Starting /dee2/code/volunteer_pipeline.sh ERR1864413 current disk space = 3050723151872 free memory = 1581030884 ERR1864413 SRAfilesize dc08fa6bf1954c11e5fda5de55817f8d ERR1864413.sra ERR1864413.sra file validated ERR1864413 is paired end ERR1864413 is conventional basespace ERR1864413 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.07875 34.0 31.0 34.0 30.0 34.0 2 31.70825 34.0 31.0 34.0 28.0 34.0 3 32.3185 34.0 31.0 34.0 30.0 34.0 4 35.8195 37.0 35.0 37.0 35.0 37.0 5 35.66775 37.0 35.0 37.0 35.0 37.0 6 35.547 37.0 35.0 37.0 35.0 37.0 7 35.64 37.0 35.0 37.0 35.0 37.0 8 35.687 37.0 36.0 37.0 35.0 37.0 9 37.4155 39.0 38.0 39.0 35.0 39.0 10-11 37.372 39.0 38.0 39.0 35.0 39.0 12-13 37.167125 39.0 37.5 39.0 33.5 39.0 14-15 38.724875 41.0 39.0 41.0 35.0 41.0 16-17 38.648375 41.0 38.5 41.0 34.0 41.0 18-19 38.60725 41.0 38.5 41.0 34.0 41.0 20-21 38.455125 41.0 39.0 41.0 34.0 41.0 22-23 38.48225 40.0 39.0 41.0 34.0 41.0 24-25 38.3685 40.0 38.0 41.0 34.0 41.0 26-27 38.342124999999996 40.0 38.0 41.0 34.0 41.0 28-29 38.304874999999996 40.0 38.0 41.0 34.0 41.0 30-31 38.1665 40.0 38.0 41.0 33.5 41.0 32-33 38.082 40.0 38.0 41.0 33.5 41.0 34-35 37.790375 40.0 38.0 41.0 32.5 41.0 36-37 37.76375 40.0 38.0 41.0 33.0 41.0 38-39 37.711749999999995 40.0 38.0 41.0 32.5 41.0 40-41 37.482625 40.0 37.5 41.0 32.0 41.0 42-43 37.368125 40.0 37.5 41.0 31.5 41.0 44-45 37.25425 40.0 37.0 41.0 31.5 41.0 46-47 37.451375 40.0 37.0 41.0 32.0 41.0 48-49 37.372749999999996 40.0 37.0 41.0 32.0 41.0 50-51 37.2245 40.0 37.0 41.0 32.0 41.0 52-53 37.004125 40.0 36.0 41.0 31.0 41.0 54-55 36.76975 40.0 36.0 41.0 31.0 41.0 56-57 36.575625 39.5 36.0 41.0 30.5 41.0 58-59 36.3405 39.0 35.5 41.0 29.5 41.0 60-61 36.035875000000004 39.0 35.0 40.5 29.5 41.0 62-63 35.707125000000005 38.5 35.0 40.0 28.5 41.0 64-65 35.141625 38.0 34.0 40.0 28.0 41.0 66-67 34.937875 37.0 34.0 40.0 28.0 41.0 68-69 34.599625 37.0 34.0 39.5 27.5 41.0 70-71 34.11225 36.0 34.0 39.0 26.5 40.5 72-73 33.67975 36.0 33.5 38.5 26.0 40.0 74-75 33.188125 35.0 33.0 37.5 26.0 39.0 76-77 31.979375 34.5 31.5 36.0 25.0 39.0 78-79 32.151624999999996 35.0 32.0 36.0 25.0 38.5 80-81 32.015125 35.0 32.0 36.0 25.0 37.0 82-83 31.709125 35.0 32.0 35.5 24.5 37.0 84-85 31.422375000000002 35.0 32.0 35.0 24.0 36.5 86-87 31.194249999999997 34.0 32.0 35.0 23.5 36.0 88-89 30.954375 34.0 32.0 35.0 23.0 36.0 90-91 30.659875 34.0 31.5 35.0 21.0 35.0 92-93 30.4035 34.0 31.0 35.0 19.5 35.0 94-95 30.093875 34.0 31.0 35.0 17.5 35.0 96-97 29.832125 34.0 31.0 35.0 12.0 35.0 98-99 29.641125000000002 34.0 31.0 35.0 2.0 35.0 100-101 28.697875 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 9.0 4 3.0 5 4.0 6 3.0 7 7.0 8 4.0 9 8.0 10 5.0 11 6.0 12 11.0 13 10.0 14 13.0 15 14.0 16 6.0 17 13.0 18 17.0 19 11.0 20 17.0 21 13.0 22 8.0 23 13.0 24 20.0 25 26.0 26 30.0 27 39.0 28 35.0 29 45.0 30 70.0 31 77.0 32 87.0 33 149.0 34 183.0 35 299.0 36 470.0 37 925.0 38 1196.0 39 129.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.02898929224341 5.510577174196919 6.842517628623662 46.61791590493601 2 23.825 8.9 34.675 32.6 3 24.524524524524523 11.711711711711711 22.64764764764765 41.11611611611611 4 29.125 18.675 20.1 32.1 5 27.33183295823956 22.83070767691923 25.35633908477119 24.48112028007002 6 22.3 29.975 25.474999999999998 22.25 7 17.525 23.9 41.275 17.299999999999997 8 18.575 24.0 35.525 21.9 9 18.925 22.575 37.5 21.0 10-11 20.7125 32.324999999999996 27.450000000000003 19.5125 12-13 21.2875 24.7375 30.337500000000002 23.6375 14-15 20.724999999999998 26.900000000000002 29.9375 22.4375 16-17 21.087500000000002 27.0875 29.849999999999998 21.975 18-19 21.2625 26.775 28.449999999999996 23.5125 20-21 21.75 27.224999999999998 27.700000000000003 23.325000000000003 22-23 21.7375 27.500000000000004 27.9375 22.825 24-25 21.6 27.650000000000002 27.287499999999998 23.4625 26-27 21.0625 26.8625 27.675 24.4 28-29 22.05 27.1375 27.575 23.2375 30-31 20.9 27.3625 28.4125 23.325000000000003 32-33 21.5625 27.500000000000004 27.400000000000002 23.5375 34-35 22.2 26.087500000000002 28.825 22.8875 36-37 21.912499999999998 27.0 27.3 23.7875 38-39 22.8 26.4625 27.85 22.8875 40-41 21.8125 27.462500000000002 28.037499999999998 22.6875 42-43 21.5 27.237499999999997 28.3125 22.95 44-45 22.05 26.950000000000003 28.287499999999998 22.7125 46-47 22.900000000000002 27.0125 27.975 22.112499999999997 48-49 21.975 26.575 28.512500000000003 22.9375 50-51 21.762500000000003 26.650000000000002 27.725 23.8625 52-53 21.8304576144036 27.91947986996749 27.144286071517882 23.10577644411103 54-55 21.6875 27.250000000000004 27.762500000000003 23.3 56-57 21.987499999999997 27.175 27.462500000000002 23.375 58-59 21.987499999999997 27.1625 27.6625 23.1875 60-61 21.9625 28.1375 26.937499999999996 22.9625 62-63 22.037499999999998 26.9125 27.825 23.225 64-65 21.590198774846854 27.965995749468686 27.565945743217902 22.877859732466558 66-67 21.952744093011624 27.228403550443808 27.54094261782723 23.27790973871734 68-69 21.555388847211805 26.756689172293076 28.644661165291325 23.0432608152038 70-71 22.415301912739093 26.453306663332913 27.84098012251531 23.29041130141268 72-73 21.825 27.55 27.5125 23.1125 74-75 21.81522690336292 27.21590198774847 27.803475434429302 23.165395674459308 76-77 21.675 26.337500000000002 28.8375 23.150000000000002 78-79 22.2125 27.025 27.474999999999998 23.2875 80-81 22.4875 26.5125 27.725 23.275000000000002 82-83 22.825 26.937499999999996 27.700000000000003 22.537499999999998 84-85 22.6125 27.075 27.2625 23.05 86-87 22.4875 28.449999999999996 26.3625 22.7 88-89 22.037499999999998 28.599999999999998 26.775 22.5875 90-91 22.5125 27.1625 27.1375 23.1875 92-93 22.400000000000002 27.075 26.8125 23.7125 94-95 22.25 27.6375 26.6625 23.45 96-97 22.6875 26.787499999999998 27.025 23.5 98-99 22.4875 27.224999999999998 26.974999999999998 23.3125 100-101 21.875 27.650000000000002 28.1 22.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.0 26 3.0 27 3.0 28 4.0 29 6.0 30 9.0 31 10.5 32 12.0 33 21.0 34 36.0 35 50.0 36 59.5 37 85.0 38 107.5 39 122.0 40 150.5 41 177.5 42 218.0 43 249.0 44 259.0 45 274.0 46 274.5 47 268.0 48 248.5 49 212.0 50 206.0 51 194.5 52 150.5 53 119.5 54 97.5 55 85.0 56 74.0 57 54.5 58 38.0 59 23.0 60 22.0 61 23.5 62 14.5 63 9.5 64 6.5 65 3.0 66 1.5 67 1.0 68 3.5 69 4.0 70 1.0 71 0.0 72 1.0 73 1.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.1 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03967652261815 97.975 2 0.8339651250947688 1.6500000000000001 3 0.1263583522870862 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 1.0125 0.0 0.0 0.0 0.0 84-85 1.35 0.0 0.0 0.0 0.0 86-87 1.65 0.0 0.0 0.0 0.0 88-89 2.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864413 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864413_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2655 34.0 31.0 34.0 30.0 34.0 2 32.3665 34.0 31.0 34.0 30.0 34.0 3 32.3895 34.0 31.0 34.0 30.0 34.0 4 35.76125 37.0 37.0 37.0 35.0 37.0 5 35.741 37.0 37.0 37.0 35.0 37.0 6 35.79525 37.0 37.0 37.0 35.0 37.0 7 35.7265 37.0 36.0 37.0 35.0 37.0 8 35.697 37.0 36.0 37.0 35.0 37.0 9 37.44175 39.0 38.0 39.0 35.0 39.0 10-11 37.3475 39.0 38.0 39.0 34.5 39.0 12-13 37.248625000000004 39.0 38.0 39.0 34.5 39.0 14-15 38.609625 41.0 38.5 41.0 34.0 41.0 16-17 38.53775 41.0 38.5 41.0 34.0 41.0 18-19 38.528375 41.0 38.5 41.0 34.0 41.0 20-21 38.404125 40.5 38.0 41.0 34.0 41.0 22-23 38.41575 40.0 38.0 41.0 34.0 41.0 24-25 38.2235 40.0 38.0 41.0 33.0 41.0 26-27 38.203625 40.0 38.0 41.0 33.5 41.0 28-29 38.053375 40.0 38.0 41.0 33.0 41.0 30-31 38.119249999999994 40.0 38.0 41.0 33.5 41.0 32-33 37.849000000000004 40.0 38.0 41.0 32.5 41.0 34-35 37.920875 40.0 38.0 41.0 33.0 41.0 36-37 37.8155 40.0 38.0 41.0 33.0 41.0 38-39 37.72275 40.0 38.0 41.0 33.0 41.0 40-41 37.636375 40.0 38.0 41.0 32.5 41.0 42-43 37.50725 40.0 38.0 41.0 32.0 41.0 44-45 37.02275 40.0 37.0 41.0 30.5 41.0 46-47 36.703125 40.0 37.0 41.0 30.0 41.0 48-49 36.699875 40.0 36.5 41.0 30.0 41.0 50-51 36.481875 39.5 36.5 40.5 30.5 41.0 52-53 36.687375 39.5 37.0 40.5 30.5 41.0 54-55 36.681125 40.0 37.0 41.0 30.0 41.0 56-57 36.74925 40.0 36.5 41.0 30.5 41.0 58-59 36.62775 39.5 36.0 41.0 30.5 41.0 60-61 35.997875 39.0 35.0 41.0 28.5 41.0 62-63 35.961375000000004 39.0 35.0 41.0 29.0 41.0 64-65 35.63775 38.0 35.0 40.0 29.0 41.0 66-67 35.254374999999996 37.5 35.0 40.0 28.0 41.0 68-69 34.659000000000006 37.0 34.0 39.5 27.5 41.0 70-71 34.273625 36.5 34.0 39.0 26.5 41.0 72-73 33.930625 36.0 34.0 39.0 26.5 40.0 74-75 33.36775 35.0 34.0 37.5 26.0 39.0 76-77 32.8825 35.0 33.5 37.0 26.0 39.0 78-79 32.371625 35.0 33.0 36.5 25.5 38.5 80-81 31.984375 35.0 32.5 36.0 24.5 37.0 82-83 31.285625 35.0 31.5 35.5 21.5 37.0 84-85 31.150875 35.0 32.0 35.0 20.5 36.5 86-87 31.017875 35.0 32.0 35.0 20.5 36.0 88-89 30.711624999999998 35.0 31.5 35.0 19.5 36.0 90-91 30.545 34.0 31.0 35.0 19.0 35.5 92-93 30.296875 34.0 31.0 35.0 17.0 35.0 94-95 29.975375 34.0 31.0 35.0 9.5 35.0 96-97 29.653 34.0 31.0 35.0 4.5 35.0 98-99 29.15 34.0 30.0 35.0 2.0 35.0 100-101 28.036875000000002 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 5.0 5 5.0 6 8.0 7 2.0 8 6.0 9 8.0 10 4.0 11 7.0 12 11.0 13 14.0 14 11.0 15 18.0 16 19.0 17 17.0 18 11.0 19 16.0 20 14.0 21 15.0 22 18.0 23 22.0 24 18.0 25 33.0 26 34.0 27 43.0 28 26.0 29 44.0 30 61.0 31 95.0 32 92.0 33 138.0 34 195.0 35 244.0 36 440.0 37 952.0 38 1192.0 39 148.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.275000000000002 16.375 15.0 38.35 2 24.975 24.575 33.45 17.0 3 20.175 27.725 29.175 22.925 4 22.25 32.875 22.425 22.45 5 25.324999999999996 34.325 23.05 17.299999999999997 6 19.950000000000003 37.35 23.25 19.45 7 18.8 21.45 38.35 21.4 8 21.175 23.95 29.675 25.2 9 21.4 24.375 30.775000000000002 23.45 10-11 22.825 32.737500000000004 23.2875 21.15 12-13 23.3625 25.474999999999998 26.8 24.3625 14-15 21.675 28.325 27.462500000000002 22.537499999999998 16-17 22.4875 28.025 27.212500000000002 22.275 18-19 22.525000000000002 27.750000000000004 27.4125 22.3125 20-21 22.75 28.050000000000004 27.212500000000002 21.987499999999997 22-23 22.3625 27.700000000000003 27.187499999999996 22.75 24-25 22.175 28.1375 27.9125 21.775 26-27 22.537499999999998 28.3375 27.287499999999998 21.837500000000002 28-29 22.575 28.012500000000003 27.462500000000002 21.95 30-31 22.400000000000002 28.249999999999996 27.1625 22.1875 32-33 22.35 28.549999999999997 27.5125 21.587500000000002 34-35 23.35 27.6375 26.5875 22.425 36-37 22.875 28.549999999999997 27.3 21.275 38-39 23.575 27.575 26.737499999999997 22.112499999999997 40-41 22.875 27.750000000000004 27.237499999999997 22.1375 42-43 23.5875 27.650000000000002 27.2625 21.5 44-45 22.35 27.325 27.6 22.725 46-47 22.237499999999997 27.287499999999998 27.6625 22.8125 48-49 22.7 27.825 27.625 21.85 50-51 23.6625 28.1875 26.474999999999998 21.675 52-53 23.375 27.212500000000002 26.8125 22.6 54-55 22.275 27.275 27.950000000000003 22.5 56-57 22.525000000000002 27.750000000000004 26.650000000000002 23.075000000000003 58-59 22.775000000000002 28.025 27.0125 22.1875 60-61 23.5875 26.55 27.474999999999998 22.3875 62-63 23.0625 27.5875 26.887499999999996 22.4625 64-65 22.575 28.425 26.4625 22.537499999999998 66-67 22.8625 28.012500000000003 27.075 22.05 68-69 22.8375 28.462500000000002 26.525 22.175 70-71 23.1875 27.962500000000002 25.825 23.025000000000002 72-73 23.325000000000003 27.187499999999996 26.875 22.6125 74-75 22.7125 28.6375 26.7625 21.8875 76-77 23.375 26.900000000000002 26.974999999999998 22.75 78-79 23.5 28.375 26.5875 21.5375 80-81 24.212500000000002 27.675 26.7125 21.4 82-83 23.150000000000002 28.537499999999998 25.775 22.537499999999998 84-85 23.45 28.287499999999998 26.5375 21.725 86-87 22.9625 28.962500000000002 26.275 21.8 88-89 24.224999999999998 27.800000000000004 26.0625 21.912499999999998 90-91 23.3875 28.212500000000002 26.6125 21.7875 92-93 23.1375 28.3875 26.35 22.125 94-95 24.2625 28.6125 25.525 21.6 96-97 24.175 27.450000000000003 26.125 22.25 98-99 24.05 28.000000000000004 26.3125 21.637500000000003 100-101 24.4 28.9 25.025 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 2.0 26 6.0 27 5.5 28 4.0 29 5.0 30 6.5 31 11.0 32 16.0 33 23.0 34 38.5 35 51.0 36 68.0 37 96.0 38 115.0 39 134.0 40 167.0 41 200.0 42 227.5 43 236.0 44 260.5 45 291.5 46 281.0 47 269.5 48 252.0 49 229.5 50 196.0 51 148.5 52 128.0 53 111.0 54 90.5 55 83.5 56 66.0 57 49.5 58 38.5 59 22.5 60 16.0 61 15.5 62 11.5 63 9.0 64 5.5 65 1.5 66 2.0 67 1.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.3375 0.0 0.0 0.0 0.0 86-87 1.625 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945556 spots for ERR1864413.sra Written 945556 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra Read 945550 spots for ERR1864413.sra Written 945550 spots for ERR1864413.sra SRR ids: ['ERR1864413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xbakkg0l ERR1864413.sra spots: 18911006 blocks: [[1, 945550], [945551, 1891100], [1891101, 2836650], [2836651, 3782200], [3782201, 4727750], [4727751, 5673300], [5673301, 6618850], [6618851, 7564400], [7564401, 8509950], [8509951, 9455500], [9455501, 10401050], [10401051, 11346600], [11346601, 12292150], [12292151, 13237700], [13237701, 14183250], [14183251, 15128800], [15128801, 16074350], [16074351, 17019900], [17019901, 17965450], [17965451, 18911006]] ERR1864413 file size 4539841 ERR1864413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864413 ERR1864413_1.fastq ERR1864413_2.fastq Input file: ERR1864413_1.fastq Paired file: ERR1864413_2.fastq trimmed: ERR1864413-trimmed-pair1.fastq, ERR1864413-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:08:45 2025 >> started Thu Feb 13 01:15:11 2025 >> done (385.834s) 18911006 read pairs processed; of these: 256465 ( 1.36%) short read pairs filtered out after trimming by size control 278904 ( 1.47%) empty read pairs filtered out after trimming by size control 18375637 (97.17%) read pairs available; of these: 4712164 (25.64%) trimmed read pairs available after processing 13663473 (74.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 111 0.00% 19 281 0.00% 20 456 0.00% 21 585 0.00% 22 819 0.00% 23 993 0.01% 24 1201 0.01% 25 1430 0.01% 26 1610 0.01% 27 1994 0.01% 28 2255 0.01% 29 2642 0.01% 30 2967 0.02% 31 3340 0.02% 32 3868 0.02% 33 4152 0.02% 34 4720 0.03% 35 5005 0.03% 36 5491 0.03% 37 5894 0.03% 38 6405 0.03% 39 6978 0.04% 40 7387 0.04% 41 7749 0.04% 42 8429 0.05% 43 8900 0.05% 44 9177 0.05% 45 9664 0.05% 46 10319 0.06% 47 10789 0.06% 48 11381 0.06% 49 11667 0.06% 50 12413 0.07% 51 12836 0.07% 52 13693 0.07% 53 14526 0.08% 54 15060 0.08% 55 15872 0.09% 56 16710 0.09% 57 17852 0.10% 58 18684 0.10% 59 22586 0.12% 60 26425 0.14% 61 27419 0.15% 62 28018 0.15% 63 29360 0.16% 64 30276 0.16% 65 32009 0.17% 66 33425 0.18% 67 34775 0.19% 68 36474 0.20% 69 37957 0.21% 70 39566 0.22% 71 41303 0.22% 72 43424 0.24% 73 45420 0.25% 74 47451 0.26% 75 48665 0.26% 76 50259 0.27% 77 52430 0.29% 78 55285 0.30% 79 58755 0.32% 80 62650 0.34% 81 64964 0.35% 82 69085 0.38% 83 72467 0.39% 84 76721 0.42% 85 81988 0.45% 86 87152 0.47% 87 90286 0.49% 88 93897 0.51% 89 99860 0.54% 90 108958 0.59% 91 119333 0.65% 92 131893 0.72% 93 147400 0.80% 94 164725 0.90% 95 189480 1.03% 96 222215 1.21% 97 271530 1.48% 98 347795 1.89% 99 461695 2.51% 100 630483 3.43% 101 13663473 74.36% 18375637 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=22 prefix-density=0.24 prefix-fanout=2.4 sequence=AATGGCAGGAGAGGTGGATTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=130.55 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.26 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=247.67 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=9.2 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864413 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:21:36 Started mapping on | Feb 13 01:21:36 Finished on | Feb 13 01:22:35 Mapping speed, Million of reads per hour | 1121.23 Number of input reads | 18375637 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 17739280 Uniquely mapped reads % | 96.54% Average mapped length | 194.88 Number of splices: Total | 10668313 Number of splices: Annotated (sjdb) | 10495112 Number of splices: GT/AG | 10480627 Number of splices: GC/AG | 164502 Number of splices: AT/AC | 7071 Number of splices: Non-canonical | 16113 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.59 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 530568 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 23718 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 126624 126624 126624 N_multimapping 530568 530568 530568 N_noFeature 467000 17563653 547076 N_ambiguous 160848 657 64909 UnstrandedReadsAssigned:17111432 PositiveStrandReadsAssigned:174970 NegativeStrandReadsAssigned:17127295 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864413 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864413-trimmed-pair1.fastq ERR1864413-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,375,637 reads, 17,424,919 reads pseudoaligned [quant] estimated average fragment length: 150.685 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 ERR1864413.ke.tsv 34699 ERR1864413.se.tsv 87100 total ==> ERR1864413.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1868.31 1151 38.3976 Potri.005G024800.1.v4.1 1035 885.315 199 14.0099 Potri.004G059700.1.v4.1 961 811.315 33 2.53515 Potri.007G009000.2.v4.1 1416 1266.31 0 0 Potri.003G141000.2.v4.1 2943 2793.31 1381.51 30.8257 Potri.016G087400.1.v4.1 270 124.308 803 402.62 Potri.015G069301.1.v4.1 564 414.362 0 0 Potri.010G195200.1.v4.1 1773 1623.31 62 2.3805 Potri.012G127500.1.v4.1 977 827.315 253 19.0602 ==> ERR1864413.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1379 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 ERR1864413 completed mapping pipeline successfully