Starting /dee2/code/volunteer_pipeline.sh ERR1864411 current disk space = 3050730799104 free memory = 1581258240 ERR1864411 SRAfilesize aaafcf0dc980729c8a2bfb4f0102efc3 ERR1864411.sra ERR1864411.sra file validated ERR1864411 is paired end ERR1864411 is conventional basespace ERR1864411 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864411_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.291 34.0 31.0 34.0 30.0 34.0 2 31.8095 34.0 31.0 34.0 28.0 34.0 3 32.32875 34.0 31.0 34.0 29.0 34.0 4 35.9195 37.0 35.0 37.0 35.0 37.0 5 35.78775 37.0 35.0 37.0 35.0 37.0 6 35.66875 37.0 35.0 37.0 35.0 37.0 7 35.67975 37.0 35.0 37.0 35.0 37.0 8 35.694 37.0 36.0 37.0 35.0 37.0 9 37.40575 39.0 38.0 39.0 35.0 39.0 10-11 37.328500000000005 39.0 38.0 39.0 35.0 39.0 12-13 37.145375 39.0 38.0 39.0 33.5 39.0 14-15 38.66775 41.0 39.0 41.0 34.5 41.0 16-17 38.53675 41.0 38.5 41.0 34.5 41.0 18-19 38.56925 41.0 38.5 41.0 34.0 41.0 20-21 38.40625 41.0 38.5 41.0 34.0 41.0 22-23 38.450125 40.5 39.0 41.0 34.0 41.0 24-25 38.3535 40.5 38.5 41.0 34.0 41.0 26-27 38.247749999999996 40.0 38.0 41.0 34.0 41.0 28-29 38.15775 40.0 38.0 41.0 33.5 41.0 30-31 38.020375 40.0 38.0 41.0 33.0 41.0 32-33 37.906375 40.0 38.0 41.0 33.0 41.0 34-35 37.818124999999995 40.0 38.0 41.0 33.0 41.0 36-37 37.759249999999994 40.0 38.0 41.0 32.5 41.0 38-39 37.69175 40.0 38.0 41.0 33.0 41.0 40-41 37.466499999999996 40.0 38.0 41.0 32.5 41.0 42-43 37.308875 40.0 37.0 41.0 31.0 41.0 44-45 37.214875 40.0 37.5 41.0 31.0 41.0 46-47 37.4965 40.0 37.5 41.0 32.0 41.0 48-49 37.45075 40.0 37.5 41.0 32.0 41.0 50-51 37.230625 40.0 37.0 41.0 31.5 41.0 52-53 37.14775 40.0 37.0 41.0 31.5 41.0 54-55 36.862375 40.0 36.5 41.0 31.0 41.0 56-57 36.666875000000005 39.5 36.0 41.0 30.5 41.0 58-59 36.47875 39.0 36.0 41.0 31.0 41.0 60-61 36.142875000000004 39.0 35.0 40.5 29.5 41.0 62-63 35.909875 39.0 35.0 40.0 29.0 41.0 64-65 35.418125 38.0 35.0 40.0 28.0 41.0 66-67 35.167375 37.5 34.5 40.0 28.0 41.0 68-69 34.786249999999995 37.0 34.0 39.5 28.0 41.0 70-71 34.286249999999995 36.5 34.0 39.0 27.5 40.5 72-73 33.832875 36.0 34.0 38.5 27.5 40.0 74-75 33.264 35.0 33.5 37.5 26.0 39.5 76-77 32.093 34.5 31.5 36.0 25.0 39.0 78-79 32.367374999999996 35.0 32.0 36.5 26.0 38.5 80-81 32.153999999999996 35.0 33.0 36.0 26.0 37.0 82-83 31.83925 35.0 32.5 36.0 24.5 37.0 84-85 31.568625 35.0 32.0 35.0 24.5 36.5 86-87 31.359 34.5 32.0 35.0 25.0 36.0 88-89 31.114624999999997 34.0 32.0 35.0 24.0 36.0 90-91 30.826 34.0 31.5 35.0 23.0 35.5 92-93 30.51475 34.0 31.0 35.0 20.0 35.0 94-95 30.287 34.0 31.0 35.0 19.0 35.0 96-97 30.15825 34.0 31.0 35.0 18.0 35.0 98-99 29.890375 34.0 31.0 35.0 4.5 35.0 100-101 28.996625 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 16.0 4 3.0 5 14.0 6 1.0 7 5.0 8 7.0 9 1.0 10 5.0 11 12.0 12 7.0 13 13.0 14 8.0 15 9.0 16 11.0 17 15.0 18 13.0 19 13.0 20 13.0 21 13.0 22 13.0 23 16.0 24 14.0 25 29.0 26 30.0 27 32.0 28 34.0 29 41.0 30 56.0 31 79.0 32 90.0 33 143.0 34 163.0 35 244.0 36 503.0 37 993.0 38 1189.0 39 135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.301612064482576 5.850234009360374 6.942277691107644 46.905876235049405 2 24.474999999999998 8.875 35.35 31.3 3 24.18627941912869 12.018027040560842 22.8092138207311 40.98647971957937 4 28.95 18.65 20.75 31.65 5 27.888944472236116 25.76288144072036 25.237618809404704 21.11055527763882 6 22.175 28.9 27.725 21.2 7 16.6 23.674999999999997 43.025000000000006 16.7 8 18.725 22.275 36.75 22.25 9 18.625 22.475 36.875 22.025 10-11 20.150000000000002 32.1125 28.325 19.412499999999998 12-13 22.225 25.162499999999998 30.375000000000004 22.237499999999997 14-15 20.6875 27.212500000000002 29.299999999999997 22.8 16-17 22.175 27.0625 28.9375 21.825 18-19 21.5 26.275 28.249999999999996 23.974999999999998 20-21 20.9875 27.462500000000002 28.762500000000003 22.787499999999998 22-23 21.4375 27.875 28.025 22.662499999999998 24-25 21.7 26.3 28.775000000000002 23.225 26-27 22.412499999999998 26.0 28.512500000000003 23.075000000000003 28-29 22.625 26.075 28.1125 23.1875 30-31 21.837500000000002 27.1125 26.85 24.2 32-33 21.525 26.6 28.287499999999998 23.5875 34-35 21.5 28.037499999999998 27.6 22.8625 36-37 21.475 27.212500000000002 27.6 23.7125 38-39 21.3625 27.075 27.500000000000004 24.0625 40-41 21.6625 28.15 27.85 22.3375 42-43 21.349999999999998 27.975 28.199999999999996 22.475 44-45 21.775 27.025 28.4125 22.787499999999998 46-47 21.875 27.462500000000002 27.650000000000002 23.0125 48-49 21.2375 27.0875 27.775 23.9 50-51 20.424999999999997 27.950000000000003 27.6375 23.9875 52-53 21.94847423711856 26.725862931465734 28.376688344172084 22.948974487243625 54-55 21.325 27.737499999999997 27.950000000000003 22.9875 56-57 21.9625 26.8375 27.725 23.474999999999998 58-59 21.4125 27.625 28.012500000000003 22.95 60-61 21.4 27.712500000000002 27.625 23.2625 62-63 21.875 26.087500000000002 28.9 23.1375 64-65 21.90273784223028 26.56582072759095 28.041005125640705 23.49043630453807 66-67 21.780445111277817 27.04426106526632 27.831957989497376 23.34333583395849 68-69 21.288305190744214 27.66729205753596 28.21763602251407 22.82676672920575 70-71 21.840230028753595 27.21590198774847 27.415926990873857 23.527940992624078 72-73 22.275 27.762500000000003 27.287499999999998 22.675 74-75 22.095785919719894 27.435288233087405 27.58534450418907 22.883581343003627 76-77 22.202775346918365 27.415926990873857 27.528441055131893 22.852856607075882 78-79 21.0625 27.537499999999998 27.55 23.849999999999998 80-81 22.0875 27.575 27.950000000000003 22.3875 82-83 22.3375 27.750000000000004 28.075 21.837500000000002 84-85 22.162499999999998 27.8625 26.825 23.150000000000002 86-87 21.925 27.287499999999998 27.6 23.1875 88-89 21.9625 27.9375 26.875 23.225 90-91 22.2125 27.450000000000003 26.825 23.5125 92-93 22.152769096137018 27.82847855981998 27.990998874859358 22.027753469183647 94-95 22.015251906488313 26.415801975246904 28.478559819977495 23.090386298287285 96-97 21.0 28.037499999999998 27.55 23.4125 98-99 21.875 27.775 28.4 21.95 100-101 22.725 27.1 27.0875 23.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 3.5 28 6.0 29 10.5 30 13.0 31 16.0 32 18.0 33 25.0 34 34.5 35 47.0 36 60.5 37 74.0 38 104.0 39 134.0 40 166.0 41 193.5 42 228.0 43 244.0 44 253.5 45 279.5 46 294.0 47 293.0 48 259.5 49 217.5 50 200.0 51 177.5 52 128.0 53 103.0 54 86.5 55 69.5 56 66.0 57 50.5 58 32.0 59 25.0 60 21.5 61 15.5 62 11.5 63 10.5 64 7.0 65 6.0 66 5.5 67 2.5 68 1.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.85 2 0.0 3 0.15 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.05 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.025 68-69 0.0625 70-71 0.0125 72-73 0.0 74-75 0.0375 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0125 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98836621143147 97.85000000000001 2 0.9357612544258977 1.8499999999999999 3 0.025290844714213456 0.075 4 0.025290844714213456 0.1 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.30000000000000004 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864411 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864411_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.282 34.0 31.0 34.0 30.0 34.0 2 32.41325 34.0 31.0 34.0 31.0 34.0 3 32.40675 34.0 31.0 34.0 31.0 34.0 4 35.72 37.0 37.0 37.0 35.0 37.0 5 35.71575 37.0 37.0 37.0 35.0 37.0 6 35.6915 37.0 37.0 37.0 35.0 37.0 7 35.76025 37.0 37.0 37.0 35.0 37.0 8 35.72925 37.0 37.0 37.0 35.0 37.0 9 37.50175 39.0 38.0 39.0 35.0 39.0 10-11 37.398624999999996 39.0 38.0 39.0 35.0 39.0 12-13 37.34825 39.0 38.0 39.0 34.5 39.0 14-15 38.699375 41.0 38.5 41.0 34.5 41.0 16-17 38.66575 41.0 39.0 41.0 34.0 41.0 18-19 38.66825 41.0 38.5 41.0 34.5 41.0 20-21 38.5 40.5 39.0 41.0 34.0 41.0 22-23 38.46275 40.0 39.0 41.0 34.0 41.0 24-25 38.298249999999996 40.5 38.0 41.0 33.5 41.0 26-27 38.2045 40.0 38.0 41.0 34.0 41.0 28-29 38.13275 40.0 38.0 41.0 33.0 41.0 30-31 38.085125000000005 40.0 38.0 41.0 33.5 41.0 32-33 38.02525 40.0 38.0 41.0 33.5 41.0 34-35 38.05525 40.0 38.0 41.0 33.0 41.0 36-37 37.96075 40.0 38.0 41.0 33.0 41.0 38-39 37.891999999999996 40.0 38.0 41.0 33.0 41.0 40-41 37.78075 40.0 38.0 41.0 33.0 41.0 42-43 37.592625 40.0 38.0 41.0 32.5 41.0 44-45 37.3335 40.0 37.5 41.0 31.5 41.0 46-47 36.9675 40.0 37.0 41.0 30.5 41.0 48-49 36.99725 40.0 37.0 41.0 31.0 41.0 50-51 36.621375 39.5 36.5 40.5 30.5 41.0 52-53 36.8375 39.5 37.0 40.5 31.0 41.0 54-55 36.958875 40.0 37.0 41.0 31.0 41.0 56-57 37.035624999999996 40.0 37.0 41.0 31.0 41.0 58-59 36.8925 40.0 36.5 41.0 31.0 41.0 60-61 36.377250000000004 39.0 36.0 41.0 29.5 41.0 62-63 36.304625 39.0 35.5 41.0 30.0 41.0 64-65 35.92725 38.5 35.0 40.0 29.5 41.0 66-67 35.53575 37.5 35.0 40.0 29.0 41.0 68-69 35.07425 37.0 34.5 39.5 28.5 41.0 70-71 34.734 36.5 34.0 39.0 28.5 41.0 72-73 34.353375 36.0 34.0 39.0 29.0 40.5 74-75 33.65975 35.5 34.0 37.5 27.0 39.0 76-77 33.2625 35.0 34.0 37.0 26.5 39.0 78-79 32.83075 35.0 33.0 36.5 26.5 38.5 80-81 32.39975 35.0 33.0 36.0 25.5 37.0 82-83 31.8475 35.0 32.0 35.5 25.0 37.0 84-85 31.762375 35.0 32.0 35.0 25.0 36.0 86-87 31.50925 35.0 32.0 35.0 25.0 36.0 88-89 31.273000000000003 35.0 32.0 35.0 24.0 36.0 90-91 30.97325 34.5 32.0 35.0 23.0 35.0 92-93 30.843375 34.0 32.0 35.0 22.0 35.0 94-95 30.51875 34.0 31.0 35.0 19.0 35.0 96-97 30.19075 34.0 31.0 35.0 16.5 35.0 98-99 29.756124999999997 34.0 31.0 35.0 2.0 35.0 100-101 28.797625 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 1.0 5 7.0 6 3.0 7 5.0 8 9.0 9 7.0 10 8.0 11 7.0 12 11.0 13 20.0 14 6.0 15 7.0 16 8.0 17 13.0 18 9.0 19 10.0 20 10.0 21 17.0 22 7.0 23 17.0 24 21.0 25 19.0 26 39.0 27 38.0 28 44.0 29 52.0 30 54.0 31 73.0 32 75.0 33 124.0 34 162.0 35 253.0 36 486.0 37 992.0 38 1199.0 39 169.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.075 18.925 12.9 39.1 2 23.9 24.825 34.025 17.25 3 20.474999999999998 28.549999999999997 29.175 21.8 4 21.875 32.800000000000004 23.65 21.675 5 25.05 34.475 22.675 17.8 6 18.85 38.425 23.775 18.95 7 19.45 21.2 37.875 21.475 8 21.425 24.6 29.275000000000002 24.7 9 20.599999999999998 25.174999999999997 29.075 25.15 10-11 22.625 32.300000000000004 24.2375 20.837500000000002 12-13 23.5 25.900000000000002 26.7625 23.8375 14-15 23.0375 27.962500000000002 26.674999999999997 22.325 16-17 23.3875 27.8875 26.55 22.175 18-19 22.1375 29.15 26.737499999999997 21.975 20-21 22.3125 28.199999999999996 27.05 22.4375 22-23 22.0625 27.9125 27.8375 22.1875 24-25 22.287499999999998 28.4125 27.224999999999998 22.075 26-27 23.0 27.474999999999998 27.787499999999998 21.7375 28-29 23.025000000000002 27.425 27.212500000000002 22.3375 30-31 22.0125 29.262500000000003 26.8625 21.8625 32-33 23.1625 29.0875 25.900000000000002 21.85 34-35 22.8875 28.625 26.087500000000002 22.400000000000002 36-37 22.375 28.000000000000004 27.437499999999996 22.1875 38-39 22.0625 29.099999999999998 27.275 21.5625 40-41 23.1625 27.737499999999997 26.387500000000003 22.7125 42-43 22.412499999999998 27.825 27.875 21.8875 44-45 22.95 28.075 27.1375 21.837500000000002 46-47 23.4125 28.249999999999996 26.687499999999996 21.65 48-49 23.0625 28.799999999999997 27.150000000000002 20.9875 50-51 23.4625 27.650000000000002 27.3 21.587500000000002 52-53 23.625 27.5625 26.6625 22.15 54-55 22.662499999999998 28.962500000000002 27.037499999999998 21.337500000000002 56-57 22.8875 27.825 27.200000000000003 22.0875 58-59 22.8875 28.349999999999998 27.450000000000003 21.3125 60-61 22.475 28.037499999999998 27.500000000000004 21.987499999999997 62-63 23.4625 28.65 26.0625 21.825 64-65 23.6875 28.1375 27.212500000000002 20.962500000000002 66-67 22.95 28.0625 26.775 22.2125 68-69 23.1625 28.249999999999996 26.737499999999997 21.85 70-71 22.6375 27.5625 27.537499999999998 22.2625 72-73 22.8375 28.675 26.700000000000003 21.7875 74-75 23.175 28.212500000000002 26.987499999999997 21.625 76-77 23.525 27.125 26.55 22.8 78-79 22.787499999999998 28.549999999999997 27.212500000000002 21.45 80-81 23.7 28.075 26.937499999999996 21.2875 82-83 23.7625 26.875 27.675 21.6875 84-85 22.325 28.4 26.724999999999998 22.55 86-87 23.6875 28.249999999999996 25.624999999999996 22.4375 88-89 23.474999999999998 27.6125 26.75 22.162499999999998 90-91 22.875 28.249999999999996 26.637499999999996 22.237499999999997 92-93 23.6875 27.8875 26.724999999999998 21.7 94-95 24.775 27.275 26.2625 21.6875 96-97 23.0625 27.737499999999997 27.287499999999998 21.912499999999998 98-99 23.9875 27.2625 26.9625 21.7875 100-101 24.2625 27.287499999999998 26.224999999999998 22.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 3.5 28 6.5 29 10.0 30 12.0 31 13.0 32 16.0 33 25.0 34 37.0 35 57.0 36 73.5 37 74.0 38 106.5 39 158.0 40 169.5 41 192.5 42 240.0 43 274.0 44 273.0 45 277.0 46 301.5 47 284.0 48 245.0 49 217.5 50 181.5 51 143.0 52 121.5 53 100.0 54 89.5 55 70.0 56 49.5 57 40.5 58 26.0 59 22.5 60 19.5 61 16.5 62 14.5 63 8.5 64 7.0 65 7.0 66 4.5 67 3.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.30000000000000004 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800858 spots for ERR1864411.sra Written 800858 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra Read 800839 spots for ERR1864411.sra Written 800839 spots for ERR1864411.sra SRR ids: ['ERR1864411.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_129iw9yf ERR1864411.sra spots: 16016799 blocks: [[1, 800839], [800840, 1601678], [1601679, 2402517], [2402518, 3203356], [3203357, 4004195], [4004196, 4805034], [4805035, 5605873], [5605874, 6406712], [6406713, 7207551], [7207552, 8008390], [8008391, 8809229], [8809230, 9610068], [9610069, 10410907], [10410908, 11211746], [11211747, 12012585], [12012586, 12813424], [12813425, 13614263], [13614264, 14415102], [14415103, 15215941], [15215942, 16016799]] ERR1864411 file size 3841726 ERR1864411 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864411 ERR1864411_1.fastq ERR1864411_2.fastq Input file: ERR1864411_1.fastq Paired file: ERR1864411_2.fastq trimmed: ERR1864411-trimmed-pair1.fastq, ERR1864411-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:49:25 2025 >> started Thu Feb 13 00:53:34 2025 >> done (248.497s) 16016799 read pairs processed; of these: 231470 ( 1.45%) short read pairs filtered out after trimming by size control 259311 ( 1.62%) empty read pairs filtered out after trimming by size control 15526018 (96.94%) read pairs available; of these: 3644912 (23.48%) trimmed read pairs available after processing 11881106 (76.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 116 0.00% 19 267 0.00% 20 387 0.00% 21 576 0.00% 22 687 0.00% 23 794 0.01% 24 1079 0.01% 25 1226 0.01% 26 1355 0.01% 27 1637 0.01% 28 1917 0.01% 29 2144 0.01% 30 2425 0.02% 31 2908 0.02% 32 3173 0.02% 33 3590 0.02% 34 3839 0.02% 35 4219 0.03% 36 4433 0.03% 37 4864 0.03% 38 5255 0.03% 39 5700 0.04% 40 6161 0.04% 41 6430 0.04% 42 6715 0.04% 43 6963 0.04% 44 7631 0.05% 45 7955 0.05% 46 8381 0.05% 47 8756 0.06% 48 9140 0.06% 49 9536 0.06% 50 9960 0.06% 51 10473 0.07% 52 11050 0.07% 53 11188 0.07% 54 12280 0.08% 55 12486 0.08% 56 12958 0.08% 57 13880 0.09% 58 14747 0.09% 59 18059 0.12% 60 21541 0.14% 61 21705 0.14% 62 22879 0.15% 63 23393 0.15% 64 24445 0.16% 65 25292 0.16% 66 26480 0.17% 67 27233 0.18% 68 28858 0.19% 69 29759 0.19% 70 31189 0.20% 71 32553 0.21% 72 34131 0.22% 73 35083 0.23% 74 36851 0.24% 75 37480 0.24% 76 37669 0.24% 77 39950 0.26% 78 42251 0.27% 79 44368 0.29% 80 47680 0.31% 81 49270 0.32% 82 51902 0.33% 83 53993 0.35% 84 56835 0.37% 85 60378 0.39% 86 64088 0.41% 87 67137 0.43% 88 68719 0.44% 89 72952 0.47% 90 80196 0.52% 91 87719 0.56% 92 97324 0.63% 93 108780 0.70% 94 123270 0.79% 95 142543 0.92% 96 169402 1.09% 97 208526 1.34% 98 271865 1.75% 99 367809 2.37% 100 514074 3.31% 101 11881106 76.52% 15526018 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=2.5 sequence=AATGGCAGGAGAGGTGGATTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=133.70 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=215.25 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.1 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864411 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:20:05 Started mapping on | Feb 13 01:20:05 Finished on | Feb 13 01:20:55 Mapping speed, Million of reads per hour | 1117.87 Number of input reads | 15526018 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15030629 Uniquely mapped reads % | 96.81% Average mapped length | 195.43 Number of splices: Total | 9122110 Number of splices: Annotated (sjdb) | 8991173 Number of splices: GT/AG | 8959877 Number of splices: GC/AG | 143614 Number of splices: AT/AC | 5735 Number of splices: Non-canonical | 12884 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413187 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 12877 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 101586 101586 101586 N_multimapping 413187 413187 413187 N_noFeature 337435 14887395 399546 N_ambiguous 135201 591 53767 UnstrandedReadsAssigned:14557993 PositiveStrandReadsAssigned:142643 NegativeStrandReadsAssigned:14577316 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864411 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864411-trimmed-pair1.fastq ERR1864411-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,526,018 reads, 14,797,007 reads pseudoaligned [quant] estimated average fragment length: 159.893 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 ERR1864411.ke.tsv 34699 ERR1864411.se.tsv 87100 total ==> ERR1864411.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.11 922 36.9764 Potri.005G024800.1.v4.1 1035 876.107 155 13.1908 Potri.004G059700.1.v4.1 961 802.113 18 1.67315 Potri.007G009000.2.v4.1 1416 1257.11 0 0 Potri.003G141000.2.v4.1 2943 2784.11 1351.55 36.1945 Potri.016G087400.1.v4.1 270 117.499 677 429.587 Potri.015G069301.1.v4.1 564 405.183 0 0 Potri.010G195200.1.v4.1 1773 1614.11 41 1.89387 Potri.012G127500.1.v4.1 977 818.113 185 16.8599 ==> ERR1864411.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1085 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 18 ERR1864411 completed mapping pipeline successfully