.0 37 36.699099549774886 37.0 37.0 37.0 37.0 37.0 38 36.62456228114057 37.0 37.0 37.0 37.0 37.0 39 36.647147147147145 37.0 37.0 37.0 37.0 37.0 40 36.69929894842264 37.0 37.0 37.0 37.0 37.0 41 36.68779754447507 37.0 37.0 37.0 37.0 37.0 42 36.66407425990968 37.0 37.0 37.0 37.0 37.0 43 36.73336680893799 37.0 37.0 37.0 37.0 37.0 44 36.73827534039334 37.0 37.0 37.0 37.0 37.0 45 36.74593495934959 37.0 37.0 37.0 37.0 37.0 46 36.75652623416904 37.0 37.0 37.0 37.0 37.0 47 36.75363098440022 37.0 37.0 37.0 37.0 37.0 48 36.799349881796694 37.0 37.0 37.0 37.0 37.0 49 36.8889634350889 37.0 37.0 37.0 37.0 37.0 50 36.91312559017941 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 1.0 26 3.0 27 4.0 28 5.0 29 8.0 30 16.0 31 27.0 32 38.0 33 45.0 34 143.0 35 425.0 36 3282.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.0 6.6000000000000005 9.950000000000001 56.45 2 23.10577644411103 14.728682170542637 31.45786446611653 30.707676919229808 3 24.2 16.175 22.3 37.325 4 27.400000000000002 21.15 21.675 29.775000000000002 5 26.325 25.45 24.25 23.974999999999998 6 24.55 27.125 24.474999999999998 23.849999999999998 7 21.7 22.225 33.75 22.325 8 22.475 22.275 28.849999999999998 26.400000000000002 9 22.525000000000002 22.575 29.525000000000002 25.374999999999996 10 23.1 28.625 24.625 23.65 11 25.8 23.0 22.7 28.499999999999996 12 26.55 21.5 24.2 27.750000000000004 13 23.775 23.974999999999998 25.650000000000002 26.6 14 24.349999999999998 23.474999999999998 25.85 26.325 15 23.974999999999998 22.425 25.924999999999997 27.675 16 23.674999999999997 22.275 24.775 29.275000000000002 17 25.6 22.175 24.474999999999998 27.750000000000004 18 23.775 23.674999999999997 25.75 26.8 19 25.5 23.225 23.575 27.700000000000003 20 25.275 24.05 24.425 26.25 21 24.725 23.674999999999997 24.474999999999998 27.125 22 24.2 23.674999999999997 24.5 27.625 23 25.6 23.925 25.05 25.424999999999997 24 25.924999999999997 22.375 24.625 27.075 25 25.074999999999996 22.8 24.425 27.700000000000003 26 24.125 23.849999999999998 24.85 27.175 27 26.1 22.5 24.925 26.474999999999998 28 24.4 23.05 23.674999999999997 28.875 29 24.075 23.775 25.0 27.150000000000002 30 25.275 24.15 24.725 25.85 31 24.95 21.725 25.575 27.750000000000004 32 25.174999999999997 24.925 23.9 26.0 33 24.85 22.775000000000002 25.074999999999996 27.3 34 25.7 22.825 23.3 28.175 35 25.674999999999997 23.05 23.95 27.325 36 25.131282820705174 23.355838959739934 24.131032758189548 27.38184546136534 37 25.53776888444222 23.56178089044522 24.287143571785894 26.613306653326664 38 25.062531265632813 24.23711855927964 23.6368184092046 27.063531765882942 39 24.5995995995996 23.673673673673672 24.4994994994995 27.227227227227228 40 25.43815723585378 22.8843264897346 24.261392088132197 27.41612418627942 41 25.457278877474316 24.104234527687296 23.427712352793787 27.0107742420446 42 25.664826894129455 22.80481685900652 24.560963371801304 26.96939287506272 43 25.13181019332162 22.847100175746924 24.830529751443635 27.190559879487825 44 25.592536560766515 24.684820978315685 23.827534039334342 25.89510842158346 45 25.584349593495936 22.052845528455283 24.61890243902439 27.743902439024392 46 25.975704316360815 21.81442233135177 24.243990695270096 27.965882657017318 47 24.394835933297472 21.947283485745025 24.771382463690156 28.88649811726735 48 26.12293144208038 19.148936170212767 25.53191489361702 29.196217494089833 49 24.622609862462262 17.2089902717209 26.23280778262328 31.93559208319356 50 26.817752596789425 0.0 34.89140698772427 38.29084041548631 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 3.5 24 3.0 25 2.5 26 5.5 27 11.0 28 15.0 29 18.0 30 22.0 31 28.0 32 37.0 33 48.5 34 56.5 35 73.5 36 95.0 37 109.0 38 127.5 39 161.0 40 187.5 41 218.5 42 254.0 43 266.5 44 282.0 45 294.5 46 291.0 47 294.5 48 301.0 49 287.0 50 278.0 51 267.0 52 246.5 53 251.5 54 263.5 55 253.5 56 231.0 57 203.0 58 187.5 59 182.5 60 170.5 61 161.5 62 162.5 63 164.0 64 152.5 65 143.0 66 145.5 67 140.0 68 132.5 69 121.0 70 103.5 71 91.0 72 88.0 73 90.5 74 79.5 75 69.5 76 64.0 77 51.5 78 42.0 79 30.0 80 19.0 81 16.0 82 12.5 83 9.5 84 7.5 85 6.0 86 4.5 87 3.5 88 2.5 89 1.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 35 1.0 36 1.0 37 0.0 38 2.0 39 2.0 40 3.0 41 5.0 42 3.0 43 17.0 44 30.0 45 67.0 46 151.0 47 334.0 48 403.0 49 863.0 50 2118.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103018 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103018_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.008 33.0 33.0 33.0 33.0 33.0 2 32.56975 33.0 33.0 33.0 33.0 33.0 3 32.55 33.0 33.0 33.0 33.0 33.0 4 32.603 33.0 33.0 33.0 33.0 33.0 5 32.74375 33.0 33.0 33.0 33.0 33.0 6 36.3065 37.0 37.0 37.0 37.0 37.0 7 36.3045 37.0 37.0 37.0 37.0 37.0 8 36.269 37.0 37.0 37.0 37.0 37.0 9 36.25225 37.0 37.0 37.0 37.0 37.0 10 36.182 37.0 37.0 37.0 37.0 37.0 11 36.25975 37.0 37.0 37.0 37.0 37.0 12 36.21475 37.0 37.0 37.0 37.0 37.0 13 36.23825 37.0 37.0 37.0 37.0 37.0 14 36.2285 37.0 37.0 37.0 37.0 37.0 15 36.24775 37.0 37.0 37.0 37.0 37.0 16 36.3275 37.0 37.0 37.0 37.0 37.0 17 36.2725 37.0 37.0 37.0 37.0 37.0 18 36.37425 37.0 37.0 37.0 37.0 37.0 19 36.23325 37.0 37.0 37.0 37.0 37.0 20 36.25 37.0 37.0 37.0 37.0 37.0 21 36.25075 37.0 37.0 37.0 37.0 37.0 22 36.2735 37.0 37.0 37.0 37.0 37.0 23 36.18275 37.0 37.0 37.0 37.0 37.0 24 36.2255 37.0 37.0 37.0 37.0 37.0 25 36.28125 37.0 37.0 37.0 37.0 37.0 26 36.2935 37.0 37.0 37.0 37.0 37.0 27 36.31275 37.0 37.0 37.0 37.0 37.0 28 36.3195 37.0 37.0 37.0 37.0 37.0 29 36.34725 37.0 37.0 37.0 37.0 37.0 30 36.38425 37.0 37.0 37.0 37.0 37.0 31 36.339 37.0 37.0 37.0 37.0 37.0 32 36.3735 37.0 37.0 37.0 37.0 37.0 33 36.35025 37.0 37.0 37.0 37.0 37.0 34 36.34925 37.0 37.0 37.0 37.0 37.0 35 36.34108527131783 37.0 37.0 37.0 37.0 37.0 36 36.331748811608705 37.0 37.0 37.0 37.0 37.0 37 36.347847847847845 37.0 37.0 37.0 37.0 37.0 38 36.36520650813517 37.0 37.0 37.0 37.0 37.0 39 36.46342685370742 37.0 37.0 37.0 37.0 37.0 40 36.40546639919759 37.0 37.0 37.0 37.0 37.0 41 36.45760160561967 37.0 37.0 37.0 37.0 37.0 42 36.4290379301683 37.0 37.0 37.0 37.0 37.0 43 36.48139768728004 37.0 37.0 37.0 37.0 37.0 44 36.44061399094112 37.0 37.0 37.0 37.0 37.0 45 36.47173144876325 37.0 37.0 37.0 37.0 37.0 46 36.51672579827674 37.0 37.0 37.0 37.0 37.0 47 36.52193877551021 37.0 37.0 37.0 37.0 37.0 48 36.64422321194655 37.0 37.0 37.0 37.0 37.0 49 36.67868474185175 37.0 37.0 37.0 37.0 37.0 50 36.844551282051285 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 6.0 24 8.0 25 11.0 26 8.0 27 13.0 28 18.0 29 21.0 30 40.0 31 47.0 32 43.0 33 90.0 34 120.0 35 311.0 36 3261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.050000000000004 16.2 12.15 37.6 2 29.4 22.475 25.45 22.675 3 24.05 24.825 23.375 27.750000000000004 4 28.050000000000004 28.375 18.625 24.95 5 30.125 30.675 18.075 21.125 6 24.825 31.45 20.225 23.5 7 24.474999999999998 19.400000000000002 31.225 24.9 8 25.0 22.175 23.525 29.299999999999997 9 25.374999999999996 22.900000000000002 24.125 27.6 10 27.425 29.975 18.8 23.799999999999997 11 28.525 23.25 18.35 29.875 12 27.125 22.25 21.45 29.175 13 26.075 24.7 22.25 26.974999999999998 14 28.275 23.775 22.825 25.124999999999996 15 25.775 24.625 22.325 27.275 16 28.175 23.625 22.975 25.224999999999998 17 28.849999999999998 23.925 20.825 26.400000000000002 18 27.05 23.549999999999997 23.200000000000003 26.200000000000003 19 27.025 24.85 21.475 26.650000000000002 20 28.175 24.825 21.5 25.5 21 26.875 25.025 22.475 25.624999999999996 22 26.875 24.875 22.125 26.125 23 26.85 24.95 21.825 26.375 24 26.75 24.075 23.575 25.6 25 27.725 23.925 22.125 26.224999999999998 26 28.050000000000004 23.75 22.25 25.95 27 26.55 23.425 22.425 27.6 28 28.125 24.099999999999998 22.875 24.9 29 28.15 24.349999999999998 22.650000000000002 24.85 30 26.900000000000002 24.224999999999998 22.3 26.575 31 28.225 24.474999999999998 21.625 25.674999999999997 32 28.275 24.65 22.075 25.0 33 26.85 23.925 22.45 26.775 34 26.25 24.5 22.775000000000002 26.474999999999998 35 28.33208302075519 24.281070267566893 21.630407601900476 25.756439109777446 36 26.444833625218916 25.11883912934701 22.9672254190643 25.469101826369776 37 27.25225225225225 23.34834834834835 22.54754754754755 26.851851851851855 38 26.48310387984981 24.480600750938674 22.428035043804755 26.608260325406757 39 26.402805611222448 24.574148296593187 22.84569138276553 26.177354709418836 40 27.783350050150453 23.42026078234704 21.790371113340022 27.00601805416249 41 26.04114400401405 24.05920722528851 22.629202207727044 27.270446562970395 42 26.048731474503896 24.039186134137154 22.356191911580005 27.55589047977895 43 26.19406737053796 23.906485671191554 23.02664655605832 26.872800402212167 44 29.466532460996476 24.81127327629592 21.263210870659286 24.458983392048314 45 25.946491670873296 24.68450277637557 23.04391721352852 26.325088339222614 46 27.065382665990878 23.82159148504815 23.188038520020275 25.924987328940702 47 27.780612244897956 23.698979591836736 23.112244897959183 25.408163265306122 48 27.560911710767616 22.216400314383023 23.13335079905685 27.089337175792505 49 27.545428324199595 17.85405249495241 25.81482549754831 28.785693683299684 50 28.76602564102564 0.0 32.65224358974359 38.581730769230774 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 0.5 24 0.0 25 0.0 26 1.0 27 2.5 28 4.5 29 9.5 30 13.5 31 17.0 32 25.5 33 39.5 34 47.5 35 54.5 36 69.0 37 100.5 38 131.5 39 153.0 40 178.0 41 202.0 42 236.0 43 272.0 44 285.0 45 291.5 46 303.0 47 300.5 48 284.5 49 288.0 50 308.5 51 282.0 52 242.0 53 235.5 54 235.0 55 224.5 56 208.0 57 200.5 58 201.0 59 196.0 60 182.5 61 167.0 62 160.0 63 150.5 64 145.0 65 146.5 66 141.5 67 137.5 68 132.5 69 130.0 70 129.5 71 118.5 72 102.5 73 92.5 74 89.0 75 81.0 76 70.5 77 56.0 78 44.0 79 37.5 80 30.5 81 23.0 82 15.5 83 12.5 84 9.5 85 8.0 86 7.0 87 5.5 88 4.0 89 2.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 2.0 36 1.0 37 1.0 38 3.0 39 4.0 40 2.0 41 5.0 42 3.0 43 4.0 44 12.0 45 16.0 46 26.0 47 103.0 48 350.0 49 971.0 50 2496.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245910 spots for SRR9103018.sra Written 1245910 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra Read 1245897 spots for SRR9103018.sra Written 1245897 spots for SRR9103018.sra SRR ids: ['SRR9103018.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_appxmft2 SRR9103018.sra spots: 24917953 blocks: [[1, 1245897], [1245898, 2491794], [2491795, 3737691], [3737692, 4983588], [4983589, 6229485], [6229486, 7475382], [7475383, 8721279], [8721280, 9967176], [9967177, 11213073], [11213074, 12458970], [12458971, 13704867], [13704868, 14950764], [14950765, 16196661], [16196662, 17442558], [17442559, 18688455], [18688456, 19934352], [19934353, 21180249], [21180250, 22426146], [22426147, 23672043], [23672044, 24917953]] SRR9103018 file size 3436612 SRR9103018 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103018 SRR9103018_1.fastq SRR9103018_2.fastq Input file: SRR9103018_1.fastq Paired file: SRR9103018_2.fastq trimmed: SRR9103018-trimmed-pair1.fastq, SRR9103018-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:11:37 2024 >> started Sat Dec 7 02:11:59 2024 >> done (21.921s) 24917953 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 24917953 (100.00%) read pairs available; of these: 132 ( 0.00%) trimmed read pairs available after processing 24917821 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 2 0.00% 34 158 0.00% 35 290 0.00% 36 528 0.00% 37 868 0.00% 38 1554 0.01% 39 3259 0.01% 40 6755 0.03% 41 14638 0.06% 42 28626 0.11% 43 39243 0.16% 44 64381 0.26% 45 127549 0.51% 46 329214 1.32% 47 1145950 4.60% 48 3989868 16.01% 49 10682317 42.87% 50 8482753 34.04% 24917953 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=10.97 fanout-score-rank=22 prefix-density=0.34 prefix-fanout=4.1 sequence=GGCTTGGGCTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=317.22 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=29.4 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.7 sequence=AACCAGAGCAGCCCAAGCCCAAGCCTACTCAACCAGATCAACCGAAGCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=354.18 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=20.4 sequence=CGCCGCCGCCGA SRR9103018 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:12:25 Started mapping on | Dec 07 02:12:25 Finished on | Dec 07 02:12:54 Mapping speed, Million of reads per hour | 3093.26 Number of input reads | 24917953 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 24064173 Uniquely mapped reads % | 96.57% Average mapped length | 98.20 Number of splices: Total | 6397323 Number of splices: Annotated (sjdb) | 6127840 Number of splices: GT/AG | 6317240 Number of splices: GC/AG | 72960 Number of splices: AT/AC | 4096 Number of splices: Non-canonical | 3027 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382122 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 183181 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471658 471658 471658 N_multimapping 382122 382122 382122 N_noFeature 578116 23320916 947321 N_ambiguous 404464 2567 31069 UnstrandedReadsAssigned:23081593 PositiveStrandReadsAssigned:740690 NegativeStrandReadsAssigned:23085783 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=48 echo kmer=43 SRR9103018 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103018-trimmed-pair1.fastq SRR9103018-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,917,953 reads, 23,413,864 reads pseudoaligned [quant] estimated average fragment length: 156.437 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR9103018.ke.tsv 35125 SRR9103018.se.tsv 88098 total ==> SRR9103018.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 780.683 160.748 12.8132 PNS24247 1044 888.563 33.0866 2.31713 PNS24249 1928 1772.56 312.023 10.954 PNS24246 1044 888.563 33.0866 2.31713 PNS24248 1044 888.563 33.0866 2.31713 PNS24244 1471 1315.56 54.9689 2.60011 PNS24243 293 143.651 0 0 KQK14069 1603 1447.56 3905.94 167.909 KQK14071 474 319.726 146.766 28.5649 ==> SRR9103018.se.tsv <== BRADI_1g14170v3 4082 BRADI_1g53295v3 80 BRADI_1g59795v3 132 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 976 BRADI_1g74790v3 173 BRADI_1g09890v3 0 BRADI_1g77505v3 192 BRADI_1g48960v3 0 SRR9103018 completed mapping pipeline successfully