Starting /dee2/code/volunteer_pipeline.sh ERR1864412 current disk space = 3050504085504 free memory = 1575675956 ERR1864412 SRAfilesize 7fbd83ca9d945cf735f82b4d47fbf979 ERR1864412.sra ERR1864412.sra file validated ERR1864412 is paired end ERR1864412 is conventional basespace ERR1864412 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.31375 34.0 31.0 34.0 30.0 34.0 2 31.841 34.0 31.0 34.0 28.0 34.0 3 32.41425 34.0 31.0 34.0 30.0 34.0 4 35.9205 37.0 35.0 37.0 35.0 37.0 5 35.6665 37.0 35.0 37.0 35.0 37.0 6 35.59225 37.0 35.0 37.0 35.0 37.0 7 35.65975 37.0 35.0 37.0 35.0 37.0 8 35.7305 37.0 36.0 37.0 35.0 37.0 9 37.417 39.0 38.0 39.0 35.0 39.0 10-11 37.347375 39.0 38.0 39.0 35.0 39.0 12-13 37.21025 39.0 38.0 39.0 34.5 39.0 14-15 38.727125 41.0 39.0 41.0 34.5 41.0 16-17 38.698875 41.0 39.0 41.0 35.0 41.0 18-19 38.611 41.0 39.0 41.0 35.0 41.0 20-21 38.461625 41.0 39.0 41.0 34.0 41.0 22-23 38.485375 41.0 39.0 41.0 34.0 41.0 24-25 38.442499999999995 40.5 39.0 41.0 34.0 41.0 26-27 38.414500000000004 40.5 38.0 41.0 34.0 41.0 28-29 38.336625 40.0 38.5 41.0 33.5 41.0 30-31 38.195 40.0 38.0 41.0 33.0 41.0 32-33 38.11925 40.0 38.0 41.0 33.0 41.0 34-35 37.867375 40.0 38.0 41.0 33.0 41.0 36-37 37.7975 40.0 38.0 41.0 33.0 41.0 38-39 37.7235 40.0 38.0 41.0 33.0 41.0 40-41 37.66175 40.0 38.0 41.0 32.5 41.0 42-43 37.440875 40.0 37.5 41.0 32.0 41.0 44-45 37.39275 40.0 37.0 41.0 31.5 41.0 46-47 37.539375 40.0 38.0 41.0 32.5 41.0 48-49 37.39925 40.0 37.0 41.0 32.0 41.0 50-51 37.261375 40.0 37.0 41.0 31.5 41.0 52-53 37.03125 40.0 37.0 41.0 31.0 41.0 54-55 36.8675 40.0 36.5 41.0 31.0 41.0 56-57 36.666875000000005 39.5 36.0 41.0 31.0 41.0 58-59 36.483625 39.0 36.0 41.0 31.0 41.0 60-61 36.246875 39.0 35.0 41.0 30.5 41.0 62-63 35.93025 39.0 35.0 40.0 29.5 41.0 64-65 35.4585 38.0 35.0 40.0 29.0 41.0 66-67 35.26725 37.5 34.5 40.0 29.0 41.0 68-69 34.92775 37.0 34.5 39.5 29.0 41.0 70-71 34.46725 36.5 34.0 39.0 28.0 40.5 72-73 34.111999999999995 36.0 34.0 39.0 28.0 40.0 74-75 33.521125 35.5 33.5 37.5 26.5 39.5 76-77 32.401375 35.0 32.0 36.5 26.0 39.0 78-79 32.522 35.0 33.0 36.5 26.0 39.0 80-81 32.267250000000004 35.0 33.0 36.0 26.0 37.5 82-83 32.0225 35.0 33.0 36.0 25.5 37.0 84-85 31.746000000000002 35.0 32.5 35.0 25.5 37.0 86-87 31.58925 35.0 32.0 35.0 25.0 36.0 88-89 31.307499999999997 34.5 32.0 35.0 24.5 36.0 90-91 30.94175 34.0 32.0 35.0 23.5 35.5 92-93 30.678875 34.0 31.5 35.0 21.0 35.0 94-95 30.44825 34.0 31.0 35.0 20.0 35.0 96-97 30.207875 34.0 31.0 35.0 18.0 35.0 98-99 29.884875 34.0 31.0 35.0 6.0 35.0 100-101 29.1325 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 15.0 4 5.0 5 6.0 6 2.0 7 5.0 8 9.0 9 0.0 10 9.0 11 11.0 12 9.0 13 10.0 14 11.0 15 12.0 16 5.0 17 8.0 18 11.0 19 14.0 20 17.0 21 13.0 22 13.0 23 11.0 24 16.0 25 16.0 26 23.0 27 29.0 28 38.0 29 59.0 30 50.0 31 53.0 32 103.0 33 145.0 34 161.0 35 297.0 36 454.0 37 927.0 38 1256.0 39 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.77656534164718 6.1834242660431284 8.002078461938165 46.03793193037152 2 24.875 8.625 35.475 31.025000000000002 3 24.34325744308231 11.158368776582437 23.54265699274456 40.955716787590696 4 27.900000000000002 19.975 20.549999999999997 31.574999999999996 5 27.51375687843922 25.587793896948476 24.112056028014006 22.786393196598297 6 22.35 29.95 26.0 21.7 7 16.625 22.85 42.175000000000004 18.35 8 18.325 23.225 35.075 23.375 9 18.15 23.125 38.4 20.325 10-11 20.0875 32.9 27.787499999999998 19.225 12-13 21.125 27.212500000000002 30.125 21.5375 14-15 20.724999999999998 27.650000000000002 29.2375 22.3875 16-17 22.425 27.85 28.050000000000004 21.675 18-19 21.175 27.962500000000002 28.475 22.3875 20-21 21.5625 28.325 27.775 22.3375 22-23 21.425 28.275 27.0875 23.2125 24-25 21.075 27.5125 28.050000000000004 23.3625 26-27 20.875 28.4375 28.462500000000002 22.225 28-29 21.637500000000003 27.8125 27.700000000000003 22.85 30-31 21.3 28.275 27.700000000000003 22.725 32-33 21.425 27.712500000000002 28.050000000000004 22.8125 34-35 22.0625 27.8125 27.6375 22.4875 36-37 21.8 27.900000000000002 27.625 22.675 38-39 20.8625 27.537499999999998 28.050000000000004 23.549999999999997 40-41 21.95 27.950000000000003 27.875 22.225 42-43 21.25 27.625 27.6625 23.4625 44-45 20.7375 28.462500000000002 27.6875 23.1125 46-47 22.575 27.875 27.037499999999998 22.5125 48-49 20.8625 27.6125 27.500000000000004 24.025 50-51 21.2625 28.037499999999998 27.6875 23.0125 52-53 22.143035758939735 26.744186046511626 28.40710177544386 22.705676419104776 54-55 21.712500000000002 27.2625 27.8125 23.2125 56-57 21.475 27.05 28.1375 23.3375 58-59 21.125 28.0625 28.3875 22.425 60-61 21.125 27.825 28.1 22.95 62-63 22.225 26.9625 27.9125 22.900000000000002 64-65 21.002625328166022 26.815851981497683 28.89111138892362 23.29041130141268 66-67 21.602700337542196 28.328541067633456 27.65345668208526 22.415301912739093 68-69 20.69526072277104 27.872952357133922 28.72327122671002 22.70851569338502 70-71 21.377672209026127 27.54094261782723 28.316039504938118 22.765345668208525 72-73 20.849999999999998 27.437499999999996 27.800000000000004 23.9125 74-75 21.002625328166022 28.378547318414803 27.86598324790599 22.75284410551319 76-77 21.340167520940117 27.440930116264532 28.116014501812725 23.102887860982623 78-79 22.1375 27.575 27.487499999999997 22.8 80-81 21.4125 26.700000000000003 28.7 23.1875 82-83 22.125 27.675 27.925 22.275 84-85 22.112499999999997 27.625 27.0625 23.200000000000003 86-87 22.625 27.1 27.6125 22.662499999999998 88-89 21.925 27.6 27.8875 22.5875 90-91 22.2 27.625 27.462500000000002 22.7125 92-93 22.26528316039505 28.003500437554695 27.765970746343292 21.965245655706962 94-95 22.090261282660332 28.59107388423553 27.390923865483185 21.927740967620952 96-97 21.175 27.1625 28.0625 23.599999999999998 98-99 22.275 27.187499999999996 26.8375 23.7 100-101 21.075 29.025000000000002 27.6125 22.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 3.5 26 3.5 27 2.5 28 3.0 29 7.0 30 16.5 31 19.0 32 16.0 33 23.5 34 37.5 35 60.5 36 84.5 37 98.0 38 120.0 39 143.5 40 177.5 41 207.0 42 230.0 43 259.5 44 274.0 45 277.5 46 256.0 47 246.5 48 245.0 49 224.0 50 194.0 51 147.5 52 120.5 53 106.5 54 78.5 55 61.0 56 56.0 57 45.5 58 37.0 59 34.0 60 24.5 61 16.0 62 10.5 63 6.5 64 7.5 65 5.0 66 2.0 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.775 2 0.0 3 0.075 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.0375 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0125 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2125 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.775 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864412 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864412_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27925 34.0 31.0 34.0 31.0 34.0 2 32.383 34.0 31.0 34.0 31.0 34.0 3 32.40225 34.0 31.0 34.0 31.0 34.0 4 35.71375 37.0 37.0 37.0 35.0 37.0 5 35.7885 37.0 37.0 37.0 35.0 37.0 6 35.74775 37.0 37.0 37.0 35.0 37.0 7 35.73125 37.0 37.0 37.0 35.0 37.0 8 35.66075 37.0 37.0 37.0 35.0 37.0 9 37.471 39.0 38.0 39.0 35.0 39.0 10-11 37.36325 39.0 38.0 39.0 34.5 39.0 12-13 37.32475 39.0 38.0 39.0 34.5 39.0 14-15 38.62875 41.0 38.5 41.0 34.5 41.0 16-17 38.65525 41.0 39.0 41.0 34.5 41.0 18-19 38.643625 41.0 38.5 41.0 34.0 41.0 20-21 38.49625 41.0 38.5 41.0 34.0 41.0 22-23 38.496375 40.5 39.0 41.0 34.0 41.0 24-25 38.264624999999995 40.5 38.0 41.0 33.5 41.0 26-27 38.198 40.0 38.0 41.0 33.5 41.0 28-29 38.117999999999995 40.0 38.0 41.0 33.0 41.0 30-31 38.045874999999995 40.0 38.0 41.0 33.0 41.0 32-33 37.866625 40.0 38.0 41.0 33.0 41.0 34-35 37.879625000000004 40.0 38.0 41.0 33.0 41.0 36-37 37.87875 40.0 38.0 41.0 33.0 41.0 38-39 37.78875 40.0 38.0 41.0 32.5 41.0 40-41 37.684875000000005 40.0 38.0 41.0 32.5 41.0 42-43 37.601749999999996 40.0 38.0 41.0 32.5 41.0 44-45 37.215125 40.0 37.5 41.0 31.0 41.0 46-47 36.960375 40.0 37.0 41.0 31.0 41.0 48-49 36.914249999999996 40.0 37.0 41.0 30.5 41.0 50-51 36.601 39.5 36.5 40.5 30.5 41.0 52-53 36.834374999999994 39.5 37.0 40.5 31.0 41.0 54-55 36.861000000000004 40.0 36.5 41.0 31.0 41.0 56-57 36.953125 40.0 36.5 41.0 31.0 41.0 58-59 36.646249999999995 39.5 36.0 41.0 31.0 41.0 60-61 36.126000000000005 39.0 35.0 41.0 28.5 41.0 62-63 36.075 39.0 35.0 41.0 29.5 41.0 64-65 35.721625 38.5 35.0 40.5 29.0 41.0 66-67 35.35425 37.5 35.0 40.0 28.5 41.0 68-69 34.777875 37.0 34.5 39.5 28.0 41.0 70-71 34.484625 36.5 34.0 39.0 28.0 41.0 72-73 34.061375 36.0 34.0 39.0 27.0 40.0 74-75 33.43625 35.0 34.0 37.5 26.0 39.0 76-77 33.174 35.0 34.0 37.0 26.5 39.0 78-79 32.638625000000005 35.0 33.0 36.5 26.0 38.5 80-81 32.257999999999996 35.0 33.0 36.0 25.0 37.0 82-83 31.640124999999998 35.0 32.0 35.5 24.0 37.0 84-85 31.480375000000002 35.0 32.0 35.0 23.5 36.5 86-87 31.376875 35.0 32.0 35.0 24.0 36.0 88-89 31.142375 35.0 32.0 35.0 23.0 36.0 90-91 30.923125 34.5 31.5 35.0 23.0 35.5 92-93 30.623375000000003 34.0 31.5 35.0 19.5 35.0 94-95 30.36875 34.0 31.0 35.0 18.5 35.0 96-97 30.021 34.0 31.0 35.0 11.5 35.0 98-99 29.610375 34.0 31.0 35.0 2.0 35.0 100-101 28.6085 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 4.0 4 2.0 5 4.0 6 4.0 7 5.0 8 11.0 9 4.0 10 5.0 11 12.0 12 6.0 13 9.0 14 19.0 15 7.0 16 11.0 17 15.0 18 8.0 19 16.0 20 8.0 21 11.0 22 17.0 23 27.0 24 23.0 25 26.0 26 27.0 27 32.0 28 37.0 29 56.0 30 70.0 31 82.0 32 111.0 33 126.0 34 163.0 35 253.0 36 438.0 37 906.0 38 1231.0 39 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.549999999999997 18.2 14.274999999999999 38.975 2 24.125 23.400000000000002 35.099999999999994 17.375 3 19.425 28.1 29.775000000000002 22.7 4 22.05 33.324999999999996 23.9 20.724999999999998 5 24.55 34.475 24.075 16.900000000000002 6 19.325 38.45 23.549999999999997 18.675 7 18.45 19.45 40.775 21.325 8 19.275000000000002 25.724999999999998 30.325000000000003 24.675 9 21.349999999999998 25.55 29.849999999999998 23.25 10-11 22.4875 32.25 23.9375 21.325 12-13 24.224999999999998 25.55 26.137500000000003 24.087500000000002 14-15 21.7875 28.8875 27.05 22.275 16-17 23.0 29.312500000000004 26.2125 21.475 18-19 23.400000000000002 27.762500000000003 27.5625 21.275 20-21 22.7625 29.612500000000004 26.3125 21.3125 22-23 22.6 28.8875 27.462500000000002 21.05 24-25 22.912499999999998 28.749999999999996 26.337500000000002 22.0 26-27 23.150000000000002 28.799999999999997 26.9125 21.1375 28-29 22.5875 27.737499999999997 27.675 22.0 30-31 23.3 28.249999999999996 26.575 21.875 32-33 22.8 28.012500000000003 27.224999999999998 21.9625 34-35 22.725 28.4 27.0625 21.8125 36-37 22.475 28.1375 27.025 22.3625 38-39 22.287499999999998 28.849999999999998 27.200000000000003 21.6625 40-41 22.7375 28.375 27.0125 21.875 42-43 22.0875 27.987499999999997 27.462500000000002 22.4625 44-45 21.987499999999997 28.199999999999996 28.175 21.637500000000003 46-47 22.2625 27.975 28.037499999999998 21.725 48-49 22.725 27.6 27.375 22.3 50-51 22.575 28.6125 27.650000000000002 21.1625 52-53 23.3 27.950000000000003 27.3 21.45 54-55 22.7 28.575 27.325 21.4 56-57 23.5375 28.15 26.5 21.8125 58-59 23.5875 27.725 27.275 21.4125 60-61 22.45 29.625 26.237500000000004 21.6875 62-63 23.0375 28.299999999999997 27.3125 21.349999999999998 64-65 22.5625 28.749999999999996 27.200000000000003 21.4875 66-67 23.3875 27.8625 27.0875 21.6625 68-69 23.5625 26.5125 27.6875 22.237499999999997 70-71 22.85 27.55 27.6125 21.987499999999997 72-73 22.5625 28.725 26.200000000000003 22.5125 74-75 21.4875 28.525 27.35 22.6375 76-77 23.2125 27.437499999999996 27.8625 21.4875 78-79 23.0375 27.6875 27.712500000000002 21.5625 80-81 23.05 28.599999999999998 26.950000000000003 21.4 82-83 23.875 27.975 27.224999999999998 20.925 84-85 22.112499999999997 28.349999999999998 27.487499999999997 22.05 86-87 23.0125 27.9125 27.125 21.95 88-89 23.4875 27.737499999999997 26.787499999999998 21.987499999999997 90-91 22.875 28.5625 27.650000000000002 20.9125 92-93 23.150000000000002 28.225 26.8375 21.7875 94-95 24.224999999999998 28.075 26.2625 21.4375 96-97 22.875 28.287499999999998 27.275 21.5625 98-99 24.15 28.5625 26.237500000000004 21.05 100-101 24.025 28.175 26.575 21.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 2.0 25 1.5 26 3.0 27 3.0 28 3.5 29 5.5 30 10.5 31 14.5 32 18.0 33 31.0 34 42.5 35 57.5 36 77.0 37 105.0 38 138.0 39 170.5 40 202.0 41 226.5 42 239.5 43 242.5 44 277.0 45 281.0 46 254.0 47 242.0 48 234.5 49 223.5 50 178.5 51 138.5 52 114.5 53 94.5 54 82.0 55 73.5 56 52.5 57 35.0 58 29.0 59 23.0 60 22.0 61 18.0 62 9.0 63 3.5 64 3.5 65 3.5 66 4.5 67 2.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.5249999999999999 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825232 spots for ERR1864412.sra Written 825232 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra Read 825214 spots for ERR1864412.sra Written 825214 spots for ERR1864412.sra SRR ids: ['ERR1864412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xswui9s3 ERR1864412.sra spots: 16504298 blocks: [[1, 825214], [825215, 1650428], [1650429, 2475642], [2475643, 3300856], [3300857, 4126070], [4126071, 4951284], [4951285, 5776498], [5776499, 6601712], [6601713, 7426926], [7426927, 8252140], [8252141, 9077354], [9077355, 9902568], [9902569, 10727782], [10727783, 11552996], [11552997, 12378210], [12378211, 13203424], [13203425, 14028638], [14028639, 14853852], [14853853, 15679066], [15679067, 16504298]] ERR1864412 file size 3959316 ERR1864412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864412 ERR1864412_1.fastq ERR1864412_2.fastq Input file: ERR1864412_1.fastq Paired file: ERR1864412_2.fastq trimmed: ERR1864412-trimmed-pair1.fastq, ERR1864412-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:50:01 2025 >> started Thu Feb 13 00:57:04 2025 >> done (422.850s) 16504298 read pairs processed; of these: 231862 ( 1.40%) short read pairs filtered out after trimming by size control 247587 ( 1.50%) empty read pairs filtered out after trimming by size control 16024849 (97.10%) read pairs available; of these: 3755508 (23.44%) trimmed read pairs available after processing 12269341 (76.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 108 0.00% 19 283 0.00% 20 346 0.00% 21 525 0.00% 22 647 0.00% 23 834 0.01% 24 1038 0.01% 25 1199 0.01% 26 1378 0.01% 27 1693 0.01% 28 1997 0.01% 29 2185 0.01% 30 2526 0.02% 31 2826 0.02% 32 3142 0.02% 33 3516 0.02% 34 3802 0.02% 35 4176 0.03% 36 4459 0.03% 37 4894 0.03% 38 5215 0.03% 39 5856 0.04% 40 6081 0.04% 41 6519 0.04% 42 6743 0.04% 43 7188 0.04% 44 7602 0.05% 45 7940 0.05% 46 8407 0.05% 47 8792 0.05% 48 9117 0.06% 49 9703 0.06% 50 10108 0.06% 51 10390 0.06% 52 10966 0.07% 53 11551 0.07% 54 12133 0.08% 55 12572 0.08% 56 13487 0.08% 57 13986 0.09% 58 15065 0.09% 59 18504 0.12% 60 21763 0.14% 61 22731 0.14% 62 23016 0.14% 63 24693 0.15% 64 24796 0.15% 65 25855 0.16% 66 27347 0.17% 67 28236 0.18% 68 29380 0.18% 69 30805 0.19% 70 32087 0.20% 71 33078 0.21% 72 35056 0.22% 73 36476 0.23% 74 37556 0.23% 75 38450 0.24% 76 39006 0.24% 77 40793 0.25% 78 43607 0.27% 79 45775 0.29% 80 48439 0.30% 81 50097 0.31% 82 53407 0.33% 83 55712 0.35% 84 58565 0.37% 85 62612 0.39% 86 66708 0.42% 87 69622 0.43% 88 70865 0.44% 89 75888 0.47% 90 83570 0.52% 91 91808 0.57% 92 101098 0.63% 93 112910 0.70% 94 127606 0.80% 95 149111 0.93% 96 175711 1.10% 97 215676 1.35% 98 280576 1.75% 99 377917 2.36% 100 527605 3.29% 101 12269341 76.56% 16024849 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=25 prefix-density=0.25 prefix-fanout=2.6 sequence=AATGGCAGGAGAGGTGGATTTGATTGGAGTGAAACGCCCAGTAGTTGTGATAGGTGTGCCATGGAAGGATGATTTGTGATCCAAGAAAGAGGATTTGAGGTTTATAGATAGAGAGGAGGTAAGGGTAGAGGCCATGGCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=67.69 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=13.2 sequence=TCATCTTCATCATTGACTTCCGACACTGACTTCTCGGATTCCTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=219.33 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.9 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864412 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:17:58 Started mapping on | Feb 13 01:17:58 Finished on | Feb 13 01:20:01 Mapping speed, Million of reads per hour | 469.02 Number of input reads | 16024849 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15494040 Uniquely mapped reads % | 96.69% Average mapped length | 195.46 Number of splices: Total | 9261350 Number of splices: Annotated (sjdb) | 9111885 Number of splices: GT/AG | 9099051 Number of splices: GC/AG | 142335 Number of splices: AT/AC | 5864 Number of splices: Non-canonical | 14100 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 432764 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 17041 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 119388 119388 119388 N_multimapping 432764 432764 432764 N_noFeature 447415 15337136 516124 N_ambiguous 146808 640 58300 UnstrandedReadsAssigned:14899817 PositiveStrandReadsAssigned:156264 NegativeStrandReadsAssigned:14919616 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864412 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864412-trimmed-pair1.fastq ERR1864412-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,024,849 reads, 15,139,145 reads pseudoaligned [quant] estimated average fragment length: 161.734 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 ERR1864412.ke.tsv 34699 ERR1864412.se.tsv 87100 total ==> ERR1864412.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1857.27 1004 39.6631 Potri.005G024800.1.v4.1 1035 874.266 190 15.9455 Potri.004G059700.1.v4.1 961 800.266 40 3.66735 Potri.007G009000.2.v4.1 1416 1255.27 0 0 Potri.003G141000.2.v4.1 2943 2782.27 1290.03 34.0196 Potri.016G087400.1.v4.1 270 116.569 767 482.769 Potri.015G069301.1.v4.1 564 403.324 0 0 Potri.010G195200.1.v4.1 1773 1612.27 52.7934 2.40254 Potri.012G127500.1.v4.1 977 816.266 173 15.5504 ==> ERR1864412.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1158 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 9 ERR1864412 completed mapping pipeline successfully