Starting /dee2/code/volunteer_pipeline.sh SRR921328 current disk space = 1547833446400 free memory = 1600475172 SRR921328 SRAfilesize d1f0086d2f17ca3e4e84edf602a60623 SRR921328.sra SRR921328.sra file validated SRR921328 is single end SRR921328 is conventional basespace SRR921328 read1 length is 35 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR921328_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.942 38.0 33.0 40.0 2.0 40.0 2 32.93825 38.0 33.0 40.0 11.0 40.0 3 33.02275 39.0 33.0 40.0 11.0 40.0 4 32.956 38.0 33.0 40.0 11.0 40.0 5 32.871 38.0 33.0 40.0 10.0 40.0 6 33.55925 39.0 33.0 40.0 17.0 40.0 7 33.5185 38.0 33.0 40.0 16.0 40.0 8 33.4835 38.0 33.0 40.0 16.0 40.0 9 33.4285 38.0 33.0 40.0 17.0 40.0 10 33.31175 38.0 33.0 40.0 16.0 40.0 11 35.016 38.0 34.0 40.0 27.0 40.0 12 34.80425 38.0 33.0 40.0 27.0 40.0 13 34.73025 38.0 33.0 40.0 27.0 40.0 14 34.931 38.0 33.0 40.0 28.0 40.0 15 34.86025 38.0 33.0 40.0 28.0 40.0 16 34.62275 38.0 33.0 40.0 27.0 40.0 17 34.5935 38.0 33.0 40.0 27.0 40.0 18 34.5565 38.0 33.0 40.0 27.0 40.0 19 34.40325 38.0 33.0 40.0 27.0 40.0 20 34.1205 38.0 32.0 39.0 25.0 40.0 21 33.8745 38.0 32.0 39.0 25.0 40.0 22 33.81725 38.0 31.0 39.0 25.0 40.0 23 33.584 38.0 31.0 39.0 24.0 40.0 24 33.4805 38.0 31.0 39.0 23.0 40.0 25 33.292 38.0 31.0 39.0 23.0 40.0 26 32.844 37.0 31.0 39.0 20.0 40.0 27 32.798 37.0 31.0 39.0 20.0 40.0 28 32.58 37.0 31.0 39.0 18.0 40.0 29 32.32275 36.0 31.0 39.0 17.0 40.0 30 31.822 36.0 31.0 39.0 2.0 40.0 31 31.589 36.0 31.0 39.0 2.0 40.0 32 31.336 36.0 31.0 39.0 2.0 40.0 33 31.13525 36.0 31.0 39.0 2.0 40.0 34 30.99675 35.0 30.0 39.0 2.0 40.0 35 30.99425 35.0 31.0 39.0 2.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 133.0 3 1.0 4 0.0 5 2.0 6 2.0 7 0.0 8 5.0 9 8.0 10 3.0 11 6.0 12 14.0 13 7.0 14 11.0 15 9.0 16 9.0 17 19.0 18 19.0 19 29.0 20 35.0 21 45.0 22 50.0 23 65.0 24 83.0 25 123.0 26 118.0 27 110.0 28 53.0 29 54.0 30 65.0 31 70.0 32 94.0 33 103.0 34 146.0 35 204.0 36 268.0 37 448.0 38 551.0 39 1037.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 24.526066350710902 27.902843601895732 24.37796208530806 23.19312796208531 2 26.825 27.925 19.875 25.374999999999996 3 22.425 20.825 20.849999999999998 35.9 4 24.45 25.924999999999997 27.05 22.575 5 21.45 26.05 23.35 29.15 6 26.150000000000002 26.200000000000003 23.45 24.2 7 24.375 28.225 23.275000000000002 24.125 8 25.4 33.074999999999996 21.6 19.925 9 27.474999999999998 28.975 20.325 23.225 10 32.074999999999996 27.750000000000004 18.8 21.375 11 27.325 29.2 21.2 22.275 12 31.05 27.3 22.175 19.475 13 33.6 26.200000000000003 20.175 20.025000000000002 14 25.6 30.15 20.724999999999998 23.525 15 26.650000000000002 28.749999999999996 21.725 22.875 16 25.05 29.325000000000003 22.025 23.599999999999998 17 29.225 25.674999999999997 22.525000000000002 22.575 18 32.45 23.599999999999998 20.150000000000002 23.799999999999997 19 28.9 23.025000000000002 20.974999999999998 27.1 20 25.825 26.224999999999998 25.25 22.7 21 27.250000000000004 23.425 27.625 21.7 22 30.4 24.725 20.95 23.925 23 26.25 25.05 22.25 26.450000000000003 24 31.924999999999997 24.6 22.5 20.974999999999998 25 31.7 26.724999999999998 20.5 21.075 26 27.6 24.525 25.6 22.275 27 27.975 26.05 21.075 24.9 28 29.25 22.900000000000002 24.325 23.525 29 25.8 28.875 18.775 26.55 30 25.025 27.625 25.874999999999996 21.475 31 27.125 28.475 20.125 24.275 32 28.425 23.200000000000003 22.175 26.200000000000003 33 25.650000000000002 24.975 23.825 25.55 34 23.425 24.25 28.775000000000002 23.549999999999997 35 27.35 28.875 22.925 20.849999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 2.5 20 5.0 21 4.0 22 3.0 23 3.0 24 15.5 25 28.0 26 28.0 27 35.0 28 42.0 29 42.0 30 57.5 31 73.0 32 73.0 33 97.0 34 121.0 35 121.0 36 160.5 37 200.0 38 200.0 39 225.5 40 251.0 41 296.5 42 342.0 43 342.0 44 361.0 45 380.0 46 380.0 47 402.5 48 425.0 49 425.0 50 449.0 51 473.0 52 473.0 53 470.0 54 467.0 55 467.0 56 405.0 57 343.0 58 343.0 59 300.5 60 258.0 61 218.5 62 179.0 63 179.0 64 158.0 65 137.0 66 137.0 67 112.0 68 87.0 69 87.0 70 84.5 71 82.0 72 82.0 73 68.5 74 55.0 75 55.0 76 40.0 77 25.0 78 25.0 79 17.5 80 10.0 81 8.5 82 7.0 83 7.0 84 4.5 85 2.0 86 2.0 87 1.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 35 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.1321361565264 90.60000000000001 2 1.5009380863039399 2.8000000000000003 3 0.6164567140176896 1.725 4 0.32162958992227286 1.2 5 0.08040739748056822 0.375 6 0.08040739748056822 0.44999999999999996 7 0.08040739748056822 0.525 8 0.02680246582685607 0.2 9 0.02680246582685607 0.22499999999999998 >10 0.13401232913428035 1.9 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACG 23 0.575 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) CCAGATCGGAAGAGCACACGTCTGAACTCCAGTCA 16 0.4 Illumina Multiplexing PCR Primer 2.01 (100% over 33bp) GCAGATCGGAAGAGCACACGTCTGAACTCCAGTCA 14 0.35000000000000003 Illumina Multiplexing PCR Primer 2.01 (100% over 33bp) CAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 13 0.325 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) ATGTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 10 0.25 No Hit TTTTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 9 0.22499999999999998 No Hit GAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 8 0.2 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) NCAGATCGGAAGAGCACACGTCTGAACTCCAGTCA 7 0.17500000000000002 Illumina Multiplexing PCR Primer 2.01 (100% over 33bp) AAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 7 0.17500000000000002 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) TTCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 7 0.17500000000000002 No Hit NAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 6 0.15 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) GGCAGATCGGAAGAGCACACGTCTGAACTCCAGTC 6 0.15 Illumina Multiplexing PCR Primer 2.01 (100% over 32bp) TAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC 6 0.15 Illumina Multiplexing PCR Primer 2.01 (100% over 34bp) CACTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit CTCTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit AATTCAAAAGAGGAAAGGCTTGCGGTGGATACCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.575 0.0 0.0 0.0 0.0 2 1.625 0.0 0.0 0.0 0.0 3 3.025 0.0 0.0 0.0 0.0 4 3.625 0.0 0.0 0.0 0.0 5 4.05 0.0 0.0 0.0 0.0 6 4.2 0.0 0.0 0.0 0.0 7 4.3 0.0 0.0 0.0 0.0 8 4.55 0.0 0.0 0.0 0.0 9 4.575 0.0 0.0 0.0 0.0 10 4.625 0.0 0.0 0.0 0.0 11 4.75 0.0 0.0 0.0 0.0 12 5.275 0.0 0.0 0.0 0.0 13 5.6 0.0 0.0 0.0 0.0 14 5.8 0.0 0.0 0.0 0.0 15 6.775 0.0 0.0 0.0 0.0 16 7.05 0.0 0.0 0.0 0.0 17 7.2 0.0 0.0 0.0 0.0 18 7.275 0.0 0.0 0.0 0.0 19 7.3 0.0 0.0 0.0 0.0 20 7.3 0.0 0.0 0.0 0.0 21 7.3 0.0 0.0 0.0 0.0 22 7.3 0.0 0.0 0.0 0.0 23 7.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATACCT 20 0.005538505 28.8375 28 GGATACC 20 0.005538505 28.8375 27 TCAAAAG 20 0.005538505 28.8375 4 AGGCTTG 20 0.005538505 28.8375 16 CGGTGGA 20 0.005538505 28.8375 23 GGCTTGC 20 0.005538505 28.8375 17 AAGGCTT 20 0.005538505 28.8375 15 AAAGGCT 20 0.005538505 28.8375 14 TGGATAC 20 0.005538505 28.8375 26 GCTTGCG 20 0.005538505 28.8375 18 CTTGCGG 20 0.005538505 28.8375 19 TTGCGGT 20 0.005538505 28.8375 20 GGTGGAT 25 4.447609E-4 28.8375 24 ATACCTA 20 0.005538505 28.8375 29 GTGGATA 20 0.005538505 28.8375 25 GAAAGGC 20 0.005538505 28.8375 13 GGAAAGG 20 0.005538505 28.8375 12 >>END_MODULE Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra Read 770534 spots for SRR921328.sra Written 770534 spots for SRR921328.sra Read 770523 spots for SRR921328.sra Written 770523 spots for SRR921328.sra SRR ids: ['SRR921328.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1kqmwmpg SRR921328.sra spots: 15410471 blocks: [[1, 770523], [770524, 1541046], [1541047, 2311569], [2311570, 3082092], [3082093, 3852615], [3852616, 4623138], [4623139, 5393661], [5393662, 6164184], [6164185, 6934707], [6934708, 7705230], [7705231, 8475753], [8475754, 9246276], [9246277, 10016799], [10016800, 10787322], [10787323, 11557845], [11557846, 12328368], [12328369, 13098891], [13098892, 13869414], [13869415, 14639937], [14639938, 15410471]] SRR921328 file size 2249049 SRR921328 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR921328 SRR921328_1.fastq Input file: SRR921328_1.fastq trimmed: SRR921328-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:10:00 2024 >> started Sat Dec 7 00:10:09 2024 >> done (9.001s) 15410471 reads processed; of these: 561786 ( 3.65%) short reads filtered out after trimming by size control 174579 ( 1.13%) empty reads filtered out after trimming by size control 14674106 (95.22%) reads available; of these: 893389 ( 6.09%) trimmed reads available after processing 13780717 (93.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16816 0.11% 19 31348 0.21% 20 66544 0.45% 21 14871 0.10% 22 23618 0.16% 23 34417 0.23% 24 69360 0.47% 25 142511 0.97% 26 23327 0.16% 27 33970 0.23% 28 58256 0.40% 29 97884 0.67% 30 179487 1.22% 31 23428 0.16% 32 18726 0.13% 33 28062 0.19% 34 30764 0.21% 35 13780717 93.91% 14674106 reads passed initial QC criterion=sequence-density sequence-density=4.23 sequence-density-rank=1 fanout-score=12.10 fanout-score-rank=10 prefix-density=4.30 prefix-fanout=11.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATA criterion=fanout-score sequence-density=0.42 sequence-density-rank=6 fanout-score=229.29 fanout-score-rank=1 prefix-density=2.01 prefix-fanout=47.6 sequence=CCCTACACGACGCTCTTCCGATCT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATA -o SRR921328 - Input file: STDIN trimmed: SRR921328-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 00:10:30 2024 >> started Sat Dec 7 00:10:40 2024 >> done (10.073s) 8804464 reads processed; of these: 378483 ( 4.30%) short reads filtered out after trimming by size control 259 ( 0.00%) empty reads filtered out after trimming by size control 8425722 (95.70%) reads available; of these: 250524 ( 2.97%) trimmed reads available after processing 8175198 (97.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12248 0.15% 19 20548 0.24% 20 39695 0.47% 21 10585 0.13% 22 15825 0.19% 23 21167 0.25% 24 41649 0.49% 25 84031 1.00% 26 15873 0.19% 27 22363 0.27% 28 35924 0.43% 29 61136 0.73% 30 117380 1.39% 31 54626 0.65% 32 180796 2.15% 33 16441 0.20% 34 17823 0.21% 35 7657612 90.88% criterion=sequence-density sequence-density=4.09 sequence-density-rank=1 fanout-score=45.21 fanout-score-rank=1 prefix-density=4.02 prefix-fanout=45.2 sequence=TCAAAAGAGGAAAGGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTT criterion=fanout-score sequence-density=4.09 sequence-density-rank=1 fanout-score=45.21 fanout-score-rank=1 prefix-density=4.02 prefix-fanout=45.2 sequence=TCAAAAGAGGAAAGGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAGCGACGAAATGCTT Started job on | Dec 07 00:10:59 Started mapping on | Dec 07 00:10:59 Finished on | Dec 07 00:11:17 Mapping speed, Million of reads per hour | 2859.07 Number of input reads | 14295364 Average input read length | 34 UNIQUE READS: Uniquely mapped reads number | 11140112 Uniquely mapped reads % | 77.93% Average mapped length | 31.93 Number of splices: Total | 939189 Number of splices: Annotated (sjdb) | 914209 Number of splices: GT/AG | 926428 Number of splices: GC/AG | 10660 Number of splices: AT/AC | 626 Number of splices: Non-canonical | 1475 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1783975 % of reads mapped to multiple loci | 12.48% Number of reads mapped to too many loci | 424371 % of reads mapped to too many loci | 2.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.62% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1371277 1371277 1371277 N_multimapping 1783975 1783975 1783975 N_noFeature 457701 642352 10753855 N_ambiguous 219205 17233 1575 UnstrandedReadsAssigned:10463206 PositiveStrandReadsAssigned:10480527 NegativeStrandReadsAssigned:384682 Dataset is classified positive stranded MeadianReadLen=35 20thPercentileLength=35 echo kmer=31 SRR921328 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR921328-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,295,364 reads, 9,278,516 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR921328.ke.tsv 35125 SRR921328.se.tsv 88098 total ==> SRR921328.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 4.85469 0.935616 PNS24247 1044 945 8.13615 1.38883 PNS24249 1928 1829 14.0987 1.24344 PNS24246 1044 945 8.13615 1.38883 PNS24248 1044 945 8.13615 1.38883 PNS24244 1471 1372 88.6382 10.4215 PNS24243 293 194 0 0 KQK14069 1603 1504 6438.01 690.502 KQK14071 474 375 8688.4 3737.41 ==> SRR921328.se.tsv <== BRADI_1g14170v3 17849 BRADI_1g53295v3 30 BRADI_1g59795v3 206 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 294 BRADI_1g74790v3 16 BRADI_1g09890v3 22 BRADI_1g77505v3 100 BRADI_1g48960v3 1 SRR921328 completed mapping pipeline successfully