Starting /dee2/code/volunteer_pipeline.sh SRR921318 current disk space = 1547787522048 free memory = 1600386796 SRR921318 SRAfilesize 49d0ca5f3075061ef0f7f4e61f7a4dfc SRR921318.sra SRR921318.sra file validated SRR921318 is single end SRR921318 is conventional basespace SRR921318 read1 length is 49 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR921318_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 49 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.21525 33.0 31.0 34.0 30.0 34.0 2 31.8865 34.0 31.0 34.0 30.0 34.0 3 32.4245 34.0 31.0 34.0 30.0 34.0 4 36.043 37.0 35.0 37.0 35.0 37.0 5 35.9585 37.0 35.0 37.0 35.0 37.0 6 35.93975 37.0 35.0 37.0 35.0 37.0 7 35.87225 37.0 35.0 37.0 35.0 37.0 8 35.91725 37.0 35.0 37.0 35.0 37.0 9 37.731 39.0 37.0 39.0 35.0 39.0 10 37.604 39.0 37.0 39.0 35.0 39.0 11 37.467 39.0 37.0 39.0 34.0 39.0 12 37.616 39.0 37.0 39.0 35.0 39.0 13 37.437 39.0 37.0 39.0 35.0 39.0 14 38.24125 40.0 38.0 40.0 34.0 40.0 15 38.304 40.0 38.0 40.0 34.0 40.0 16 38.05575 40.0 38.0 40.0 34.0 40.0 17 38.25825 40.0 38.0 40.0 34.0 40.0 18 38.06025 40.0 38.0 40.0 33.0 40.0 19 37.939 40.0 38.0 40.0 33.0 40.0 20 37.9345 40.0 38.0 40.0 34.0 40.0 21 37.897 40.0 38.0 40.0 34.0 40.0 22 37.722 40.0 38.0 40.0 33.0 40.0 23 37.7885 40.0 38.0 40.0 33.0 40.0 24 37.73525 40.0 38.0 40.0 33.0 40.0 25 37.805 40.0 38.0 40.0 33.0 40.0 26 37.73525 40.0 38.0 40.0 33.0 40.0 27 37.54925 40.0 38.0 40.0 33.0 40.0 28 37.306 40.0 37.0 40.0 32.0 40.0 29 37.3045 40.0 37.0 40.0 32.0 40.0 30 36.98825 40.0 37.0 40.0 31.0 40.0 31 37.072 40.0 37.0 40.0 31.0 40.0 32 36.95875 40.0 37.0 40.0 31.0 40.0 33 36.79425 40.0 37.0 40.0 31.0 40.0 34 36.5595 40.0 36.0 40.0 30.0 40.0 35 36.51525 40.0 36.0 40.0 30.0 40.0 36 36.1525 40.0 36.0 40.0 29.0 40.0 37 36.0105 40.0 36.0 40.0 29.0 40.0 38 35.82175 39.0 35.0 40.0 29.0 40.0 39 35.7095 39.0 35.0 40.0 27.0 40.0 40 35.596 39.0 35.0 40.0 27.0 40.0 41 35.46425 39.0 35.0 40.0 27.0 40.0 42 35.05125 39.0 35.0 40.0 25.0 40.0 43 34.923 39.0 34.0 40.0 24.0 40.0 44 34.7545 39.0 34.0 40.0 24.0 40.0 45 34.47275 38.0 34.0 40.0 24.0 40.0 46 34.19025 38.0 33.0 40.0 23.0 40.0 47 33.9265 38.0 33.0 40.0 22.0 40.0 48 33.6655 38.0 33.0 40.0 19.0 40.0 49 32.9825 38.0 32.0 40.0 4.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 1.0 15 5.0 16 7.0 17 4.0 18 5.0 19 12.0 20 14.0 21 7.0 22 19.0 23 18.0 24 24.0 25 32.0 26 30.0 27 42.0 28 40.0 29 65.0 30 76.0 31 104.0 32 104.0 33 146.0 34 163.0 35 245.0 36 334.0 37 528.0 38 1108.0 39 865.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.767466110531807 14.885297184567259 6.230448383733055 57.11678832116789 2 22.1 16.45 42.875 18.575 3 16.275000000000002 16.975 30.45 36.3 4 23.775 24.6 25.0 26.625 5 25.900000000000002 25.15 28.249999999999996 20.7 6 21.025 29.175 28.475 21.325 7 20.849999999999998 17.8 37.724999999999994 23.625 8 17.4 21.425 33.45 27.725 9 19.650000000000002 20.200000000000003 34.425 25.724999999999998 10 23.575 30.275000000000002 23.45 22.7 11 26.724999999999998 23.825 21.95 27.500000000000004 12 24.175 20.275000000000002 28.299999999999997 27.250000000000004 13 23.65 23.95 25.7 26.700000000000003 14 23.95 24.3 25.45 26.3 15 23.724999999999998 24.275 25.525 26.474999999999998 16 24.95 24.2 24.325 26.525 17 24.025 25.45 25.525 25.0 18 24.725 24.325 24.55 26.400000000000002 19 25.525 23.549999999999997 24.65 26.275 20 24.175 24.05 26.875 24.9 21 24.875 23.5 26.125 25.5 22 25.074999999999996 25.4 22.225 27.3 23 26.325 23.799999999999997 24.625 25.25 24 23.625 25.95 25.074999999999996 25.35 25 25.374999999999996 25.25 23.724999999999998 25.650000000000002 26 25.8 25.95 23.0 25.25 27 24.65 24.6 24.6 26.150000000000002 28 27.238619309654826 24.637318659329665 22.11105552776388 26.013006503251624 29 24.925 25.2 24.825 25.05 30 25.624999999999996 24.5 25.85 24.025 31 25.5 23.95 23.325000000000003 27.224999999999998 32 26.60665166291573 23.830957739434858 23.63090772693173 25.93148287071768 33 24.337168584292147 25.912956478239117 24.462231115557778 25.287643821910955 34 26.424999999999997 23.474999999999998 23.474999999999998 26.625 35 25.374999999999996 24.85 24.25 25.525 36 25.081270317579396 23.85596399099775 25.131282820705174 25.93148287071768 37 27.056764191047762 23.53088272068017 22.655663915978995 26.756689172293076 38 25.937968984492244 24.437218609304654 24.7623811905953 24.862431215607803 39 24.125 24.075 26.474999999999998 25.324999999999996 40 26.6 23.974999999999998 22.075 27.35 41 25.174999999999997 25.650000000000002 24.275 24.9 42 24.349999999999998 24.45 24.725 26.474999999999998 43 26.224999999999998 24.25 21.975 27.55 44 25.424999999999997 23.75 24.575 26.25 45 25.55 23.724999999999998 25.15 25.575 46 25.650000000000002 23.5 22.7 28.15 47 25.900000000000002 25.174999999999997 23.849999999999998 25.074999999999996 48 26.424999999999997 23.775 23.974999999999998 25.825 49 26.875 22.7 23.625 26.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 5.0 22 7.0 23 8.0 24 9.0 25 9.0 26 13.0 27 17.0 28 18.0 29 19.0 30 32.0 31 45.0 32 60.0 33 75.0 34 96.5 35 118.0 36 132.5 37 147.0 38 180.0 39 213.0 40 233.0 41 253.0 42 252.5 43 252.0 44 271.5 45 291.0 46 291.5 47 292.0 48 289.0 49 286.0 50 284.5 51 283.0 52 270.0 53 257.0 54 235.5 55 214.0 56 209.5 57 205.0 58 189.5 59 174.0 60 163.0 61 152.0 62 152.5 63 153.0 64 135.5 65 118.0 66 105.5 67 93.0 68 87.0 69 81.0 70 77.0 71 73.0 72 64.5 73 56.0 74 46.5 75 37.0 76 37.0 77 40.5 78 44.0 79 29.0 80 14.0 81 10.0 82 6.0 83 5.0 84 4.0 85 5.5 86 7.0 87 4.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.1000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.05 29 0.0 30 0.0 31 0.0 32 0.025 33 0.05 34 0.0 35 0.0 36 0.025 37 0.025 38 0.05 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 49 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4438775510204 96.475 2 1.2755102040816326 2.5 3 0.12755102040816327 0.375 4 0.10204081632653061 0.4 5 0.05102040816326531 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAAGCTCTCGTTGACATTTCCTTGAGAAGAAGAAGAAACAACTCCGGC 5 0.125 No Hit CTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625114 spots for SRR921318.sra Written 625114 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra Read 625106 spots for SRR921318.sra Written 625106 spots for SRR921318.sra SRR ids: ['SRR921318.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hzq82507 SRR921318.sra spots: 12502128 blocks: [[1, 625106], [625107, 1250212], [1250213, 1875318], [1875319, 2500424], [2500425, 3125530], [3125531, 3750636], [3750637, 4375742], [4375743, 5000848], [5000849, 5625954], [5625955, 6251060], [6251061, 6876166], [6876167, 7501272], [7501273, 8126378], [8126379, 8751484], [8751485, 9376590], [9376591, 10001696], [10001697, 10626802], [10626803, 11251908], [11251909, 11877014], [11877015, 12502128]] SRR921318 file size 1979733 SRR921318 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR921318 SRR921318_1.fastq Input file: SRR921318_1.fastq trimmed: SRR921318-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:06:04 2024 >> started Sat Dec 7 00:06:10 2024 >> done (6.514s) 12502128 reads processed; of these: 7817 ( 0.06%) short reads filtered out after trimming by size control 19108 ( 0.15%) empty reads filtered out after trimming by size control 12475203 (99.78%) reads available; of these: 1402745 (11.24%) trimmed reads available after processing 11072458 (88.76%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2201 0.02% 19 3183 0.03% 20 4112 0.03% 21 5726 0.05% 22 7582 0.06% 23 9961 0.08% 24 12163 0.10% 25 16804 0.13% 26 18384 0.15% 27 19346 0.16% 28 22120 0.18% 29 23451 0.19% 30 25421 0.20% 31 27492 0.22% 32 29479 0.24% 33 33620 0.27% 34 37311 0.30% 35 39966 0.32% 36 41152 0.33% 37 44296 0.36% 38 48159 0.39% 39 52489 0.42% 40 57722 0.46% 41 63325 0.51% 42 68431 0.55% 43 78210 0.63% 44 87515 0.70% 45 99907 0.80% 46 119487 0.96% 47 137816 1.10% 48 165914 1.33% 49 11072458 88.76% 12475203 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=6.60 fanout-score-rank=15 prefix-density=1.05 prefix-fanout=2.5 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTCCACATGGGCGGTGGCAGCGACCACAAGGACGAGCACAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=82.74 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.9 sequence=CTGCTGCTGTGGCCGTCTTCCTTCTTGTGGCCCTCGCCGTGCTTCTTC Started job on | Dec 07 00:06:23 Started mapping on | Dec 07 00:06:23 Finished on | Dec 07 00:06:36 Mapping speed, Million of reads per hour | 3454.67 Number of input reads | 12475203 Average input read length | 48 UNIQUE READS: Uniquely mapped reads number | 11240338 Uniquely mapped reads % | 90.10% Average mapped length | 47.87 Number of splices: Total | 1457741 Number of splices: Annotated (sjdb) | 1396642 Number of splices: GT/AG | 1437612 Number of splices: GC/AG | 17049 Number of splices: AT/AC | 818 Number of splices: Non-canonical | 2262 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.01% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 980260 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 156468 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 254605 254605 254605 N_multimapping 980260 980260 980260 N_noFeature 462869 5612389 5919239 N_ambiguous 189323 11291 10025 UnstrandedReadsAssigned:10588146 PositiveStrandReadsAssigned:5616658 NegativeStrandReadsAssigned:5311074 Dataset is classified unstranded MeadianReadLen=49 20thPercentileLength=49 echo kmer=45 SRR921318 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR921318-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,475,203 reads, 10,706,578 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR921318.ke.tsv 35125 SRR921318.se.tsv 88098 total ==> SRR921318.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 5.36905 0.928532 PNS24247 1044 945 18.923 2.89857 PNS24249 1928 1829 11.5929 0.917497 PNS24246 1044 945 18.923 2.89857 PNS24248 1044 945 18.923 2.89857 PNS24244 1471 1372 8.26897 0.872414 PNS24243 293 194 2 1.49229 KQK14069 1603 1504 254.689 24.5125 KQK14071 474 375 90.7165 35.0171 ==> SRR921318.se.tsv <== BRADI_1g14170v3 448 BRADI_1g53295v3 21 BRADI_1g59795v3 42 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 267 BRADI_1g74790v3 154 BRADI_1g09890v3 5 BRADI_1g77505v3 53 BRADI_1g48960v3 0 SRR921318 completed mapping pipeline successfully