Starting /dee2/code/volunteer_pipeline.sh SRR921317 current disk space = 1547906871296 free memory = 1600158116 SRR921317 SRAfilesize f71f9f2e7a3b4241ac2abf82cb9c5132 SRR921317.sra SRR921317.sra file validated SRR921317 is single end SRR921317 is conventional basespace SRR921317 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR921317_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.55875 39.0 38.0 39.0 35.0 39.0 2 37.46625 39.0 37.0 39.0 35.0 39.0 3 37.44375 39.0 37.0 39.0 35.0 39.0 4 37.40575 39.0 37.0 39.0 35.0 39.0 5 37.20575 39.0 37.0 39.0 34.0 39.0 6 37.39225 39.0 37.0 39.0 35.0 39.0 7 37.44575 39.0 37.0 39.0 35.0 39.0 8 37.13875 39.0 37.0 39.0 33.0 39.0 9 37.27825 39.0 37.0 39.0 34.0 39.0 10 37.1845 39.0 37.0 39.0 34.0 39.0 11 37.31575 39.0 37.0 39.0 34.0 39.0 12 37.2005 39.0 37.0 39.0 34.0 39.0 13 37.22475 39.0 37.0 39.0 34.0 39.0 14 37.038 39.0 37.0 39.0 33.0 39.0 15 36.9145 39.0 37.0 39.0 33.0 39.0 16 36.922 39.0 37.0 39.0 33.0 39.0 17 36.90775 39.0 37.0 39.0 33.0 39.0 18 36.801 39.0 36.0 39.0 33.0 39.0 19 36.73825 38.0 36.0 39.0 33.0 39.0 20 36.68625 38.0 36.0 39.0 33.0 39.0 21 36.5915 38.0 36.0 39.0 33.0 39.0 22 36.4005 38.0 36.0 39.0 32.0 39.0 23 35.80475 38.0 35.0 39.0 30.0 39.0 24 36.5135 38.0 36.0 39.0 32.0 39.0 25 36.33525 38.0 36.0 39.0 32.0 39.0 26 35.825 38.0 36.0 39.0 31.0 39.0 27 35.8255 38.0 36.0 39.0 30.0 39.0 28 35.6315 38.0 35.0 39.0 30.0 39.0 29 35.68625 38.0 35.0 39.0 30.0 39.0 30 35.659 38.0 35.0 39.0 30.0 39.0 31 35.3545 38.0 35.0 39.0 29.0 39.0 32 35.1535 38.0 35.0 39.0 29.0 39.0 33 34.82575 37.0 35.0 39.0 28.0 39.0 34 34.78775 37.0 35.0 39.0 27.0 39.0 35 34.5175 37.0 34.0 39.0 27.0 39.0 36 34.55075 37.0 35.0 39.0 27.0 39.0 37 34.362 37.0 34.0 39.0 26.0 39.0 38 34.053 37.0 34.0 39.0 26.0 39.0 39 33.747 37.0 34.0 39.0 24.0 39.0 40 33.7125 37.0 34.0 39.0 25.0 39.0 41 33.232 37.0 33.0 39.0 21.0 39.0 42 33.103 37.0 33.0 39.0 21.0 39.0 43 32.6695 37.0 33.0 39.0 19.0 39.0 44 32.6865 37.0 33.0 39.0 17.0 39.0 45 32.21125 36.0 32.0 39.0 8.0 39.0 46 31.87825 36.0 32.0 39.0 4.0 39.0 47 31.7065 36.0 31.0 39.0 4.0 39.0 48 31.62875 36.0 31.0 39.0 4.0 39.0 49 31.45275 36.0 31.0 39.0 4.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 6.0 5 0.0 6 0.0 7 1.0 8 2.0 9 2.0 10 3.0 11 2.0 12 3.0 13 3.0 14 7.0 15 5.0 16 10.0 17 11.0 18 12.0 19 17.0 20 20.0 21 12.0 22 16.0 23 19.0 24 30.0 25 35.0 26 41.0 27 75.0 28 66.0 29 64.0 30 78.0 31 95.0 32 100.0 33 150.0 34 202.0 35 249.0 36 434.0 37 637.0 38 1576.0 39 17.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.324127542053727 19.708762239517952 3.138337936228973 53.828772282199346 2 19.75 21.525 45.625 13.100000000000001 3 15.2 19.35 29.75 35.699999999999996 4 22.900000000000002 31.35 22.425 23.325000000000003 5 22.95 33.25 26.525 17.275 6 18.925 32.824999999999996 29.599999999999998 18.65 7 18.975 17.65 40.9 22.475 8 19.025 22.575 31.6 26.8 9 20.025000000000002 20.9 33.275 25.8 10 23.849999999999998 34.725 22.45 18.975 11 26.55 25.85 21.375 26.224999999999998 12 22.475 24.474999999999998 26.525 26.525 13 22.975 25.374999999999996 27.05 24.6 14 22.6 26.325 26.75 24.325 15 23.175 26.05 24.65 26.125 16 24.224999999999998 25.45 24.224999999999998 26.1 17 25.15 26.05 26.424999999999997 22.375 18 24.55 25.15 26.0 24.3 19 24.9 26.375 24.5 24.224999999999998 20 25.15 25.75 25.525 23.575 21 23.925 25.324999999999996 24.85 25.900000000000002 22 24.425 26.700000000000003 23.9 24.975 23 25.05 26.0 25.924999999999997 23.025000000000002 24 23.75 26.275 24.975 25.0 25 24.525 25.775 24.099999999999998 25.6 26 25.15 25.874999999999996 25.7 23.275000000000002 27 25.3 24.825 24.775 25.1 28 25.0 26.900000000000002 23.5 24.6 29 24.3 27.224999999999998 24.65 23.825 30 24.474999999999998 25.775 25.1 24.65 31 25.100100100100097 25.025025025025027 24.474474474474476 25.400400400400404 32 25.025 25.0 26.5 23.474999999999998 33 24.656164041010253 24.781195298824706 24.781195298824706 25.78144536134033 34 25.0 27.0 23.225 24.775 35 24.252324704699674 25.106810756471475 25.031414928373962 25.609449610454888 36 23.859649122807017 23.909774436090224 25.68922305764411 26.54135338345865 37 25.07530120481928 25.602409638554217 23.84538152610442 25.47690763052209 38 25.352112676056336 26.056338028169012 25.27665995975855 23.314889336016094 39 24.27453949028514 23.845571536714612 25.25864244259399 26.621246530406257 40 25.74880442990184 25.069217216209417 24.46513969292726 24.71683866096149 41 25.303336703741152 25.556117290192116 24.823053589484328 24.317492416582407 42 25.22750252780586 24.3680485338726 25.50556117290192 24.898887765419616 43 23.93900889453621 25.667090216010163 24.34561626429479 26.04828462515883 44 26.106870229007633 25.34351145038168 24.987277353689567 23.56234096692112 45 25.70188871873405 24.400204185809084 24.476773864216437 25.42113323124043 46 24.518255578093306 26.242393509127787 24.239350912778903 25.0 47 24.90527911088659 25.460974993685277 26.446072240464762 23.187673654963376 48 25.484276729559745 24.30188679245283 25.68553459119497 24.528301886792452 49 24.198839263184457 25.914711077466567 24.829674489023468 25.056775170325512 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 2.0 22 3.0 23 5.5 24 8.0 25 8.0 26 12.5 27 17.0 28 25.5 29 34.0 30 43.0 31 52.0 32 73.0 33 94.0 34 129.0 35 164.0 36 175.5 37 187.0 38 219.5 39 252.0 40 273.5 41 295.0 42 306.0 43 317.0 44 318.5 45 320.0 46 327.5 47 335.0 48 319.5 49 304.0 50 291.5 51 279.0 52 258.5 53 238.0 54 215.0 55 192.0 56 173.5 57 155.0 58 161.5 59 168.0 60 154.0 61 140.0 62 119.0 63 98.0 64 94.0 65 90.0 66 79.5 67 69.0 68 68.0 69 67.0 70 49.5 71 32.0 72 34.0 73 36.0 74 30.5 75 25.0 76 25.0 77 19.0 78 13.0 79 9.0 80 5.0 81 4.5 82 4.0 83 4.0 84 4.0 85 2.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.1 32 0.0 33 0.025 34 0.0 35 0.525 36 0.25 37 0.4 38 0.6 39 0.9249999999999999 40 0.675 41 1.0999999999999999 42 1.0999999999999999 43 1.625 44 1.7500000000000002 45 2.0500000000000003 46 1.4000000000000001 47 1.0250000000000001 48 0.625 49 0.9249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629430 spots for SRR921317.sra Written 629430 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra Read 629423 spots for SRR921317.sra Written 629423 spots for SRR921317.sra SRR ids: ['SRR921317.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c1ve1jg0 SRR921317.sra spots: 12588467 blocks: [[1, 629423], [629424, 1258846], [1258847, 1888269], [1888270, 2517692], [2517693, 3147115], [3147116, 3776538], [3776539, 4405961], [4405962, 5035384], [5035385, 5664807], [5664808, 6294230], [6294231, 6923653], [6923654, 7553076], [7553077, 8182499], [8182500, 8811922], [8811923, 9441345], [9441346, 10070768], [10070769, 10700191], [10700192, 11329614], [11329615, 11959037], [11959038, 12588467]] SRR921317 file size 1952017 SRR921317 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR921317 SRR921317_1.fastq Input file: SRR921317_1.fastq trimmed: SRR921317-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:03:57 2024 >> started Sat Dec 7 00:04:04 2024 >> done (6.970s) 12588467 reads processed; of these: 33555 ( 0.27%) short reads filtered out after trimming by size control 15977 ( 0.13%) empty reads filtered out after trimming by size control 12538935 (99.61%) reads available; of these: 1292479 (10.31%) trimmed reads available after processing 11246456 (89.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5596 0.04% 19 11369 0.09% 20 22021 0.18% 21 5335 0.04% 22 8580 0.07% 23 14123 0.11% 24 25579 0.20% 25 45937 0.37% 26 10703 0.09% 27 14264 0.11% 28 22939 0.18% 29 39644 0.32% 30 66683 0.53% 31 14854 0.12% 32 20722 0.17% 33 31058 0.25% 34 55412 0.44% 35 88990 0.71% 36 21094 0.17% 37 29146 0.23% 38 44502 0.35% 39 73322 0.58% 40 123204 0.98% 41 28859 0.23% 42 39721 0.32% 43 60250 0.48% 44 99253 0.79% 45 152602 1.22% 46 27500 0.22% 47 34105 0.27% 48 55112 0.44% 49 11246456 89.69% 12538935 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=13 prefix-density=0.05 prefix-fanout=2.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=63.57 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.5 sequence=CCGCCGCCGCCA Started job on | Dec 07 00:04:18 Started mapping on | Dec 07 00:04:18 Finished on | Dec 07 00:04:35 Mapping speed, Million of reads per hour | 2655.30 Number of input reads | 12538935 Average input read length | 47 UNIQUE READS: Uniquely mapped reads number | 11151581 Uniquely mapped reads % | 88.94% Average mapped length | 47.72 Number of splices: Total | 1550137 Number of splices: Annotated (sjdb) | 1485073 Number of splices: GT/AG | 1529029 Number of splices: GC/AG | 18018 Number of splices: AT/AC | 1167 Number of splices: Non-canonical | 1923 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.01% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 520358 % of reads mapped to multiple loci | 4.15% Number of reads mapped to too many loci | 77716 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.24% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 866996 866996 866996 N_multimapping 520358 520358 520358 N_noFeature 551188 5280242 6243329 N_ambiguous 195466 9166 8139 UnstrandedReadsAssigned:10404927 PositiveStrandReadsAssigned:5862173 NegativeStrandReadsAssigned:4900113 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR921317 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR921317-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,538,935 reads, 10,289,966 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52973 SRR921317.ke.tsv 35125 SRR921317.se.tsv 88098 total ==> SRR921317.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 88.8259 17.2577 PNS24247 1044 945 28.7953 4.95518 PNS24249 1928 1829 43.6654 3.88235 PNS24246 1044 945 28.7953 4.95518 PNS24248 1044 945 28.7953 4.95518 PNS24244 1471 1372 60.1227 7.12615 PNS24243 293 194 1 0.83824 KQK14069 1603 1504 742.882 80.3234 KQK14071 474 375 121.601 52.732 ==> SRR921317.se.tsv <== BRADI_1g14170v3 995 BRADI_1g53295v3 398 BRADI_1g59795v3 246 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 648 BRADI_1g74790v3 174 BRADI_1g09890v3 2 BRADI_1g77505v3 119 BRADI_1g48960v3 0 SRR921317 completed mapping pipeline successfully