Starting /dee2/code/volunteer_pipeline.sh SRR921327 current disk space = 1547786293248 free memory = 1599995800 SRR921327 SRAfilesize cb4d6b8be6d63b3dae3a19fc051254e4 SRR921327.sra SRR921327.sra file validated SRR921327 is single end SRR921327 is conventional basespace SRR921327 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR921327_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.5385 39.0 38.0 40.0 2.0 40.0 2 35.33875 39.0 38.0 40.0 17.0 40.0 3 35.4315 39.0 38.0 40.0 17.0 40.0 4 35.37125 39.0 38.0 40.0 16.0 40.0 5 35.308 39.0 38.0 40.0 15.0 40.0 6 35.944 39.0 38.0 40.0 22.0 40.0 7 35.889 39.0 38.0 40.0 22.0 40.0 8 35.76825 39.0 37.0 40.0 21.0 40.0 9 35.7725 39.0 37.0 40.0 21.0 40.0 10 35.72225 39.0 37.0 40.0 21.0 40.0 11 36.7275 39.0 36.0 40.0 31.0 40.0 12 36.69275 39.0 36.0 40.0 31.0 40.0 13 36.67775 39.0 36.0 40.0 31.0 40.0 14 36.75325 39.0 36.0 40.0 31.0 40.0 15 36.746 39.0 36.0 40.0 31.0 40.0 16 36.74275 39.0 36.0 40.0 31.0 40.0 17 36.747 39.0 36.0 40.0 31.0 40.0 18 36.58875 39.0 36.0 40.0 31.0 40.0 19 36.49425 39.0 36.0 40.0 31.0 40.0 20 36.31925 39.0 35.0 40.0 31.0 40.0 21 36.3915 39.0 35.0 40.0 31.0 40.0 22 36.22525 39.0 35.0 40.0 31.0 40.0 23 36.084 39.0 35.0 40.0 31.0 40.0 24 35.93975 39.0 35.0 40.0 31.0 40.0 25 35.8115 39.0 35.0 40.0 31.0 40.0 26 35.21125 38.0 34.0 40.0 29.0 40.0 27 35.1805 38.0 34.0 40.0 29.0 40.0 28 35.16775 38.0 34.0 40.0 29.0 40.0 29 35.0575 38.0 34.0 40.0 28.0 40.0 30 34.79225 38.0 33.0 40.0 28.0 40.0 31 34.668 38.0 34.0 40.0 27.0 40.0 32 34.48775 38.0 33.0 40.0 26.0 40.0 33 34.357 38.0 33.0 40.0 27.0 40.0 34 34.08525 38.0 33.0 39.0 25.0 40.0 35 34.05175 38.0 33.0 40.0 25.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 54.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 6.0 12 5.0 13 2.0 14 2.0 15 5.0 16 6.0 17 9.0 18 3.0 19 18.0 20 26.0 21 15.0 22 37.0 23 38.0 24 48.0 25 75.0 26 102.0 27 107.0 28 51.0 29 24.0 30 40.0 31 53.0 32 62.0 33 76.0 34 100.0 35 152.0 36 228.0 37 378.0 38 601.0 39 1659.0 40 13.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 23.85758340342024 25.34342584805158 24.586487244182788 26.212503504345385 2 24.9 28.050000000000004 21.275 25.775 3 21.725 19.25 23.724999999999998 35.3 4 24.675 23.9 31.125000000000004 20.3 5 20.45 25.775 21.7 32.074999999999996 6 23.65 30.4 23.200000000000003 22.75 7 23.45 33.475 18.475 24.6 8 23.65 36.075 19.15 21.125 9 26.200000000000003 30.9 22.425 20.474999999999998 10 37.175000000000004 24.95 18.375 19.5 11 28.799999999999997 30.599999999999998 19.5 21.099999999999998 12 32.6 30.099999999999998 18.875 18.425 13 39.0 23.625 18.0 19.375 14 25.2 34.9 19.425 20.474999999999998 15 27.650000000000002 31.025000000000002 21.125 20.200000000000003 16 23.625 31.45 22.775000000000002 22.15 17 31.5 24.675 23.225 20.599999999999998 18 33.775 22.95 20.1 23.175 19 31.374999999999996 23.474999999999998 19.7 25.45 20 23.65 27.925 26.025 22.400000000000002 21 26.025 21.675 31.324999999999996 20.974999999999998 22 31.8 24.6 20.225 23.375 23 25.624999999999996 23.05 19.950000000000003 31.374999999999996 24 31.775 23.674999999999997 25.35 19.2 25 36.475 23.45 19.025 21.05 26 30.9 22.225 27.525 19.35 27 31.374999999999996 24.2 21.075 23.35 28 30.875000000000004 22.425 24.099999999999998 22.6 29 23.3 32.025 17.8 26.875 30 24.525 28.625 25.724999999999998 21.125 31 29.45 32.225 19.375 18.95 32 30.049999999999997 21.8 19.525000000000002 28.625 33 25.3 26.275 22.05 26.375 34 25.7 22.5 31.15 20.65 35 28.775000000000002 31.724999999999998 20.025000000000002 19.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 4.0 2 6.0 3 6.0 4 4.0 5 2.0 6 2.0 7 1.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.5 14 2.0 15 2.0 16 2.0 17 2.0 18 2.0 19 6.0 20 10.0 21 11.5 22 13.0 23 13.0 24 18.5 25 24.0 26 24.0 27 28.5 28 33.0 29 33.0 30 54.0 31 75.0 32 75.0 33 90.5 34 106.0 35 106.0 36 133.5 37 161.0 38 161.0 39 201.5 40 242.0 41 295.5 42 349.0 43 349.0 44 412.5 45 476.0 46 476.0 47 469.5 48 463.0 49 463.0 50 462.5 51 462.0 52 462.0 53 440.0 54 418.0 55 418.0 56 353.5 57 289.0 58 289.0 59 259.5 60 230.0 61 199.5 62 169.0 63 169.0 64 151.0 65 133.0 66 133.0 67 120.5 68 108.0 69 108.0 70 102.0 71 96.0 72 96.0 73 78.0 74 60.0 75 60.0 76 44.5 77 29.0 78 29.0 79 25.5 80 22.0 81 15.5 82 9.0 83 9.0 84 6.5 85 4.0 86 4.0 87 3.0 88 2.0 89 2.0 90 1.5 91 1.0 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 95.99220706930141 86.225 2 1.4750904536598943 2.65 3 0.8627887559142778 2.325 4 0.528806011689396 1.9 5 0.3896465349290287 1.7500000000000002 6 0.30615084887280825 1.6500000000000001 7 0.16699137211244086 1.05 8 0.08349568605622043 0.6 9 0.055663790704146954 0.44999999999999996 >10 0.13915947676036738 1.4000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 13 0.325 No Hit ATGTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 12 0.3 No Hit GGGGCGACCCCAGGTCAGGCGGGACTACCCGCTGA 11 0.27499999999999997 No Hit CCGTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 10 0.25 No Hit ATCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 10 0.25 No Hit AAATCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 9 0.22499999999999998 No Hit ATTTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 9 0.22499999999999998 No Hit AAGTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 8 0.2 No Hit TGCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 8 0.2 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACG 8 0.2 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) CTCTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 7 0.17500000000000002 No Hit GCCTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 7 0.17500000000000002 No Hit TATTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 7 0.17500000000000002 No Hit CTATCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 7 0.17500000000000002 No Hit CGCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 7 0.17500000000000002 No Hit CAGTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 7 0.17500000000000002 No Hit CATTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit AACTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 6 0.15 No Hit TAATCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit GGATCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit CACTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 6 0.15 No Hit TTTTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit CCCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit GAATCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit CCAGATCGGAAGAGCACACGTCTGAACTCCAGTCA 6 0.15 Illumina Multiplexing PCR Primer 2.01 (100% over 33bp) TCTTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit NACTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 6 0.15 No Hit AATTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit TTATCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit CCTTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit CCATCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit ACTTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit NGCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit AGCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit CTGTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit TACTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit GCAGATCGGAAGAGCACACGTCTGAACTCCAGTCA 5 0.125 Illumina Multiplexing PCR Primer 2.01 (100% over 33bp) CTTTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit AGATCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit ACTTCTCATGGAGAGTTCGATCCTGGCTCAGGATG 5 0.125 No Hit CCGTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.2 0.0 0.0 0.0 0.0 2 0.375 0.0 0.0 0.0 0.0 3 0.775 0.0 0.0 0.0 0.0 4 0.875 0.0 0.0 0.0 0.0 5 0.875 0.0 0.0 0.0 0.0 6 0.875 0.0 0.0 0.0 0.0 7 0.875 0.0 0.0 0.0 0.0 8 0.95 0.0 0.0 0.0 0.0 9 0.95 0.0 0.0 0.0 0.0 10 0.95 0.0 0.0 0.0 0.0 11 0.975 0.0 0.0 0.0 0.0 12 1.0 0.0 0.0 0.0 0.0 13 1.05 0.0 0.0 0.0 0.0 14 1.075 0.0 0.0 0.0 0.0 15 1.175 0.0 0.0 0.0 0.0 16 1.275 0.0 0.0 0.0 0.0 17 1.275 0.0 0.0 0.0 0.0 18 1.3 0.0 0.0 0.0 0.0 19 1.3 0.0 0.0 0.0 0.0 20 1.325 0.0 0.0 0.0 0.0 21 1.325 0.0 0.0 0.0 0.0 22 1.35 0.0 0.0 0.0 0.0 23 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502215 spots for SRR921327.sra Written 502215 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra Read 502196 spots for SRR921327.sra Written 502196 spots for SRR921327.sra SRR ids: ['SRR921327.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r7m9txm7 SRR921327.sra spots: 10043939 blocks: [[1, 502196], [502197, 1004392], [1004393, 1506588], [1506589, 2008784], [2008785, 2510980], [2510981, 3013176], [3013177, 3515372], [3515373, 4017568], [4017569, 4519764], [4519765, 5021960], [5021961, 5524156], [5524157, 6026352], [6026353, 6528548], [6528549, 7030744], [7030745, 7532940], [7532941, 8035136], [8035137, 8537332], [8537333, 9039528], [9039529, 9541724], [9541725, 10043939]] SRR921327 file size 1462116 SRR921327 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR921327 SRR921327_1.fastq Input file: SRR921327_1.fastq trimmed: SRR921327-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:07:19 2024 >> started Sat Dec 7 00:07:26 2024 >> done (6.396s) 10043939 reads processed; of these: 104753 ( 1.04%) short reads filtered out after trimming by size control 35185 ( 0.35%) empty reads filtered out after trimming by size control 9904001 (98.61%) reads available; of these: 434118 ( 4.38%) trimmed reads available after processing 9469883 (95.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7402 0.07% 19 13794 0.14% 20 29613 0.30% 21 6950 0.07% 22 12613 0.13% 23 17208 0.17% 24 32262 0.33% 25 76660 0.77% 26 11639 0.12% 27 17616 0.18% 28 28776 0.29% 29 41704 0.42% 30 81683 0.82% 31 9988 0.10% 32 11165 0.11% 33 16121 0.16% 34 18924 0.19% 35 9469883 95.62% 9904001 reads passed initial QC criterion=sequence-density sequence-density=7.51 sequence-density-rank=1 fanout-score=45.45 fanout-score-rank=2 prefix-density=7.38 prefix-fanout=45.4 sequence=TCAAAAGAGGAAAGGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGGA criterion=fanout-score sequence-density=0.72 sequence-density-rank=5 fanout-score=47.67 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=47.7 sequence=CATACAATGGAGAGTTTGATCCTGGCTC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x TCAAAAGAGGAAAGGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTTCGGGGA -o SRR921327 - Input file: STDIN trimmed: SRR921327-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): TCAAAAGAGGAAAGGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 00:07:40 2024 >> started Sat Dec 7 00:07:49 2024 >> done (8.942s) 7428001 reads processed; of these: 548585 ( 7.39%) short reads filtered out after trimming by size control 1403 ( 0.02%) empty reads filtered out after trimming by size control 6878013 (92.60%) reads available; of these: 130924 ( 1.90%) trimmed reads available after processing 6747089 (98.10%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5566 0.08% 19 9802 0.14% 20 20713 0.30% 21 5197 0.08% 22 9356 0.14% 23 11983 0.17% 24 22938 0.33% 25 52283 0.76% 26 8675 0.13% 27 12769 0.19% 28 18310 0.27% 29 29986 0.44% 30 61737 0.90% 31 36497 0.53% 32 97553 1.42% 33 8895 0.13% 34 13451 0.20% 35 6452302 93.81% criterion=sequence-density sequence-density=5.02 sequence-density-rank=1 fanout-score=40.06 fanout-score-rank=3 prefix-density=4.94 prefix-fanout=40.1 sequence=TCTCATGGAGAGTTCGATCCTGGCTCAGGATGAACGCT criterion=fanout-score sequence-density=0.79 sequence-density-rank=4 fanout-score=47.71 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=47.7 sequence=CATACAATGGAGAGTTTGATCCTGGCTC Started job on | Dec 07 00:08:06 Started mapping on | Dec 07 00:08:06 Finished on | Dec 07 00:08:19 Mapping speed, Million of reads per hour | 2590.34 Number of input reads | 9354013 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 6729004 Uniquely mapped reads % | 71.94% Average mapped length | 31.98 Number of splices: Total | 612266 Number of splices: Annotated (sjdb) | 594687 Number of splices: GT/AG | 603648 Number of splices: GC/AG | 7188 Number of splices: AT/AC | 305 Number of splices: Non-canonical | 1125 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1435308 % of reads mapped to multiple loci | 15.34% Number of reads mapped to too many loci | 527104 % of reads mapped to too many loci | 5.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.07% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1189701 1189701 1189701 N_multimapping 1435308 1435308 1435308 N_noFeature 332128 441881 6494296 N_ambiguous 132582 7558 1050 UnstrandedReadsAssigned:6264294 PositiveStrandReadsAssigned:6279565 NegativeStrandReadsAssigned:233658 Dataset is classified positive stranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR921327 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR921327-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,354,013 reads, 5,688,626 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR921327.ke.tsv 35125 SRR921327.se.tsv 88098 total ==> SRR921327.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 28.2437 8.0542 PNS24247 1044 945 4.5166 1.14079 PNS24249 1928 1829 20.6272 2.69187 PNS24246 1044 945 4.5166 1.14079 PNS24248 1044 945 4.5166 1.14079 PNS24244 1471 1372 36.5793 6.36368 PNS24243 293 194 0 0 KQK14069 1603 1504 11379.7 1805.97 KQK14071 474 375 17825.4 11345.8 ==> SRR921327.se.tsv <== BRADI_1g14170v3 33911 BRADI_1g53295v3 17 BRADI_1g59795v3 40 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 153 BRADI_1g74790v3 55 BRADI_1g09890v3 5 BRADI_1g77505v3 40 BRADI_1g48960v3 2 SRR921327 completed mapping pipeline successfully