Starting /dee2/code/volunteer_pipeline.sh ERR1864415 current disk space = 3050992316416 free memory = 1574894032 ERR1864415 SRAfilesize 1328cd6c3bb888017a634617caebe21d ERR1864415.sra ERR1864415.sra file validated ERR1864415 is paired end ERR1864415 is conventional basespace ERR1864415 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8315 34.0 31.0 34.0 27.0 34.0 2 31.57275 34.0 31.0 34.0 28.0 34.0 3 32.0725 34.0 31.0 34.0 30.0 34.0 4 35.50775 37.0 35.0 37.0 33.0 37.0 5 35.436 37.0 35.0 37.0 33.0 37.0 6 35.42275 37.0 36.0 37.0 33.0 37.0 7 35.3155 37.0 35.0 37.0 33.0 37.0 8 35.312 37.0 35.0 37.0 33.0 37.0 9 37.08625 39.0 38.0 39.0 34.0 39.0 10-11 37.057500000000005 39.0 38.0 39.0 34.0 39.0 12-13 37.02625 39.0 38.0 39.0 33.0 39.0 14-15 38.414 41.0 39.0 41.0 34.0 41.0 16-17 38.269375 41.0 38.0 41.0 33.5 41.0 18-19 38.310375 41.0 39.0 41.0 34.0 41.0 20-21 38.204875 41.0 39.0 41.0 34.0 41.0 22-23 37.963875 40.0 38.0 41.0 32.5 41.0 24-25 37.9355 40.5 38.0 41.0 33.5 41.0 26-27 37.9345 40.5 38.0 41.0 33.0 41.0 28-29 37.712875 40.0 38.0 41.0 32.5 41.0 30-31 37.6255 40.0 38.0 41.0 32.5 41.0 32-33 37.641625000000005 40.0 38.0 41.0 33.0 41.0 34-35 37.506249999999994 40.0 38.0 41.0 32.0 41.0 36-37 37.34525 40.0 38.0 41.0 32.0 41.0 38-39 37.22275 40.0 38.0 41.0 32.0 41.0 40-41 37.231375 40.0 38.0 41.0 31.0 41.0 42-43 37.057874999999996 40.0 38.0 41.0 31.0 41.0 44-45 37.1325 40.0 37.5 41.0 31.5 41.0 46-47 37.144625 40.0 38.0 41.0 31.0 41.0 48-49 37.03725 40.0 37.5 41.0 31.0 41.0 50-51 36.9135 40.0 37.0 41.0 31.0 41.0 52-53 36.75 40.0 37.0 41.0 30.0 41.0 54-55 36.55625 40.0 37.0 41.0 29.5 41.0 56-57 36.399375 40.0 36.0 41.0 29.5 41.0 58-59 36.221125 39.5 36.0 41.0 29.5 41.0 60-61 35.94475 39.0 35.5 41.0 28.5 41.0 62-63 35.609750000000005 39.0 35.0 40.5 28.0 41.0 64-65 35.198375 38.0 35.0 40.0 27.5 41.0 66-67 34.835375 37.5 34.0 40.0 27.0 41.0 68-69 34.57875 37.0 34.0 40.0 27.0 41.0 70-71 34.163375 36.5 34.0 39.0 26.0 41.0 72-73 33.748625000000004 36.0 34.0 39.0 26.0 40.0 74-75 33.19075 35.5 33.0 38.0 26.0 39.5 76-77 32.07 34.5 31.5 36.5 24.5 39.0 78-79 32.345749999999995 35.0 33.0 37.0 25.5 39.0 80-81 32.055125000000004 35.0 33.0 36.0 25.0 37.5 82-83 31.826625 35.0 33.0 36.0 25.0 37.0 84-85 31.445375 35.0 32.0 35.5 23.0 37.0 86-87 30.736125 34.0 31.5 35.0 18.0 36.0 88-89 30.711 34.0 31.5 35.0 20.0 36.0 90-91 30.613750000000003 34.0 31.5 35.0 19.0 35.5 92-93 30.304625 34.0 31.0 35.0 19.0 35.0 94-95 29.963 34.0 31.0 35.0 12.0 35.0 96-97 29.694625 34.0 31.0 35.0 2.0 35.0 98-99 29.451999999999998 34.0 31.0 35.0 2.0 35.0 100-101 28.504624999999997 33.5 29.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 51.0 3 11.0 4 6.0 5 17.0 6 11.0 7 6.0 8 6.0 9 3.0 10 7.0 11 10.0 12 8.0 13 7.0 14 10.0 15 11.0 16 8.0 17 10.0 18 18.0 19 8.0 20 9.0 21 15.0 22 13.0 23 18.0 24 14.0 25 25.0 26 31.0 27 36.0 28 35.0 29 37.0 30 69.0 31 78.0 32 79.0 33 122.0 34 158.0 35 267.0 36 435.0 37 880.0 38 1298.0 39 173.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.53092783505154 10.154639175257731 8.762886597938143 47.551546391752574 2 22.400000000000002 14.424999999999999 37.35 25.825 3 21.0 18.175 24.7 36.125 4 23.25 27.700000000000003 20.75 28.299999999999997 5 22.136068034017008 32.51625812906453 24.437218609304654 20.910455227613806 6 18.66866866866867 33.50850850850851 25.575575575575577 22.24724724724725 7 13.710282712034024 26.54490868151113 41.18088566424819 18.563922942206652 8 16.816816816816818 25.825825825825827 33.58358358358358 23.773773773773772 9 16.833416708354175 22.811405702851424 35.842921460730366 24.512256128064035 10-11 19.54699036415968 33.46264547616068 25.303466399699666 21.686897759979978 12-13 19.987484355444305 26.020025031289112 29.21151439299124 24.780976220275345 14-15 19.396821424102114 28.019021399073957 28.769866099361778 23.814291077462144 16-17 19.892338507761643 28.680520781171758 27.478718077115673 23.948422633950926 18-19 19.424280350438046 28.67334167709637 28.48560700876095 23.416770963704632 20-21 19.524405506883603 28.09762202753442 27.909887359198997 24.46808510638298 22-23 20.195317390759985 28.871916864905472 27.544760235382498 23.388005508952048 24-25 19.777193641256726 27.813243209412942 28.514207034672673 23.895356114657655 26-27 19.451746150957565 27.90086368757041 28.02603579922393 24.62135436224809 28-29 19.714607585429967 28.614344723995494 28.439103767680564 23.23194392289398 30-31 19.90485728592889 28.55533299949925 27.641462193289932 23.898347521281924 32-33 19.68957316309926 28.58931030166479 27.863312054074353 23.857804481161597 34-35 19.096483543986984 29.02014766612439 28.119134025779 23.764234764109624 36-37 20.2377972465582 28.423028785982478 27.334167709637047 24.005006257822277 38-39 20.42808862185505 27.825760420578295 27.975966954562526 23.77018400300413 40-41 19.474342928660825 28.74843554443054 28.6107634543179 23.166458072590736 42-43 19.379068602904358 29.68202303455183 26.790185277916873 24.14872308462694 44-45 20.658570176536873 28.208338550143985 27.26931263302867 23.863778640290473 46-47 20.70865155878302 29.19744584950545 26.518091899336422 23.57581069237511 48-49 19.849812265331664 28.71088861076345 27.55944931163955 23.879849812265334 50-51 20.192789183775663 29.018527791687532 27.090635953930896 23.69804707060591 52-53 20.70953992729096 28.155948351510595 26.714303622915885 24.42020809828256 54-55 19.639504318437854 28.626861935160846 27.98848416572788 23.745149580673424 56-57 20.32032032032032 27.915415415415417 27.94044044044044 23.823823823823822 58-59 20.312891113892366 28.34793491864831 27.25907384230288 24.080100125156445 60-61 20.235264672756852 28.14416218245526 27.76873983231135 23.851833312476536 62-63 20.375 28.275 27.787499999999998 23.5625 64-65 21.1375 28.6625 28.175 22.025 66-67 19.875 28.749999999999996 28.287499999999998 23.0875 68-69 21.2625 27.6375 27.750000000000004 23.35 70-71 21.212500000000002 28.375 27.437499999999996 22.975 72-73 20.8625 28.6125 26.7625 23.7625 74-75 20.65 28.537499999999998 27.1625 23.65 76-77 20.849999999999998 28.4125 27.625 23.1125 78-79 19.637046307884855 28.473091364205256 27.672090112640802 24.217772215269086 80-81 20.38009502375594 28.49462365591398 27.506876719179797 23.618404601150285 82-83 20.667666916729182 28.66966741685421 27.406851712928233 23.25581395348837 84-85 20.5125 28.375 26.5 24.6125 86-87 20.5125 28.775000000000002 27.6 23.1125 88-89 21.625 28.7375 27.0 22.6375 90-91 20.962500000000002 29.1375 25.5375 24.3625 92-93 20.9875 28.675 27.0125 23.325000000000003 94-95 21.9375 28.95 26.387500000000003 22.725 96-97 21.987499999999997 29.4125 25.0625 23.5375 98-99 21.95 29.099999999999998 25.887500000000003 23.0625 100-101 21.8125 28.95 26.0 23.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 1.0 21 0.0 22 0.0 23 0.0 24 1.5 25 4.0 26 3.5 27 4.0 28 10.5 29 16.0 30 17.5 31 23.5 32 32.0 33 34.0 34 38.0 35 62.0 36 95.0 37 122.0 38 127.5 39 141.0 40 184.5 41 210.0 42 239.0 43 263.0 44 271.0 45 279.5 46 257.0 47 244.0 48 241.0 49 222.5 50 185.0 51 137.0 52 123.0 53 104.0 54 77.5 55 64.0 56 46.5 57 31.0 58 20.0 59 19.5 60 16.0 61 8.0 62 4.5 63 3.0 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.1 7 0.075 8 0.1 9 0.05 10-11 0.11249999999999999 12-13 0.125 14-15 0.11249999999999999 16-17 0.15 18-19 0.125 20-21 0.125 22-23 0.1625 24-25 0.13749999999999998 26-27 0.13749999999999998 28-29 0.13749999999999998 30-31 0.15 32-33 0.13749999999999998 34-35 0.11249999999999999 36-37 0.125 38-39 0.13749999999999998 40-41 0.125 42-43 0.15 44-45 0.1625 46-47 0.1625 48-49 0.125 50-51 0.15 52-53 0.2875 54-55 0.13749999999999998 56-57 0.1 58-59 0.125 60-61 0.11249999999999999 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.125 80-81 0.025 82-83 0.025 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39546599496222 98.65 2 0.5289672544080605 1.05 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.4125 0.0 0.0 0.0 0.0 66-67 0.6000000000000001 0.0 0.0 0.0 0.0 68-69 0.7875 0.0 0.0 0.0 0.0 70-71 1.025 0.0 0.0 0.0 0.0 72-73 1.2125 0.0 0.0 0.0 0.0 74-75 1.4125 0.0 0.0 0.0 0.0 76-77 1.7625 0.0 0.0 0.0 0.0 78-79 2.4 0.0 0.0 0.0 0.0 80-81 3.0125 0.0 0.0 0.0 0.0 82-83 3.7625 0.0 0.0 0.0 0.0 84-85 4.5 0.0 0.0 0.0 0.0 86-87 5.275 0.0 0.0 0.0 0.0 88-89 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864415 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864415_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0185 34.0 31.0 34.0 30.0 34.0 2 32.01 34.0 31.0 34.0 30.0 34.0 3 32.0925 34.0 31.0 34.0 30.0 34.0 4 35.383 37.0 37.0 37.0 33.0 37.0 5 35.37375 37.0 35.0 37.0 33.0 37.0 6 35.4115 37.0 36.0 37.0 33.0 37.0 7 35.50325 37.0 36.0 37.0 35.0 37.0 8 35.4445 37.0 36.0 37.0 33.0 37.0 9 37.0555 39.0 38.0 39.0 34.0 39.0 10-11 36.99525 39.0 38.0 39.0 33.5 39.0 12-13 36.885875 39.0 37.5 39.0 33.5 39.0 14-15 38.228625 41.0 38.0 41.0 33.5 41.0 16-17 38.093 41.0 38.0 41.0 33.0 41.0 18-19 38.155 41.0 38.5 41.0 33.5 41.0 20-21 38.013374999999996 40.5 38.0 41.0 33.0 41.0 22-23 37.827625 40.0 38.0 41.0 32.0 41.0 24-25 37.842 40.0 38.0 41.0 33.0 41.0 26-27 37.770624999999995 40.0 38.0 41.0 32.5 41.0 28-29 37.603875 40.0 38.0 41.0 32.0 41.0 30-31 37.563625 40.0 38.0 41.0 32.0 41.0 32-33 37.276125 40.0 38.0 41.0 31.0 41.0 34-35 37.28875 40.0 38.0 41.0 31.0 41.0 36-37 37.090875 40.0 38.0 41.0 30.5 41.0 38-39 36.99125 40.0 37.5 41.0 30.5 41.0 40-41 36.933499999999995 40.0 37.5 41.0 30.0 41.0 42-43 36.79075 40.0 37.0 41.0 30.0 41.0 44-45 36.66525 40.0 37.0 41.0 30.0 41.0 46-47 36.468500000000006 40.0 36.5 41.0 30.0 41.0 48-49 36.3275 40.0 36.0 41.0 29.5 41.0 50-51 36.010374999999996 39.5 36.0 40.5 29.5 41.0 52-53 36.225125000000006 39.5 36.5 40.5 29.5 41.0 54-55 36.51925 40.0 37.0 41.0 29.5 41.0 56-57 36.326875 40.0 36.0 41.0 29.0 41.0 58-59 36.123875 39.5 36.0 41.0 28.0 41.0 60-61 35.9105 39.0 35.5 41.0 28.0 41.0 62-63 35.600750000000005 39.0 35.0 41.0 28.0 41.0 64-65 35.393 38.5 35.0 40.5 28.0 41.0 66-67 34.8455 38.0 35.0 40.0 26.5 41.0 68-69 34.46325 37.0 34.0 39.5 26.0 41.0 70-71 33.96275 36.5 34.0 39.0 26.0 41.0 72-73 33.519125 36.0 34.0 39.0 26.0 40.0 74-75 33.118375 35.5 34.0 37.5 26.0 39.5 76-77 32.318625 35.0 32.5 37.0 23.0 39.0 78-79 32.027125 35.0 33.0 36.5 22.5 39.0 80-81 31.614375000000003 35.0 32.0 36.0 21.5 37.0 82-83 31.167 35.0 32.0 35.5 20.0 37.0 84-85 30.833750000000002 35.0 31.0 35.0 18.5 36.5 86-87 30.423375 34.5 31.0 35.0 16.5 36.0 88-89 30.008249999999997 34.0 31.0 35.0 7.0 36.0 90-91 29.90225 34.0 31.0 35.0 4.5 35.0 92-93 29.523625 34.0 30.0 35.0 2.0 35.0 94-95 29.215625000000003 34.0 30.0 35.0 2.0 35.0 96-97 28.393375 34.0 28.5 35.0 2.0 35.0 98-99 27.926875000000003 34.0 29.0 35.0 2.0 35.0 100-101 26.810000000000002 33.0 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 8.0 4 8.0 5 7.0 6 12.0 7 10.0 8 11.0 9 3.0 10 9.0 11 13.0 12 12.0 13 13.0 14 11.0 15 9.0 16 14.0 17 16.0 18 13.0 19 18.0 20 18.0 21 16.0 22 25.0 23 22.0 24 22.0 25 31.0 26 38.0 27 40.0 28 34.0 29 52.0 30 62.0 31 85.0 32 106.0 33 118.0 34 155.0 35 262.0 36 486.0 37 906.0 38 1113.0 39 184.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.30830830830831 17.24224224224224 12.712712712712712 36.73673673673674 2 25.90738423028786 23.52941176470588 33.86733416770964 16.69586983729662 3 20.535267633816908 28.339169584792394 29.03951975987994 22.086043021510758 4 23.204005006257823 33.46683354192741 23.128911138923655 20.200250312891114 5 26.138069034517258 34.99249624812406 22.936468234117058 15.93296648324162 6 20.200000000000003 38.2 24.224999999999998 17.375 7 20.225 20.175 38.4 21.2 8 21.085542771385693 25.387693846923458 29.314657328664335 24.212106053026513 9 21.325 24.725 31.8 22.15 10-11 24.193548387096776 31.695423855963988 24.281070267566893 19.829957489372344 12-13 24.508945327161268 25.12198173401726 27.611660202677342 22.757412736144126 14-15 22.47402028295981 27.89532991110555 28.496306498059347 21.134343307875298 16-17 23.751720685771495 28.66975347265674 26.88024027030409 20.69828557126768 18-19 22.964352720450282 27.979987492182612 27.417135709818634 21.638524077548468 20-21 23.668417104276067 28.95723930982746 26.531632908227053 20.84271067766942 22-23 23.150000000000002 27.825 28.1625 20.8625 24-25 23.0625 27.975 28.287499999999998 20.674999999999997 26-27 23.025000000000002 28.349999999999998 28.237499999999997 20.3875 28-29 23.74343585896474 27.156789197299325 28.132033008252062 20.967741935483872 30-31 22.7625 28.1625 27.875 21.2 32-33 22.9875 28.549999999999997 28.599999999999998 19.8625 34-35 23.575 28.199999999999996 27.85 20.375 36-37 23.0 27.962500000000002 28.499999999999996 20.5375 38-39 23.425 27.250000000000004 28.462500000000002 20.8625 40-41 23.330832708177045 28.457114278569644 27.831957989497376 20.38009502375594 42-43 23.05 27.525 28.325 21.099999999999998 44-45 23.6625 27.487499999999997 28.1875 20.6625 46-47 23.2625 27.375 28.549999999999997 20.8125 48-49 23.1125 27.425 28.325 21.1375 50-51 23.1125 28.075 28.075 20.7375 52-53 24.1125 28.075 27.3125 20.5 54-55 23.021132924846818 28.248093034888083 28.110541453044892 20.620232587220208 56-57 23.382960090078818 28.324784186162894 27.63668209683473 20.655573626923555 58-59 23.893473368342086 27.33183295823956 28.244561140285075 20.530132533133283 60-61 23.275000000000002 28.712500000000002 27.925 20.0875 62-63 23.175 28.025 28.1375 20.6625 64-65 23.974999999999998 27.212500000000002 27.962500000000002 20.849999999999998 66-67 23.45 27.6375 28.449999999999996 20.4625 68-69 22.8375 28.050000000000004 28.3375 20.775 70-71 24.425 27.650000000000002 27.575 20.349999999999998 72-73 23.2875 28.325 26.875 21.512500000000003 74-75 24.474999999999998 28.65 26.8 20.075000000000003 76-77 23.3375 28.425 27.85 20.3875 78-79 23.9875 27.6875 27.737499999999997 20.5875 80-81 23.8375 27.787499999999998 28.050000000000004 20.325 82-83 24.762500000000003 28.875 26.0625 20.3 84-85 24.462500000000002 27.625 27.787499999999998 20.125 86-87 24.962500000000002 28.625 26.8125 19.6 88-89 25.837500000000002 28.299999999999997 26.2875 19.575 90-91 25.337500000000002 28.325 26.6125 19.725 92-93 25.112499999999997 27.85 26.224999999999998 20.8125 94-95 25.624999999999996 28.575 25.912499999999998 19.8875 96-97 26.3625 27.5875 25.900000000000002 20.150000000000002 98-99 26.5125 27.950000000000003 26.35 19.1875 100-101 27.237499999999997 28.225 26.174999999999997 18.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.0 25 5.0 26 4.0 27 3.5 28 6.5 29 12.0 30 14.5 31 11.0 32 19.0 33 38.0 34 47.5 35 60.5 36 73.5 37 97.5 38 128.5 39 149.0 40 172.0 41 207.0 42 247.5 43 275.0 44 299.0 45 289.0 46 270.5 47 259.0 48 225.5 49 210.5 50 186.0 51 147.0 52 121.0 53 99.0 54 82.5 55 64.0 56 45.0 57 32.5 58 25.0 59 17.0 60 12.5 61 8.5 62 5.0 63 4.5 64 3.5 65 3.0 66 2.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.05 4 0.125 5 0.05 6 0.0 7 0.0 8 0.05 9 0.0 10-11 0.025 12-13 0.08750000000000001 14-15 0.1625 16-17 0.11249999999999999 18-19 0.0625 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.08750000000000001 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39485627836612 98.55000000000001 2 0.4790721129601614 0.95 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.05042864346949068 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit GAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCACCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.4125 0.0 0.0 0.0 0.0 66-67 0.6000000000000001 0.0 0.0 0.0 0.0 68-69 0.7625 0.0 0.0 0.0 0.0 70-71 1.0375 0.0 0.0 0.0 0.0 72-73 1.2125 0.0 0.0 0.0 0.0 74-75 1.425 0.0 0.0 0.0 0.0 76-77 1.7875 0.0 0.0 0.0 0.0 78-79 2.4 0.0 0.0 0.0 0.0 80-81 3.025 0.0 0.0 0.0 0.0 82-83 3.8125 0.0 0.0 0.0 0.0 84-85 4.5875 0.0 0.0 0.0 0.0 86-87 5.3125 0.0 0.0 0.0 0.0 88-89 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCTTG 15 0.009957196 47.5 38-39 >>END_MODULE Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512243 spots for ERR1864415.sra Written 512243 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra Read 512231 spots for ERR1864415.sra Written 512231 spots for ERR1864415.sra SRR ids: ['ERR1864415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_unkp843k ERR1864415.sra spots: 10244632 blocks: [[1, 512231], [512232, 1024462], [1024463, 1536693], [1536694, 2048924], [2048925, 2561155], [2561156, 3073386], [3073387, 3585617], [3585618, 4097848], [4097849, 4610079], [4610080, 5122310], [5122311, 5634541], [5634542, 6146772], [6146773, 6659003], [6659004, 7171234], [7171235, 7683465], [7683466, 8195696], [8195697, 8707927], [8707928, 9220158], [9220159, 9732389], [9732390, 10244632]] ERR1864415 file size 2449416 ERR1864415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864415 ERR1864415_1.fastq ERR1864415_2.fastq Input file: ERR1864415_1.fastq Paired file: ERR1864415_2.fastq trimmed: ERR1864415-trimmed-pair1.fastq, ERR1864415-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:24:06 2025 >> started Thu Feb 13 01:24:39 2025 >> done (33.773s) 10244632 read pairs processed; of these: 111975 ( 1.09%) short read pairs filtered out after trimming by size control 130604 ( 1.27%) empty read pairs filtered out after trimming by size control 10002053 (97.63%) read pairs available; of these: 3006072 (30.05%) trimmed read pairs available after processing 6995981 (69.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 56 0.00% 19 97 0.00% 20 173 0.00% 21 216 0.00% 22 237 0.00% 23 353 0.00% 24 408 0.00% 25 477 0.00% 26 528 0.01% 27 639 0.01% 28 783 0.01% 29 884 0.01% 30 910 0.01% 31 1095 0.01% 32 1242 0.01% 33 1428 0.01% 34 1527 0.02% 35 1650 0.02% 36 1809 0.02% 37 2022 0.02% 38 2304 0.02% 39 2474 0.02% 40 2614 0.03% 41 2976 0.03% 42 3060 0.03% 43 3275 0.03% 44 3463 0.03% 45 3942 0.04% 46 4109 0.04% 47 4376 0.04% 48 4852 0.05% 49 5093 0.05% 50 5461 0.05% 51 5872 0.06% 52 6521 0.07% 53 6737 0.07% 54 7419 0.07% 55 7896 0.08% 56 8479 0.08% 57 9118 0.09% 58 10248 0.10% 59 12600 0.13% 60 15514 0.16% 61 16169 0.16% 62 17050 0.17% 63 18097 0.18% 64 19234 0.19% 65 20195 0.20% 66 21496 0.21% 67 23018 0.23% 68 24053 0.24% 69 25594 0.26% 70 27422 0.27% 71 29382 0.29% 72 31495 0.31% 73 33970 0.34% 74 35656 0.36% 75 37804 0.38% 76 39695 0.40% 77 42179 0.42% 78 45016 0.45% 79 47577 0.48% 80 51643 0.52% 81 54755 0.55% 82 58020 0.58% 83 60916 0.61% 84 65093 0.65% 85 68964 0.69% 86 72449 0.72% 87 75055 0.75% 88 78042 0.78% 89 81648 0.82% 90 85941 0.86% 91 91580 0.92% 92 96014 0.96% 93 103235 1.03% 94 110958 1.11% 95 120564 1.21% 96 133529 1.34% 97 153629 1.54% 98 184641 1.85% 99 224987 2.25% 100 324370 3.24% 101 6995981 69.95% 10002053 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=15 prefix-density=0.22 prefix-fanout=2.7 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.1 sequence=TTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=6.25 fanout-score-rank=9 prefix-density=1.11 prefix-fanout=1.7 sequence=CACCTGCGACACCTGCGACTGCG criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=50.95 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=11.2 sequence=GAAGAAGAGAAG ERR1864415 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:26:25 Started mapping on | Feb 13 01:26:25 Finished on | Feb 13 01:27:05 Mapping speed, Million of reads per hour | 900.18 Number of input reads | 10002053 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 9689957 Uniquely mapped reads % | 96.88% Average mapped length | 193.35 Number of splices: Total | 6145362 Number of splices: Annotated (sjdb) | 6050100 Number of splices: GT/AG | 6037154 Number of splices: GC/AG | 91585 Number of splices: AT/AC | 3626 Number of splices: Non-canonical | 12997 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221256 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 23579 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 106237 106237 106237 N_multimapping 221256 221256 221256 N_noFeature 193398 9533088 264365 N_ambiguous 123492 256 37477 UnstrandedReadsAssigned:9373067 PositiveStrandReadsAssigned:156613 NegativeStrandReadsAssigned:9388115 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR1864415 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864415-trimmed-pair1.fastq ERR1864415-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,002,053 reads, 9,503,397 reads pseudoaligned [quant] estimated average fragment length: 147.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 ERR1864415.ke.tsv 34699 ERR1864415.se.tsv 87100 total ==> ERR1864415.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1871.95 470 25.5934 Potri.005G024800.1.v4.1 1035 888.946 260 29.8141 Potri.004G059700.1.v4.1 961 814.946 4 0.500328 Potri.007G009000.2.v4.1 1416 1269.95 0 0 Potri.003G141000.2.v4.1 2943 2796.95 846.484 30.8502 Potri.016G087400.1.v4.1 270 131.674 580 449.006 Potri.015G069301.1.v4.1 564 418.058 0 0 Potri.010G195200.1.v4.1 1773 1626.95 17 1.06512 Potri.012G127500.1.v4.1 977 830.946 131 16.0702 ==> ERR1864415.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 ERR1864415 completed mapping pipeline successfully