Starting /dee2/code/volunteer_pipeline.sh ERR1864414 current disk space = 3050732249088 free memory = 1578443896 ERR1864414 SRAfilesize a356b63a721b40457324bf07a20a17a6 ERR1864414.sra ERR1864414.sra file validated ERR1864414 is paired end ERR1864414 is conventional basespace ERR1864414 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864414_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.831 34.0 31.0 34.0 28.0 34.0 2 31.5625 34.0 31.0 34.0 28.0 34.0 3 32.0915 34.0 31.0 34.0 29.0 34.0 4 35.494 37.0 35.0 37.0 33.0 37.0 5 35.40525 37.0 35.0 37.0 33.0 37.0 6 35.29175 37.0 35.0 37.0 33.0 37.0 7 35.22925 37.0 35.0 37.0 33.0 37.0 8 35.2185 37.0 35.0 37.0 33.0 37.0 9 36.89775 39.0 37.0 39.0 33.0 39.0 10-11 36.919875000000005 39.0 37.5 39.0 33.5 39.0 12-13 36.870875 39.0 38.0 39.0 33.0 39.0 14-15 38.170500000000004 41.0 38.0 41.0 33.0 41.0 16-17 38.152249999999995 41.0 38.0 41.0 33.0 41.0 18-19 38.176249999999996 41.0 38.5 41.0 33.5 41.0 20-21 37.983625 40.0 38.0 41.0 33.0 41.0 22-23 37.805125000000004 40.0 38.0 41.0 33.0 41.0 24-25 37.73675 40.0 38.0 41.0 33.0 41.0 26-27 37.77525 40.0 38.0 41.0 33.0 41.0 28-29 37.708625 40.0 38.0 41.0 33.0 41.0 30-31 37.609375 40.0 38.0 41.0 32.5 41.0 32-33 37.4895 40.0 38.0 41.0 32.0 41.0 34-35 37.338125000000005 40.0 38.0 41.0 31.5 41.0 36-37 37.252750000000006 40.0 38.0 41.0 31.0 41.0 38-39 37.078625 40.0 38.0 41.0 31.0 41.0 40-41 36.973625 40.0 37.0 41.0 31.0 41.0 42-43 36.7905 40.0 37.0 41.0 30.0 41.0 44-45 36.721625 40.0 37.0 41.0 30.0 41.0 46-47 36.8465 40.0 37.0 41.0 30.5 41.0 48-49 36.858625 40.0 37.0 41.0 30.5 41.0 50-51 36.699 40.0 37.0 41.0 31.0 41.0 52-53 36.4395 40.0 36.5 41.0 29.5 41.0 54-55 36.308375 40.0 36.0 41.0 30.0 41.0 56-57 36.090875 39.0 36.0 41.0 29.0 41.0 58-59 35.878625 39.0 35.0 41.0 28.0 41.0 60-61 35.582125 39.0 35.0 40.5 28.0 41.0 62-63 35.2095 39.0 35.0 40.0 28.0 41.0 64-65 34.839375000000004 38.0 34.0 40.0 27.0 41.0 66-67 34.394625000000005 37.0 34.0 40.0 26.0 41.0 68-69 34.178375 37.0 34.0 39.5 26.0 41.0 70-71 33.785125 36.0 34.0 39.0 26.0 41.0 72-73 33.3 36.0 33.0 39.0 25.5 40.0 74-75 32.747375 35.0 33.0 37.5 24.5 39.5 76-77 31.7785 34.5 31.5 36.0 23.5 39.0 78-79 31.947375 35.0 32.0 36.5 23.5 39.0 80-81 31.678375000000003 35.0 32.0 36.0 23.0 37.0 82-83 31.4185 35.0 32.0 36.0 23.0 37.0 84-85 31.106375 35.0 32.0 35.0 21.0 36.5 86-87 30.433374999999998 34.0 31.0 35.0 18.0 36.0 88-89 30.327624999999998 34.0 31.0 35.0 17.5 36.0 90-91 30.15275 34.0 31.0 35.0 15.5 35.5 92-93 29.83775 34.0 30.5 35.0 9.5 35.0 94-95 29.598999999999997 34.0 30.5 35.0 4.5 35.0 96-97 29.434125 34.0 30.5 35.0 2.0 35.0 98-99 29.012875 34.0 30.0 35.0 2.0 35.0 100-101 27.886375 33.5 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 47.0 3 22.0 4 11.0 5 13.0 6 7.0 7 6.0 8 4.0 9 9.0 10 8.0 11 6.0 12 9.0 13 13.0 14 8.0 15 10.0 16 14.0 17 13.0 18 8.0 19 8.0 20 12.0 21 19.0 22 22.0 23 21.0 24 23.0 25 27.0 26 19.0 27 33.0 28 39.0 29 49.0 30 63.0 31 80.0 32 87.0 33 154.0 34 169.0 35 281.0 36 456.0 37 922.0 38 1168.0 39 140.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.06532403821327 5.809450038729667 7.513555383423702 47.61167053963336 2 24.025 9.575 34.2 32.2 3 24.55 11.825 21.825 41.8 4 29.2 19.725 20.575 30.5 5 28.199999999999996 24.5 24.925 22.375 6 21.930482620655166 30.632658164541137 24.706176544136035 22.73068267066767 7 16.60415103775944 21.655413853463365 44.33608402100525 17.404351087771943 8 18.879719929982496 23.455863965991497 35.8589647411853 21.80545136284071 9 19.204801200300075 22.55563890972743 36.68417104276069 21.555388847211805 10-11 20.475297060662914 32.69543464665416 27.204502814258912 19.624765478424013 12-13 21.19089316987741 26.13209907430573 29.38453840380285 23.29246935201401 14-15 20.40280210157618 28.42131598699024 29.046785088816613 22.12909682261696 16-17 21.22842131598699 27.445584188141105 28.921691268451337 22.404303227420566 18-19 21.278458844133098 28.8591443582687 26.99524643482612 22.86715036277208 20-21 21.453590192644484 27.89592194145609 28.521391043282463 22.12909682261696 22-23 21.603702777082813 28.108581436077056 27.820865649236925 22.466850137603203 24-25 21.103327495621716 27.695771828871653 27.45809357017763 23.742807105328996 26-27 20.915686765073804 27.433074806104578 28.68401300975732 22.9672254190643 28-29 21.478608956717537 26.99524643482612 28.546409807355516 22.979734801100825 30-31 21.203402551913936 28.008506379784837 27.90843132349262 22.879659744808606 32-33 21.453590192644484 27.958468851638727 27.23292469352014 23.35501626219665 34-35 21.6260162601626 28.542839274546594 27.5797373358349 22.25140712945591 36-37 21.23827392120075 27.79237023139462 27.76735459662289 23.20200125078174 38-39 21.553665248936703 27.708281210908183 28.29622216662497 22.441831373530146 40-41 21.491118338754063 27.558168626469854 27.920940705529144 23.029772329246935 42-43 21.728796597448085 27.120340255191394 28.096072054040533 23.05479109331999 44-45 21.541155866900176 27.045283962972228 28.19614711033275 23.217413059794847 46-47 21.70377783337503 27.89592194145609 27.583187390542907 22.81711283462597 48-49 21.240930698023515 26.607455591693768 27.983487615711784 24.168126094570926 50-51 20.878158618964225 26.732549412059043 28.246184638478862 24.143107330497873 52-53 21.109997494362315 28.251064896016036 27.649711851666247 22.9892257579554 54-55 20.878158618964225 27.24543407555667 28.57142857142857 23.30497873405054 56-57 21.901188242651656 27.066916823014388 27.40462789243277 23.627267041901188 58-59 22.091568676507382 28.096072054040533 27.570678008506377 22.241681260945708 60-61 20.97823367525644 27.583187390542907 27.983487615711784 23.455091318488865 62-63 21.765220652581576 27.090886360795096 27.778472309038634 23.365420677584698 64-65 22.037499999999998 27.737499999999997 27.575 22.650000000000002 66-67 21.762500000000003 28.249999999999996 27.462500000000002 22.525000000000002 68-69 21.36784196049012 27.631907976994246 27.581895473868467 23.418354588647162 70-71 20.7 27.1 28.1875 24.0125 72-73 21.0625 26.9625 28.012500000000003 23.962500000000002 74-75 21.002625328166022 27.040880110013752 28.9536192024003 23.002875359419928 76-77 21.7402175271909 26.92836604575572 28.778597324665583 22.552819102387797 78-79 22.74318579644911 27.59439859964991 26.60665166291573 23.055763940985248 80-81 20.9875 28.299999999999997 27.275 23.4375 82-83 21.625 28.349999999999998 27.6125 22.412499999999998 84-85 22.1 27.400000000000002 26.937499999999996 23.5625 86-87 21.5625 26.937499999999996 28.499999999999996 23.0 88-89 21.95 27.462500000000002 26.775 23.8125 90-91 22.025 27.925 26.937499999999996 23.1125 92-93 22.787499999999998 27.212500000000002 27.8625 22.1375 94-95 22.1 28.512500000000003 26.85 22.537499999999998 96-97 21.7875 28.625 27.05 22.537499999999998 98-99 21.525 27.5125 27.437499999999996 23.525 100-101 21.825 28.7375 27.0875 22.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.5 25 3.0 26 3.5 27 4.0 28 6.0 29 8.5 30 10.5 31 13.0 32 18.0 33 26.5 34 42.0 35 52.5 36 68.5 37 94.5 38 110.5 39 132.0 40 169.0 41 199.5 42 222.0 43 246.0 44 249.0 45 277.5 46 295.5 47 263.0 48 249.0 49 230.0 50 193.5 51 163.5 52 135.0 53 116.5 54 91.5 55 64.5 56 55.0 57 50.0 58 38.0 59 25.5 60 19.0 61 12.0 62 7.0 63 6.0 64 7.5 65 4.0 66 2.5 67 2.5 68 0.5 69 1.0 70 2.0 71 1.0 72 1.0 73 1.5 74 2.0 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.0625 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.0625 36-37 0.0625 38-39 0.075 40-41 0.075 42-43 0.075 44-45 0.075 46-47 0.075 48-49 0.075 50-51 0.075 52-53 0.22499999999999998 54-55 0.075 56-57 0.0625 58-59 0.075 60-61 0.075 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06494819307557 98.0 2 0.7834217841799342 1.55 3 0.1516300227445034 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.5375000000000001 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 1.075 0.0 0.0 0.0 0.0 86-87 1.5 0.0 0.0 0.0 0.0 88-89 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 25 0.0015247238 37.985 40-41 >>END_MODULE ERR1864414 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864414_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01 34.0 31.0 34.0 30.0 34.0 2 32.008 34.0 31.0 34.0 30.0 34.0 3 32.171 34.0 31.0 34.0 30.0 34.0 4 35.3525 37.0 35.0 37.0 33.0 37.0 5 35.42775 37.0 35.0 37.0 33.0 37.0 6 35.4215 37.0 36.0 37.0 33.0 37.0 7 35.494 37.0 36.0 37.0 33.0 37.0 8 35.422 37.0 36.0 37.0 33.0 37.0 9 37.00075 39.0 38.0 39.0 34.0 39.0 10-11 36.9645 39.0 38.0 39.0 33.0 39.0 12-13 36.945625 39.0 37.0 39.0 33.0 39.0 14-15 38.2555 41.0 38.0 41.0 33.0 41.0 16-17 38.227625 41.0 38.0 41.0 33.0 41.0 18-19 38.212875 41.0 38.0 41.0 33.5 41.0 20-21 38.1025 40.5 38.0 41.0 33.0 41.0 22-23 37.900625 40.0 38.0 41.0 32.5 41.0 24-25 37.917375 40.0 38.0 41.0 32.5 41.0 26-27 37.75725 40.0 38.0 41.0 32.0 41.0 28-29 37.649375000000006 40.0 38.0 41.0 32.0 41.0 30-31 37.58625000000001 40.0 38.0 41.0 32.0 41.0 32-33 37.4745 40.0 38.0 41.0 32.0 41.0 34-35 37.451875 40.0 38.0 41.0 31.5 41.0 36-37 37.181875000000005 40.0 37.5 41.0 30.5 41.0 38-39 37.007875 40.0 37.5 41.0 30.0 41.0 40-41 36.99675 40.0 37.0 41.0 30.0 41.0 42-43 36.91625 40.0 37.0 41.0 30.0 41.0 44-45 36.699875 40.0 37.0 41.0 30.0 41.0 46-47 36.474000000000004 40.0 37.0 41.0 30.0 41.0 48-49 36.28025 40.0 36.5 41.0 29.5 41.0 50-51 35.92075 39.0 36.0 40.5 28.5 40.5 52-53 36.221625 39.5 36.5 40.5 29.5 41.0 54-55 36.585625 40.0 37.0 41.0 30.0 41.0 56-57 36.47325 40.0 36.5 41.0 29.5 41.0 58-59 36.1465 39.5 36.0 41.0 28.5 41.0 60-61 35.832875 39.0 35.5 41.0 28.0 41.0 62-63 35.519375 39.0 35.0 41.0 28.0 41.0 64-65 35.294 38.0 35.0 40.5 28.0 41.0 66-67 34.916875000000005 37.5 35.0 40.0 27.5 41.0 68-69 34.3905 37.0 34.0 39.5 26.0 41.0 70-71 33.99425 36.5 34.0 39.0 26.0 41.0 72-73 33.415499999999994 36.0 34.0 39.0 26.0 40.0 74-75 32.946625 35.0 33.0 37.5 25.0 39.0 76-77 32.196124999999995 35.0 32.5 37.0 22.0 39.0 78-79 31.849249999999998 35.0 32.0 36.5 22.0 38.5 80-81 31.59575 35.0 32.0 36.0 22.5 37.0 82-83 31.3595 35.0 32.5 35.5 20.5 37.0 84-85 30.835875 35.0 31.5 35.0 18.5 36.5 86-87 30.253749999999997 34.5 31.0 35.0 11.0 36.0 88-89 29.863625 34.0 30.5 35.0 7.0 36.0 90-91 29.841625 34.0 31.0 35.0 7.0 35.5 92-93 29.58925 34.0 30.0 35.0 2.0 35.0 94-95 29.380125 34.0 30.5 35.0 2.0 35.0 96-97 28.551375 34.0 29.5 35.0 2.0 35.0 98-99 28.2045 34.0 29.0 35.0 2.0 35.0 100-101 27.12325 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 5.0 4 8.0 5 7.0 6 12.0 7 5.0 8 8.0 9 11.0 10 9.0 11 18.0 12 9.0 13 17.0 14 9.0 15 13.0 16 11.0 17 16.0 18 16.0 19 25.0 20 17.0 21 17.0 22 21.0 23 30.0 24 21.0 25 33.0 26 34.0 27 44.0 28 33.0 29 49.0 30 56.0 31 82.0 32 82.0 33 134.0 34 198.0 35 265.0 36 440.0 37 909.0 38 1153.0 39 154.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.575000000000003 18.325 12.875 38.224999999999994 2 24.025 24.775 34.375 16.825000000000003 3 18.7 28.075 29.475 23.75 4 22.686343171585793 32.3911955977989 24.012006003001503 20.910455227613806 5 24.05 35.825 23.150000000000002 16.975 6 19.175 38.025 24.474999999999998 18.325 7 19.925 20.474999999999998 38.5 21.099999999999998 8 20.9 25.224999999999998 28.000000000000004 25.874999999999996 9 20.775 25.525 30.075000000000003 23.625 10-11 22.4875 32.35 23.962500000000002 21.2 12-13 22.892169126845133 25.344008006004504 28.183637728296222 23.58018513885414 14-15 22.109482650632593 27.019917324314168 28.698484279093073 22.172115745960166 16-17 22.873936968484244 27.651325662831418 27.163581790895446 22.311155577788895 18-19 22.30278784848106 27.740967620952617 27.778472309038634 22.177772221527693 20-21 22.8875 28.287499999999998 27.675 21.15 22-23 22.4875 27.6875 27.55 22.275 24-25 22.537499999999998 29.1375 26.5125 21.8125 26-27 22.8625 28.962500000000002 27.1125 21.0625 28-29 22.6375 28.225 27.3 21.837500000000002 30-31 22.1375 27.625 28.65 21.587500000000002 32-33 22.112499999999997 28.575 27.787499999999998 21.525 34-35 22.875 28.225 27.6125 21.2875 36-37 22.8 28.15 26.974999999999998 22.075 38-39 22.7625 28.449999999999996 27.075 21.712500000000002 40-41 22.162499999999998 28.3125 27.5875 21.9375 42-43 21.8625 29.075 26.9125 22.15 44-45 23.7375 27.950000000000003 27.0625 21.25 46-47 22.8625 28.000000000000004 27.437499999999996 21.7 48-49 22.237499999999997 28.012500000000003 28.537499999999998 21.212500000000002 50-51 23.3625 28.849999999999998 26.4125 21.375 52-53 24.075 28.375 26.8375 20.7125 54-55 22.3875 28.799999999999997 26.525 22.287499999999998 56-57 22.05 28.125 27.650000000000002 22.175 58-59 23.65 27.762500000000003 26.8625 21.725 60-61 23.0 28.212500000000002 27.487499999999997 21.3 62-63 22.7625 27.737499999999997 27.85 21.65 64-65 23.6125 28.249999999999996 26.8125 21.325 66-67 23.375 28.175 27.187499999999996 21.2625 68-69 23.8375 27.462500000000002 27.05 21.65 70-71 23.8625 28.5625 26.8625 20.7125 72-73 22.325 28.599999999999998 27.650000000000002 21.425 74-75 23.05 28.4375 26.6 21.912499999999998 76-77 24.087500000000002 26.8125 27.462500000000002 21.637500000000003 78-79 22.537499999999998 27.6625 27.9375 21.8625 80-81 22.075 28.499999999999996 28.025 21.4 82-83 23.6625 28.1625 26.174999999999997 22.0 84-85 23.2375 28.0875 27.6875 20.9875 86-87 23.5375 28.4 27.025 21.0375 88-89 24.5 27.3125 26.687499999999996 21.5 90-91 23.625 27.950000000000003 26.437500000000004 21.987499999999997 92-93 23.0625 29.175 26.687499999999996 21.075 94-95 24.224999999999998 27.4125 27.1 21.2625 96-97 24.275 28.0875 26.224999999999998 21.4125 98-99 23.3375 28.000000000000004 26.2625 22.400000000000002 100-101 24.087500000000002 27.700000000000003 27.35 20.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 1.5 24 0.5 25 3.0 26 5.0 27 4.5 28 4.5 29 8.0 30 11.0 31 15.5 32 22.5 33 30.5 34 43.0 35 57.5 36 80.0 37 100.5 38 120.5 39 157.0 40 195.5 41 224.5 42 238.0 43 239.5 44 261.5 45 278.5 46 272.5 47 259.0 48 239.5 49 211.0 50 181.0 51 157.5 52 126.0 53 100.5 54 84.5 55 67.5 56 57.5 57 41.5 58 23.0 59 19.0 60 15.5 61 8.5 62 6.0 63 6.0 64 3.0 65 2.0 66 4.0 67 4.0 68 1.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.075 14-15 0.21250000000000002 16-17 0.05 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.6625 0.0 0.0 0.0 0.0 82-83 0.8375 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.525 0.0 0.0 0.0 0.0 88-89 1.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 583692 spots for ERR1864414.sra Written 583692 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra Read 583675 spots for ERR1864414.sra Written 583675 spots for ERR1864414.sra SRR ids: ['ERR1864414.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__knk_jmj ERR1864414.sra spots: 11673517 blocks: [[1, 583675], [583676, 1167350], [1167351, 1751025], [1751026, 2334700], [2334701, 2918375], [2918376, 3502050], [3502051, 4085725], [4085726, 4669400], [4669401, 5253075], [5253076, 5836750], [5836751, 6420425], [6420426, 7004100], [7004101, 7587775], [7587776, 8171450], [8171451, 8755125], [8755126, 9338800], [9338801, 9922475], [9922476, 10506150], [10506151, 11089825], [11089826, 11673517]] ERR1864414 file size 2794079 ERR1864414 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864414 ERR1864414_1.fastq ERR1864414_2.fastq Input file: ERR1864414_1.fastq Paired file: ERR1864414_2.fastq trimmed: ERR1864414-trimmed-pair1.fastq, ERR1864414-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:26:56 2025 >> started Thu Feb 13 00:35:34 2025 >> done (518.013s) 11673517 read pairs processed; of these: 137189 ( 1.18%) short read pairs filtered out after trimming by size control 147379 ( 1.26%) empty read pairs filtered out after trimming by size control 11388949 (97.56%) read pairs available; of these: 2545636 (22.35%) trimmed read pairs available after processing 8843313 (77.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 79 0.00% 19 183 0.00% 20 244 0.00% 21 324 0.00% 22 344 0.00% 23 427 0.00% 24 548 0.00% 25 690 0.01% 26 850 0.01% 27 919 0.01% 28 1069 0.01% 29 1224 0.01% 30 1393 0.01% 31 1542 0.01% 32 1747 0.02% 33 2032 0.02% 34 2221 0.02% 35 2383 0.02% 36 2626 0.02% 37 2787 0.02% 38 3019 0.03% 39 3211 0.03% 40 3388 0.03% 41 3539 0.03% 42 3833 0.03% 43 4042 0.04% 44 4305 0.04% 45 4589 0.04% 46 4761 0.04% 47 5095 0.04% 48 5213 0.05% 49 5574 0.05% 50 5797 0.05% 51 6147 0.05% 52 6469 0.06% 53 6712 0.06% 54 6925 0.06% 55 7506 0.07% 56 7984 0.07% 57 8176 0.07% 58 8846 0.08% 59 11513 0.10% 60 13770 0.12% 61 14142 0.12% 62 14642 0.13% 63 15343 0.13% 64 15746 0.14% 65 16618 0.15% 66 17460 0.15% 67 18005 0.16% 68 18802 0.17% 69 19687 0.17% 70 20542 0.18% 71 21519 0.19% 72 22373 0.20% 73 23979 0.21% 74 25068 0.22% 75 25619 0.22% 76 25826 0.23% 77 27499 0.24% 78 29211 0.26% 79 31051 0.27% 80 33530 0.29% 81 34706 0.30% 82 36732 0.32% 83 39346 0.35% 84 42222 0.37% 85 44129 0.39% 86 47132 0.41% 87 49505 0.43% 88 51266 0.45% 89 54908 0.48% 90 60250 0.53% 91 66099 0.58% 92 72072 0.63% 93 80212 0.70% 94 89806 0.79% 95 103531 0.91% 96 120396 1.06% 97 147002 1.29% 98 188450 1.65% 99 241775 2.12% 100 375389 3.30% 101 8843313 77.65% 11388949 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=269.76 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=26.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=37 prefix-density=0.33 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=174.85 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=20.0 sequence=AGAAGAAGAAGAG ERR1864414 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 00:47:38 Started mapping on | Feb 13 00:47:49 Finished on | Feb 13 01:12:46 Mapping speed, Million of reads per hour | 27.39 Number of input reads | 11388949 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 11057844 Uniquely mapped reads % | 97.09% Average mapped length | 195.99 Number of splices: Total | 6978698 Number of splices: Annotated (sjdb) | 6877378 Number of splices: GT/AG | 6861858 Number of splices: GC/AG | 101773 Number of splices: AT/AC | 4381 Number of splices: Non-canonical | 10686 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274596 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 11723 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 70206 70206 70206 N_multimapping 274596 274596 274596 N_noFeature 187607 10916155 252064 N_ambiguous 121218 344 43783 UnstrandedReadsAssigned:10749019 PositiveStrandReadsAssigned:141345 NegativeStrandReadsAssigned:10761997 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864414 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864414-trimmed-pair1.fastq ERR1864414-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,388,949 reads, 10,925,821 reads pseudoaligned [quant] estimated average fragment length: 156.872 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 ERR1864414.ke.tsv 34699 ERR1864414.se.tsv 87100 total ==> ERR1864414.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1862.13 573 28.8623 Potri.005G024800.1.v4.1 1035 879.128 153 16.3239 Potri.004G059700.1.v4.1 961 805.128 17 1.98047 Potri.007G009000.2.v4.1 1416 1260.13 0 0 Potri.003G141000.2.v4.1 2943 2787.13 848.41 28.5518 Potri.016G087400.1.v4.1 270 120.716 622 483.294 Potri.015G069301.1.v4.1 564 408.174 0 0 Potri.010G195200.1.v4.1 1773 1617.13 23 1.33404 Potri.012G127500.1.v4.1 977 821.128 126 14.3928 ==> ERR1864414.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 593 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 191 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864414 completed mapping pipeline successfully