Starting /dee2/code/volunteer_pipeline.sh SRR9103019 current disk space = 1547854483456 free memory = 1600264552 SRR9103019 SRAfilesize fe08354ae7d05b9690a9c8e48e4690ca SRR9103019.sra SRR9103019.sra file validated SRR9103019 is paired end SRR9103019 is conventional basespace SRR9103019 read1 length is 36-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103019_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-50 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.025 33.0 33.0 33.0 33.0 33.0 2 29.28225 33.0 27.0 33.0 14.0 33.0 3 31.9385 33.0 33.0 33.0 27.0 33.0 4 33.11975 33.0 33.0 33.0 33.0 37.0 5 33.77025 33.0 33.0 37.0 33.0 37.0 6 35.84175 37.0 37.0 37.0 33.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.59675 37.0 37.0 37.0 37.0 37.0 9 36.569 37.0 37.0 37.0 37.0 37.0 10 36.61375 37.0 37.0 37.0 37.0 37.0 11 36.675 37.0 37.0 37.0 37.0 37.0 12 36.61475 37.0 37.0 37.0 37.0 37.0 13 36.617 37.0 37.0 37.0 37.0 37.0 14 36.56075 37.0 37.0 37.0 37.0 37.0 15 36.51975 37.0 37.0 37.0 37.0 37.0 16 36.59225 37.0 37.0 37.0 37.0 37.0 17 36.5625 37.0 37.0 37.0 37.0 37.0 18 36.5565 37.0 37.0 37.0 37.0 37.0 19 36.6265 37.0 37.0 37.0 37.0 37.0 20 36.58875 37.0 37.0 37.0 37.0 37.0 21 36.589 37.0 37.0 37.0 37.0 37.0 22 36.6665 37.0 37.0 37.0 37.0 37.0 23 36.688 37.0 37.0 37.0 37.0 37.0 24 36.611 37.0 37.0 37.0 37.0 37.0 25 36.60925 37.0 37.0 37.0 37.0 37.0 26 36.62975 37.0 37.0 37.0 37.0 37.0 27 36.6485 37.0 37.0 37.0 37.0 37.0 28 36.6665 37.0 37.0 37.0 37.0 37.0 29 36.58825 37.0 37.0 37.0 37.0 37.0 30 36.60875 37.0 37.0 37.0 37.0 37.0 31 36.59425 37.0 37.0 37.0 37.0 37.0 32 36.63075 37.0 37.0 37.0 37.0 37.0 33 36.5965 37.0 37.0 37.0 37.0 37.0 34 36.627 37.0 37.0 37.0 37.0 37.0 35 36.636 37.0 37.0 37.0 37.0 37.0 36 36.63175 37.0 37.0 37.0 37.0 37.0 37 36.62056028014007 37.0 37.0 37.0 37.0 37.0 38 36.672336168084044 37.0 37.0 37.0 37.0 37.0 39 36.61205602801401 37.0 37.0 37.0 37.0 37.0 40 36.66358179089545 37.0 37.0 37.0 37.0 37.0 41 36.70806209313971 37.0 37.0 37.0 37.0 37.0 42 36.65572538210975 37.0 37.0 37.0 37.0 37.0 43 36.70704790569351 37.0 37.0 37.0 37.0 37.0 44 36.689229994967285 37.0 37.0 37.0 37.0 37.0 45 36.703073406146814 37.0 37.0 37.0 37.0 37.0 46 36.73233238415739 37.0 37.0 37.0 37.0 37.0 47 36.703005464480874 37.0 37.0 37.0 37.0 37.0 48 36.70290964777948 37.0 37.0 37.0 37.0 37.0 49 36.8036832412523 37.0 37.0 37.0 37.0 37.0 50 36.892415277030665 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 9.0 28 4.0 29 12.0 30 22.0 31 23.0 32 54.0 33 52.0 34 116.0 35 359.0 36 3345.0 37 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.175000000000004 6.550000000000001 8.175 33.1 2 25.075075075075077 13.838838838838837 29.629629629629626 31.456456456456454 3 24.175 17.4 22.1 36.325 4 28.000000000000004 19.8 22.375 29.825000000000003 5 25.85 24.7 24.275 25.174999999999997 6 24.425 25.75 25.95 23.875 7 23.95 23.799999999999997 29.95 22.3 8 22.3 24.175 27.800000000000004 25.724999999999998 9 22.925 21.9 30.225 24.95 10 24.675 25.6 25.45 24.275 11 25.674999999999997 22.8 23.875 27.650000000000002 12 25.174999999999997 21.025 25.4 28.4 13 26.075 22.5 23.7 27.725 14 24.8 22.375 26.325 26.5 15 24.675 23.625 24.875 26.825 16 26.3 22.35 24.175 27.175 17 24.825 23.45 24.375 27.35 18 25.474999999999998 22.45 24.75 27.325 19 26.450000000000003 22.95 23.799999999999997 26.8 20 25.05 23.200000000000003 25.4 26.35 21 24.725 23.275000000000002 24.75 27.250000000000004 22 26.275 22.75 23.200000000000003 27.775 23 26.55 22.775000000000002 25.374999999999996 25.3 24 24.85 23.799999999999997 23.875 27.474999999999998 25 25.874999999999996 22.3 23.35 28.475 26 25.650000000000002 21.925 25.35 27.075 27 24.325 23.974999999999998 24.4 27.3 28 26.125 22.45 23.65 27.775 29 25.900000000000002 24.099999999999998 23.474999999999998 26.525 30 25.624999999999996 23.200000000000003 24.5 26.674999999999997 31 27.075 23.3 21.975 27.650000000000002 32 24.875 24.099999999999998 24.4 26.625 33 25.474999999999998 23.375 25.0 26.150000000000002 34 26.0 22.400000000000002 23.05 28.549999999999997 35 24.65 23.45 25.224999999999998 26.674999999999997 36 24.625 22.85 24.125 28.4 37 26.18809404702351 22.586293146573286 22.63631815907954 28.58929464732366 38 25.212606303151574 24.412206103051524 24.462231115557778 25.912956478239117 39 25.287643821910955 22.936468234117058 23.986993496748372 27.788894447223612 40 26.863431715857928 22.411205602801402 22.28614307153577 28.4392196098049 41 25.212819228843266 23.885828743114672 25.6885327991988 25.212819228843266 42 24.65547481834127 22.95164119268354 24.680531195189175 27.712352793786017 43 26.059694005517937 23.97792826686732 22.397792826686732 27.56458490092802 44 26.17010568696527 23.50276799194766 23.729240060392552 26.597886260694516 45 25.654051308102616 22.809245618491236 24.30784861569723 27.228854457708916 46 27.388040383121925 20.864612995081544 24.540512555009062 27.206834066787472 47 25.10928961748634 20.245901639344265 26.284153005464482 28.36065573770492 48 25.819295558958654 18.652373660030626 25.51301684532925 30.01531393568147 49 28.434622467771636 15.248618784530388 26.998158379373848 29.318600368324127 50 27.326519634211945 0.0 34.319526627218934 38.353953738569125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 2.5 21 1.5 22 1.0 23 1.0 24 1.0 25 1.0 26 1.0 27 3.0 28 6.0 29 8.0 30 14.5 31 23.0 32 24.0 33 32.0 34 56.5 35 79.5 36 94.5 37 117.5 38 134.5 39 145.5 40 166.0 41 199.5 42 236.0 43 251.0 44 255.0 45 260.5 46 271.5 47 297.0 48 319.5 49 316.0 50 308.0 51 306.0 52 289.5 53 259.0 54 237.0 55 234.0 56 238.5 57 220.5 58 196.0 59 190.5 60 186.0 61 173.5 62 158.5 63 148.5 64 149.5 65 149.5 66 141.5 67 136.5 68 135.5 69 130.0 70 119.0 71 104.0 72 92.0 73 89.5 74 87.0 75 70.5 76 55.5 77 51.5 78 44.5 79 36.0 80 30.0 81 21.5 82 16.0 83 15.0 84 10.0 85 6.0 86 3.5 87 3.0 88 2.5 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36 2.0 37 0.0 38 0.0 39 0.0 40 4.0 41 3.0 42 4.0 43 13.0 44 37.0 45 74.0 46 203.0 47 395.0 48 550.0 49 856.0 50 1859.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR9103019 read2 length is 34-50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR9103019_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 34-50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.009 33.0 33.0 33.0 33.0 33.0 2 32.471 33.0 33.0 33.0 33.0 33.0 3 32.476 33.0 33.0 33.0 33.0 33.0 4 32.58375 33.0 33.0 33.0 33.0 33.0 5 32.728 33.0 33.0 33.0 33.0 33.0 6 36.25375 37.0 37.0 37.0 37.0 37.0 7 36.24975 37.0 37.0 37.0 37.0 37.0 8 36.243 37.0 37.0 37.0 37.0 37.0 9 36.20575 37.0 37.0 37.0 37.0 37.0 10 36.10825 37.0 37.0 37.0 37.0 37.0 11 36.13125 37.0 37.0 37.0 37.0 37.0 12 36.018 37.0 37.0 37.0 37.0 37.0 13 36.08875 37.0 37.0 37.0 37.0 37.0 14 36.17225 37.0 37.0 37.0 37.0 37.0 15 36.11325 37.0 37.0 37.0 37.0 37.0 16 36.13725 37.0 37.0 37.0 37.0 37.0 17 36.09575 37.0 37.0 37.0 37.0 37.0 18 36.20575 37.0 37.0 37.0 37.0 37.0 19 36.135 37.0 37.0 37.0 37.0 37.0 20 36.09725 37.0 37.0 37.0 37.0 37.0 21 36.09925 37.0 37.0 37.0 37.0 37.0 22 36.14225 37.0 37.0 37.0 37.0 37.0 23 36.08925 37.0 37.0 37.0 37.0 37.0 24 36.05975 37.0 37.0 37.0 37.0 37.0 25 36.14925 37.0 37.0 37.0 37.0 37.0 26 36.08925 37.0 37.0 37.0 37.0 37.0 27 36.21675 37.0 37.0 37.0 37.0 37.0 28 36.16825 37.0 37.0 37.0 37.0 37.0 29 36.23225 37.0 37.0 37.0 37.0 37.0 30 36.27375 37.0 37.0 37.0 37.0 37.0 31 36.2025 37.0 37.0 37.0 37.0 37.0 32 36.11625 37.0 37.0 37.0 37.0 37.0 33 36.188 37.0 37.0 37.0 37.0 37.0 34 36.24125 37.0 37.0 37.0 37.0 37.0 35 36.20405101275319 37.0 37.0 37.0 37.0 37.0 36 36.18759379689845 37.0 37.0 37.0 37.0 37.0 37 36.29614807403702 37.0 37.0 37.0 37.0 37.0 38 36.271953965474104 37.0 37.0 37.0 37.0 37.0 39 36.364455569461825 37.0 37.0 37.0 37.0 37.0 40 36.30085170340681 37.0 37.0 37.0 37.0 37.0 41 36.323971915747244 37.0 37.0 37.0 37.0 37.0 42 36.27825213460572 37.0 37.0 37.0 37.0 37.0 43 36.35782586814293 37.0 37.0 37.0 37.0 37.0 44 36.45131180625631 37.0 37.0 37.0 37.0 37.0 45 36.46899519109086 37.0 37.0 37.0 37.0 37.0 46 36.47605705552726 37.0 37.0 37.0 37.0 37.0 47 36.41083462934163 37.0 37.0 37.0 37.0 37.0 48 36.551031342084116 37.0 37.0 37.0 37.0 37.0 49 36.63748894783377 37.0 37.0 37.0 37.0 37.0 50 36.83387096774194 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 8.0 25 12.0 26 15.0 27 25.0 28 16.0 29 29.0 30 52.0 31 61.0 32 63.0 33 91.0 34 124.0 35 323.0 36 3177.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.975 17.5 11.325000000000001 38.2 2 28.799999999999997 24.075 25.0 22.125 3 23.275000000000002 26.25 23.575 26.900000000000002 4 27.1 28.975 18.9 25.025 5 30.15 30.049999999999997 18.125 21.675 6 25.25 32.550000000000004 18.425 23.775 7 23.875 19.8 30.15 26.174999999999997 8 24.825 21.55 24.55 29.075 9 24.8 21.575 25.95 27.675 10 26.174999999999997 28.999999999999996 20.5 24.325 11 27.725 22.975 18.775 30.525000000000002 12 27.450000000000003 21.775 21.975 28.799999999999997 13 26.150000000000002 23.974999999999998 22.05 27.825 14 27.1 24.45 21.2 27.250000000000004 15 26.474999999999998 25.275 22.8 25.45 16 27.800000000000004 23.724999999999998 21.45 27.025 17 26.575 24.3 21.525 27.6 18 26.875 24.75 22.625 25.75 19 27.3 24.175 22.225 26.3 20 28.349999999999998 23.45 21.3 26.900000000000002 21 26.05 24.275 23.175 26.5 22 25.95 23.674999999999997 23.1 27.275 23 26.724999999999998 24.349999999999998 21.45 27.474999999999998 24 25.724999999999998 25.650000000000002 22.475 26.150000000000002 25 26.025 25.45 21.55 26.974999999999998 26 27.400000000000002 24.224999999999998 21.55 26.825 27 27.05 24.325 22.475 26.150000000000002 28 26.825 23.35 21.725 28.1 29 26.75 25.2 20.974999999999998 27.075 30 26.700000000000003 24.15 23.674999999999997 25.474999999999998 31 27.275 23.05 22.900000000000002 26.775 32 27.175 23.425 20.625 28.775000000000002 33 25.4 25.324999999999996 23.275000000000002 26.0 34 27.474999999999998 23.075000000000003 21.625 27.825 35 27.906976744186046 24.706176544136035 21.605401350337583 25.78144536134033 36 26.988494247123562 24.562281140570285 22.086043021510758 26.3631815907954 37 26.413206603301653 24.862431215607803 22.461230615307652 26.263131565782892 38 29.347010257693267 23.34250688016012 21.866399799849887 25.444083062296723 39 26.282853566958696 25.381727158948685 21.802252816020026 26.533166458072593 40 27.304609218436877 24.223446893787575 21.492985971943888 26.978957915831664 41 27.256770310932797 24.49849548645938 22.291875626880643 25.952858575727184 42 25.816172777498746 24.15871421396283 22.65193370165746 27.373179306880964 43 27.50377453447408 23.829894313034725 20.91092098641168 27.75541016607952 44 28.355196770938445 23.81432896064581 21.291624621594348 26.538849646821394 45 26.347760060744115 24.727916983042267 21.969121741331307 26.955201214882308 46 27.63627101375446 23.000509424350486 21.956189505858383 27.407030056036678 47 29.367547952306893 22.86158631415241 21.643338517366512 26.127527216174183 48 25.957674792392176 22.394856683632465 24.484328957942676 27.16313956603268 49 27.792513999410552 16.651930445033894 24.137931034482758 31.417624521072796 50 28.951612903225804 0.0 31.61290322580645 39.435483870967744 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 5.5 27 6.0 28 6.0 29 12.5 30 17.0 31 16.5 32 22.5 33 35.0 34 44.5 35 53.5 36 68.0 37 87.5 38 108.5 39 139.5 40 171.5 41 191.5 42 203.0 43 222.5 44 245.0 45 255.5 46 271.0 47 294.5 48 311.5 49 325.0 50 326.5 51 294.5 52 259.5 53 251.5 54 255.0 55 253.0 56 250.5 57 242.0 58 222.5 59 197.0 60 185.0 61 174.5 62 161.5 63 170.0 64 174.0 65 167.0 66 155.5 67 131.5 68 117.5 69 119.5 70 118.5 71 104.5 72 94.0 73 93.5 74 88.5 75 76.5 76 66.5 77 56.5 78 49.0 79 37.0 80 22.0 81 19.0 82 18.5 83 14.0 84 7.5 85 4.0 86 2.0 87 1.5 88 1.5 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34 1.0 35 1.0 36 0.0 37 1.0 38 2.0 39 3.0 40 4.0 41 6.0 42 8.0 43 10.0 44 13.0 45 25.0 46 68.0 47 125.0 48 340.0 49 913.0 50 2480.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1766009 spots for SRR9103019.sra Written 1766009 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra Read 1765992 spots for SRR9103019.sra Written 1765992 spots for SRR9103019.sra SRR ids: ['SRR9103019.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_888wlujk SRR9103019.sra spots: 35319857 blocks: [[1, 1765992], [1765993, 3531984], [3531985, 5297976], [5297977, 7063968], [7063969, 8829960], [8829961, 10595952], [10595953, 12361944], [12361945, 14127936], [14127937, 15893928], [15893929, 17659920], [17659921, 19425912], [19425913, 21191904], [21191905, 22957896], [22957897, 24723888], [24723889, 26489880], [26489881, 28255872], [28255873, 30021864], [30021865, 31787856], [31787857, 33553848], [33553849, 35319857]] SRR9103019 file size 4879073 SRR9103019 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR9103019 SRR9103019_1.fastq SRR9103019_2.fastq Input file: SRR9103019_1.fastq Paired file: SRR9103019_2.fastq trimmed: SRR9103019-trimmed-pair1.fastq, SRR9103019-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:11:20 2024 >> started Sat Dec 7 02:11:50 2024 >> done (30.159s) 35319857 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 35319857 (100.00%) read pairs available; of these: 316 ( 0.00%) trimmed read pairs available after processing 35319541 (100.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 33 1 0.00% 34 181 0.00% 35 382 0.00% 36 688 0.00% 37 1244 0.00% 38 2506 0.01% 39 5325 0.02% 40 12083 0.03% 41 25747 0.07% 42 50497 0.14% 43 68466 0.19% 44 108829 0.31% 45 206517 0.58% 46 506152 1.43% 47 1665204 4.71% 48 5813286 16.46% 49 15183852 42.99% 50 11668897 33.04% 35319857 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=9.73 fanout-score-rank=23 prefix-density=0.30 prefix-fanout=3.9 sequence=GGCTTGGGCTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=412.79 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=33.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=126.71 fanout-score-rank=12 prefix-density=0.93 prefix-fanout=18.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=309.28 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=18.7 sequence=CGCCGCCGCCGA SRR9103019 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:12:14 Started mapping on | Dec 07 02:12:14 Finished on | Dec 07 02:13:03 Mapping speed, Million of reads per hour | 2594.93 Number of input reads | 35319857 Average input read length | 98 UNIQUE READS: Uniquely mapped reads number | 34096094 Uniquely mapped reads % | 96.54% Average mapped length | 98.12 Number of splices: Total | 9626793 Number of splices: Annotated (sjdb) | 9209426 Number of splices: GT/AG | 9505904 Number of splices: GC/AG | 109819 Number of splices: AT/AC | 6597 Number of splices: Non-canonical | 4473 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 540939 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 289334 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 682824 682824 682824 N_multimapping 540939 540939 540939 N_noFeature 769511 33269369 1103862 N_ambiguous 537614 3636 45497 UnstrandedReadsAssigned:32788969 PositiveStrandReadsAssigned:823089 NegativeStrandReadsAssigned:32946735 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=48 echo kmer=43 SRR9103019 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR9103019-trimmed-pair1.fastq SRR9103019-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,319,857 reads, 33,403,160 reads pseudoaligned [quant] estimated average fragment length: 169.249 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52973 SRR9103019.ke.tsv 35125 SRR9103019.se.tsv 88098 total ==> SRR9103019.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 767.912 95.3546 5.47727 PNS24247 1044 875.751 72.908 3.67222 PNS24249 1928 1759.75 480.554 12.0455 PNS24246 1044 875.751 72.908 3.67222 PNS24248 1044 875.751 72.908 3.67222 PNS24244 1471 1302.75 44.3676 1.50224 PNS24243 293 135.123 1 0.326442 KQK14069 1603 1434.75 3218.64 98.9532 KQK14071 474 308.069 255.731 36.6158 ==> SRR9103019.se.tsv <== BRADI_1g14170v3 3511 BRADI_1g53295v3 167 BRADI_1g59795v3 218 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 1485 BRADI_1g74790v3 281 BRADI_1g09890v3 0 BRADI_1g77505v3 270 BRADI_1g48960v3 2 SRR9103019 completed mapping pipeline successfully