Starting /dee2/code/volunteer_pipeline.sh ERR1864416 current disk space = 3052086370304 free memory = 1582160796 ERR1864416 SRAfilesize a70bdf001006ddfaaf2025b038d28630 ERR1864416.sra ERR1864416.sra file validated ERR1864416 is paired end ERR1864416 is conventional basespace ERR1864416 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864416_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.59375 34.0 31.0 34.0 27.0 34.0 2 31.49275 34.0 31.0 34.0 28.0 34.0 3 32.1555 34.0 31.0 34.0 29.0 34.0 4 35.54775 37.0 35.0 37.0 33.0 37.0 5 35.4135 37.0 35.0 37.0 33.0 37.0 6 35.4465 37.0 35.0 37.0 33.0 37.0 7 35.402 37.0 35.0 37.0 33.0 37.0 8 35.37175 37.0 35.0 37.0 33.0 37.0 9 37.08725 39.0 38.0 39.0 34.0 39.0 10-11 37.0665 39.0 38.0 39.0 33.5 39.0 12-13 37.025625000000005 39.0 37.5 39.0 34.0 39.0 14-15 38.423249999999996 41.0 38.5 41.0 33.5 41.0 16-17 38.285875 41.0 38.0 41.0 33.0 41.0 18-19 38.290375 41.0 38.5 41.0 34.0 41.0 20-21 38.195750000000004 40.0 38.5 41.0 33.5 41.0 22-23 38.11525 40.0 38.0 41.0 33.0 41.0 24-25 38.024 40.0 38.0 41.0 33.0 41.0 26-27 37.94975 40.0 38.0 41.0 33.0 41.0 28-29 37.790625000000006 40.0 38.0 41.0 32.5 41.0 30-31 37.68875 40.0 38.0 41.0 32.0 41.0 32-33 37.654624999999996 40.0 38.0 41.0 32.0 41.0 34-35 37.4985 40.0 38.0 41.0 32.5 41.0 36-37 37.406875 40.0 38.0 41.0 32.0 41.0 38-39 37.357124999999996 40.0 38.0 41.0 31.5 41.0 40-41 37.168375 40.0 38.0 41.0 31.0 41.0 42-43 36.99325 40.0 37.0 41.0 30.0 41.0 44-45 36.9645 40.0 37.5 41.0 30.5 41.0 46-47 37.073750000000004 40.0 37.5 41.0 31.0 41.0 48-49 37.072375 40.0 37.5 41.0 31.0 41.0 50-51 36.920375 40.0 37.0 41.0 30.5 41.0 52-53 36.638374999999996 40.0 37.0 41.0 30.0 41.0 54-55 36.506625 40.0 36.5 41.0 30.0 41.0 56-57 36.349000000000004 40.0 36.0 41.0 29.5 41.0 58-59 36.132375 39.0 35.5 41.0 28.5 41.0 60-61 35.90275 39.0 35.0 41.0 28.5 41.0 62-63 35.57025 39.0 35.0 40.0 28.0 41.0 64-65 35.211375000000004 38.0 35.0 40.0 28.0 41.0 66-67 34.804500000000004 37.5 34.0 40.0 27.0 41.0 68-69 34.461875 37.0 34.0 39.5 26.0 41.0 70-71 34.050375 36.5 34.0 39.0 26.5 41.0 72-73 33.544 36.0 33.5 39.0 26.0 40.0 74-75 32.9385 35.0 33.0 37.5 25.0 39.5 76-77 31.883875 34.5 31.5 36.0 24.0 39.0 78-79 32.234 35.0 32.0 36.5 25.5 39.0 80-81 31.93775 35.0 32.0 36.0 24.5 37.0 82-83 31.664875000000002 35.0 32.0 36.0 24.0 37.0 84-85 31.247625 35.0 32.0 35.0 22.0 37.0 86-87 30.499875 34.0 31.0 35.0 18.0 36.0 88-89 30.416375 34.0 31.0 35.0 18.5 36.0 90-91 30.312125 34.0 31.0 35.0 18.0 35.5 92-93 29.994750000000003 34.0 31.0 35.0 11.5 35.0 94-95 29.750875 34.0 31.0 35.0 4.5 35.0 96-97 29.50075 34.0 30.5 35.0 2.0 35.0 98-99 29.198625 34.0 30.5 35.0 2.0 35.0 100-101 28.176375 33.5 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 16.0 4 8.0 5 8.0 6 6.0 7 5.0 8 3.0 9 9.0 10 8.0 11 12.0 12 15.0 13 7.0 14 5.0 15 16.0 16 12.0 17 11.0 18 9.0 19 12.0 20 17.0 21 22.0 22 25.0 23 11.0 24 16.0 25 27.0 26 29.0 27 43.0 28 43.0 29 50.0 30 68.0 31 75.0 32 86.0 33 121.0 34 190.0 35 257.0 36 448.0 37 919.0 38 1183.0 39 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.95213319458897 9.027055150884495 8.272632674297608 46.74817898022893 2 22.55 13.700000000000001 36.275 27.474999999999998 3 20.625 18.425 24.875 36.075 4 24.875 25.7 22.45 26.974999999999998 5 23.336668334167083 31.140570285142573 24.037018509254626 21.48574287143572 6 17.187890918188643 35.82687015261446 25.91943957968476 21.065799349512133 7 14.736052039029271 24.39329497122842 42.95721791343507 17.91343507630723 8 17.137853390042533 25.11883912934701 33.675256442331744 24.06805103827871 9 17.513134851138354 22.266700025018764 36.05203902927195 24.168126094570926 10-11 19.707207207207208 33.68368368368368 25.925925925925924 20.683183183183182 12-13 20.50800800800801 25.5005005005005 29.22922922922923 24.762262262262265 14-15 19.544544544544546 28.453453453453452 27.77777777777778 24.224224224224226 16-17 20.445445445445447 28.52852852852853 27.75275275275275 23.273273273273272 18-19 20.10760760760761 27.5025025025025 28.566066066066064 23.823823823823822 20-21 19.61961961961962 28.666166166166168 28.453453453453452 23.26076076076076 22-23 20.558058058058055 29.016516516516518 27.32732732732733 23.0980980980981 24-25 19.944944944944947 28.678678678678676 27.790290290290294 23.586086086086087 26-27 19.21921921921922 28.19069069069069 28.703703703703702 23.886386386386384 28-29 21.35885885885886 28.928928928928926 27.05205205205205 22.66016016016016 30-31 20.00750750750751 28.753753753753752 27.815315315315313 23.423423423423422 32-33 21.083583583583586 28.541041041041044 27.32732732732733 23.04804804804805 34-35 19.81981981981982 29.517017017017018 27.615115115115113 23.04804804804805 36-37 20.32032032032032 28.803803803803802 27.965465465465467 22.91041041041041 38-39 21.10860860860861 28.59109109109109 27.2022022022022 23.0980980980981 40-41 19.95745745745746 29.34184184184184 26.83933933933934 23.86136136136136 42-43 20.00750750750751 28.553553553553552 27.82782782782783 23.61111111111111 44-45 20.633133133133132 28.916416416416418 27.540040040040044 22.91041041041041 46-47 21.22122122122122 27.677677677677675 27.965465465465467 23.135635635635634 48-49 20.32032032032032 28.97897897897898 26.864364364364363 23.836336336336338 50-51 20.32032032032032 28.19069069069069 27.5025025025025 23.986486486486484 52-53 20.260782347041122 29.300401203610832 27.407221664994985 23.03159478435306 54-55 21.246246246246248 27.59009009009009 27.264764764764767 23.8988988988989 56-57 20.492931314900538 28.237207556612038 27.01113474290004 24.25872638558739 58-59 20.482982982982982 28.72872872872873 26.43893893893894 24.34934934934935 60-61 19.944944944944947 29.34184184184184 27.25225225225225 23.46096096096096 62-63 20.6875 28.65 27.787499999999998 22.875 64-65 20.775 28.549999999999997 27.037499999999998 23.6375 66-67 20.575 28.375 27.775 23.275000000000002 68-69 20.2375 28.237499999999997 28.499999999999996 23.025000000000002 70-71 21.0 28.849999999999998 27.224999999999998 22.925 72-73 20.875 28.125 27.450000000000003 23.549999999999997 74-75 20.599999999999998 28.1 27.500000000000004 23.799999999999997 76-77 20.849999999999998 28.3375 27.3875 23.425 78-79 20.65298974230673 27.9459594696022 28.19614711033275 23.204903677758317 80-81 20.424999999999997 28.9125 27.737499999999997 22.925 82-83 21.265158144768094 27.928491061382672 27.428428553569194 23.377922240280036 84-85 20.7375 29.2 26.825 23.2375 86-87 21.6125 28.212500000000002 25.85 24.325 88-89 21.5625 29.675 26.0625 22.7 90-91 21.6875 28.9875 25.85 23.474999999999998 92-93 21.175 29.599999999999998 26.087500000000002 23.1375 94-95 21.762500000000003 29.099999999999998 25.874999999999996 23.2625 96-97 20.6625 29.799999999999997 25.387500000000003 24.15 98-99 22.025 28.3625 25.7375 23.875 100-101 21.725 29.062500000000004 25.137500000000003 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.5 24 2.5 25 4.0 26 6.0 27 4.5 28 7.0 29 13.5 30 16.5 31 21.0 32 25.5 33 31.0 34 47.0 35 69.0 36 89.0 37 119.0 38 147.5 39 163.5 40 183.5 41 200.5 42 221.5 43 243.0 44 248.5 45 247.5 46 268.0 47 268.5 48 244.0 49 209.0 50 178.0 51 162.0 52 118.0 53 93.5 54 86.0 55 64.5 56 53.0 57 41.0 58 28.0 59 20.0 60 14.5 61 9.0 62 3.5 63 4.5 64 4.0 65 4.5 66 4.5 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.05 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.1 12-13 0.1 14-15 0.1 16-17 0.1 18-19 0.1 20-21 0.1 22-23 0.1 24-25 0.1 26-27 0.1 28-29 0.1 30-31 0.1 32-33 0.1 34-35 0.1 36-37 0.1 38-39 0.1 40-41 0.1 42-43 0.1 44-45 0.1 46-47 0.1 48-49 0.1 50-51 0.1 52-53 0.3 54-55 0.1 56-57 0.08750000000000001 58-59 0.1 60-61 0.1 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.075 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31835395102246 98.35000000000001 2 0.5301691492047462 1.05 3 0.050492299924261554 0.15 4 0.050492299924261554 0.2 5 0.050492299924261554 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.1875 0.0 0.0 0.0 0.0 54-55 0.21250000000000002 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.44999999999999996 0.0 0.0 0.0 0.0 66-67 0.55 0.0 0.0 0.0 0.0 68-69 0.6875 0.0 0.0 0.0 0.0 70-71 0.9875 0.0 0.0 0.0 0.0 72-73 1.25 0.0 0.0 0.0 0.0 74-75 1.625 0.0 0.0 0.0 0.0 76-77 1.9375 0.0 0.0 0.0 0.0 78-79 2.325 0.0 0.0 0.0 0.0 80-81 2.7 0.0 0.0 0.0 0.0 82-83 3.2875 0.0 0.0 0.0 0.0 84-85 4.0625 0.0 0.0 0.0 0.0 86-87 5.012499999999999 0.0 0.0 0.0 0.0 88-89 5.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864416 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864416_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.031 34.0 31.0 34.0 30.0 34.0 2 32.10925 34.0 31.0 34.0 30.0 34.0 3 32.133 34.0 31.0 34.0 30.0 34.0 4 35.4005 37.0 35.0 37.0 33.0 37.0 5 35.31925 37.0 35.0 37.0 33.0 37.0 6 35.52475 37.0 36.0 37.0 33.0 37.0 7 35.512 37.0 36.0 37.0 33.0 37.0 8 35.42575 37.0 35.0 37.0 33.0 37.0 9 37.0905 39.0 37.0 39.0 34.0 39.0 10-11 37.041125 39.0 37.0 39.0 33.5 39.0 12-13 36.951750000000004 39.0 37.0 39.0 33.5 39.0 14-15 38.317125000000004 41.0 38.0 41.0 33.0 41.0 16-17 38.223375 41.0 38.0 41.0 33.0 41.0 18-19 38.24575 41.0 38.0 41.0 33.5 41.0 20-21 38.1095 40.0 38.0 41.0 33.0 41.0 22-23 37.8455 40.0 38.0 41.0 32.5 41.0 24-25 37.880250000000004 40.0 38.0 41.0 33.0 41.0 26-27 37.806375 40.0 38.0 41.0 32.0 41.0 28-29 37.59725 40.0 38.0 41.0 32.0 41.0 30-31 37.55675 40.0 38.0 41.0 32.0 41.0 32-33 37.323625 40.0 38.0 41.0 31.0 41.0 34-35 37.21525 40.0 38.0 41.0 30.5 41.0 36-37 37.075874999999996 40.0 37.5 41.0 30.5 41.0 38-39 36.879875 40.0 37.5 41.0 30.0 41.0 40-41 36.83925 40.0 37.0 41.0 30.0 41.0 42-43 36.7735 40.0 37.0 41.0 30.0 41.0 44-45 36.560875 40.0 37.0 41.0 30.0 41.0 46-47 36.307125 39.5 36.5 41.0 29.0 41.0 48-49 36.134625 39.0 36.0 41.0 29.0 41.0 50-51 35.75975 39.0 35.5 40.5 28.5 41.0 52-53 36.08175 39.0 36.5 40.5 29.5 41.0 54-55 36.41175 40.0 36.0 41.0 30.0 41.0 56-57 36.21825 40.0 36.0 41.0 28.5 41.0 58-59 35.931250000000006 39.0 35.5 41.0 28.5 41.0 60-61 35.54075 39.0 35.0 41.0 27.5 41.0 62-63 35.322375 39.0 35.0 41.0 26.5 41.0 64-65 35.05275 38.0 35.0 40.0 27.0 41.0 66-67 34.545375 37.5 34.0 40.0 26.0 41.0 68-69 34.195875 37.0 34.0 39.5 26.0 41.0 70-71 33.647875 36.0 34.0 39.0 25.5 41.0 72-73 33.201625 36.0 34.0 38.5 25.0 40.0 74-75 32.7205 35.0 33.0 37.0 23.5 39.0 76-77 31.903 35.0 31.5 37.0 21.0 39.0 78-79 31.6165 35.0 32.0 36.0 20.0 38.5 80-81 31.28725 35.0 32.0 36.0 19.0 37.0 82-83 30.868875 35.0 31.5 35.5 18.0 37.0 84-85 30.487625 34.5 31.0 35.0 15.5 36.5 86-87 30.046125 34.0 30.5 35.0 7.5 36.0 88-89 29.597875000000002 34.0 30.0 35.0 3.5 36.0 90-91 29.4265 34.0 30.5 35.0 2.0 35.0 92-93 29.233625 34.0 30.0 35.0 2.0 35.0 94-95 28.93725 34.0 30.0 35.0 2.0 35.0 96-97 28.07975 34.0 28.0 35.0 2.0 35.0 98-99 27.579625 34.0 28.0 35.0 2.0 35.0 100-101 26.438 33.0 25.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 7.0 4 5.0 5 10.0 6 8.0 7 6.0 8 10.0 9 13.0 10 16.0 11 7.0 12 16.0 13 10.0 14 21.0 15 16.0 16 14.0 17 17.0 18 17.0 19 19.0 20 17.0 21 22.0 22 19.0 23 20.0 24 21.0 25 28.0 26 45.0 27 38.0 28 53.0 29 51.0 30 71.0 31 79.0 32 101.0 33 121.0 34 199.0 35 291.0 36 480.0 37 928.0 38 1021.0 39 156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.666333166583286 18.159079539769884 13.406703351675839 35.767883941970986 2 25.94445834375782 23.592694520890667 34.10057543157368 16.362271703777832 3 21.1855927963982 27.63881940970485 29.739869934967484 21.435717858929465 4 23.892919689767325 34.375781836377286 22.39179384538404 19.339504628471353 5 24.58729364682341 37.06853426713357 22.761380690345174 15.582791395697848 6 19.525000000000002 38.875 22.625 18.975 7 20.075000000000003 19.400000000000002 39.675 20.849999999999998 8 21.85546386596649 25.18129532383096 28.907226806701676 24.056014003500874 9 22.35 24.5 30.25 22.900000000000002 10-11 24.2375 31.35 24.2875 20.125 12-13 24.246215438508695 24.58401100963343 28.237207556612038 22.93256599524584 14-15 22.297381936615306 28.18489289740699 27.395715896279594 22.122009269698108 16-17 23.91494684177611 27.066916823014388 27.01688555347092 22.001250781738587 18-19 24.14655495810929 29.035888458171815 26.172314617981744 20.645241965737153 20-21 23.980995248812203 28.33208302075519 27.094273568392097 20.59264816204051 22-23 23.724999999999998 27.987499999999997 27.500000000000004 20.7875 24-25 23.125 28.4125 28.000000000000004 20.4625 26-27 22.7 28.975 27.9375 20.3875 28-29 23.8375 28.1 27.6125 20.45 30-31 23.75 27.375 28.3625 20.5125 32-33 23.0875 28.000000000000004 28.1375 20.775 34-35 23.9125 27.925 27.4125 20.75 36-37 24.0 27.462500000000002 28.050000000000004 20.4875 38-39 22.325 28.549999999999997 27.9125 21.212500000000002 40-41 23.99349837459365 27.019254813703427 28.26956739184796 20.717679419854964 42-43 23.6375 27.1 28.0875 21.175 44-45 23.3375 28.549999999999997 27.9375 20.175 46-47 24.0125 27.287499999999998 27.462500000000002 21.2375 48-49 23.025000000000002 27.200000000000003 29.225 20.549999999999997 50-51 22.9625 27.925 27.900000000000002 21.212500000000002 52-53 24.099999999999998 28.125 27.525 20.25 54-55 23.118279569892472 27.70692673168292 29.019754938734682 20.155038759689923 56-57 23.20200125078174 27.892432770481552 27.779862414008754 21.125703564727953 58-59 24.256064016004 26.581645411352838 28.569642410602654 20.59264816204051 60-61 23.3 26.8375 28.3375 21.525 62-63 23.8375 27.900000000000002 27.900000000000002 20.3625 64-65 23.799999999999997 27.9125 27.55 20.7375 66-67 22.425 28.287499999999998 28.287499999999998 21.0 68-69 23.799999999999997 28.3375 27.3625 20.5 70-71 23.7875 28.1125 27.0875 21.0125 72-73 23.4375 28.299999999999997 27.474999999999998 20.7875 74-75 24.7 26.950000000000003 27.5625 20.7875 76-77 24.2625 28.0875 26.8625 20.7875 78-79 23.0125 27.6 28.525 20.8625 80-81 23.875 27.55 27.3 21.275 82-83 24.7 27.487499999999997 27.1125 20.7 84-85 24.4125 27.5625 28.1 19.925 86-87 24.7375 27.437499999999996 27.1375 20.6875 88-89 24.3875 27.5625 27.650000000000002 20.4 90-91 25.912499999999998 28.125 26.25 19.7125 92-93 25.7875 28.5875 25.7625 19.8625 94-95 26.687499999999996 28.050000000000004 26.0 19.2625 96-97 26.275 28.000000000000004 25.937500000000004 19.787499999999998 98-99 25.9875 28.625 25.7875 19.6 100-101 26.0375 27.825 25.4 20.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.5 25 1.5 26 1.0 27 1.0 28 4.0 29 9.0 30 12.5 31 16.5 32 21.5 33 32.5 34 42.5 35 58.5 36 81.5 37 98.5 38 132.5 39 169.0 40 191.5 41 200.0 42 234.5 43 263.0 44 265.0 45 271.5 46 272.0 47 255.0 48 223.5 49 199.0 50 173.0 51 150.0 52 130.5 53 111.5 54 98.5 55 74.5 56 48.5 57 39.5 58 33.0 59 24.5 60 14.5 61 7.5 62 6.0 63 7.5 64 6.0 65 2.5 66 1.5 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.05 4 0.075 5 0.05 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0 12-13 0.08750000000000001 14-15 0.21250000000000002 16-17 0.0625 18-19 0.0375 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0625 58-59 0.025 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.45305814246161585 0.8999999999999999 3 0.07550969041026932 0.22499999999999998 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.16249999999999998 0.0 0.0 0.0 0.0 54-55 0.1875 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2375 0.0 0.0 0.0 0.0 60-61 0.275 0.0 0.0 0.0 0.0 62-63 0.325 0.0 0.0 0.0 0.0 64-65 0.42500000000000004 0.0 0.0 0.0 0.0 66-67 0.5249999999999999 0.0 0.0 0.0 0.0 68-69 0.6625 0.0 0.0 0.0 0.0 70-71 1.0 0.0 0.0 0.0 0.0 72-73 1.275 0.0 0.0 0.0 0.0 74-75 1.65 0.0 0.0 0.0 0.0 76-77 1.9625 0.0 0.0 0.0 0.0 78-79 2.3499999999999996 0.0 0.0 0.0 0.0 80-81 2.75 0.0 0.0 0.0 0.0 82-83 3.3375 0.0 0.0 0.0 0.0 84-85 4.125 0.0 0.0 0.0 0.0 86-87 5.0625 0.0 0.0 0.0 0.0 88-89 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561671 spots for ERR1864416.sra Written 561671 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra Read 561655 spots for ERR1864416.sra Written 561655 spots for ERR1864416.sra SRR ids: ['ERR1864416.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t3es5grq ERR1864416.sra spots: 11233116 blocks: [[1, 561655], [561656, 1123310], [1123311, 1684965], [1684966, 2246620], [2246621, 2808275], [2808276, 3369930], [3369931, 3931585], [3931586, 4493240], [4493241, 5054895], [5054896, 5616550], [5616551, 6178205], [6178206, 6739860], [6739861, 7301515], [7301516, 7863170], [7863171, 8424825], [8424826, 8986480], [8986481, 9548135], [9548136, 10109790], [10109791, 10671445], [10671446, 11233116]] ERR1864416 file size 2687850 ERR1864416 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864416 ERR1864416_1.fastq ERR1864416_2.fastq Input file: ERR1864416_1.fastq Paired file: ERR1864416_2.fastq trimmed: ERR1864416-trimmed-pair1.fastq, ERR1864416-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:06:10 2025 >> started Thu Feb 13 04:34:03 2025 >> done (1673.434s) 11233116 read pairs processed; of these: 110865 ( 0.99%) short read pairs filtered out after trimming by size control 116515 ( 1.04%) empty read pairs filtered out after trimming by size control 11005736 (97.98%) read pairs available; of these: 3290892 (29.90%) trimmed read pairs available after processing 7714844 (70.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 53 0.00% 19 121 0.00% 20 168 0.00% 21 212 0.00% 22 295 0.00% 23 345 0.00% 24 440 0.00% 25 525 0.00% 26 574 0.01% 27 704 0.01% 28 838 0.01% 29 911 0.01% 30 1120 0.01% 31 1172 0.01% 32 1450 0.01% 33 1585 0.01% 34 1676 0.02% 35 1886 0.02% 36 2010 0.02% 37 2227 0.02% 38 2539 0.02% 39 2711 0.02% 40 2800 0.03% 41 3019 0.03% 42 3365 0.03% 43 3509 0.03% 44 3830 0.03% 45 3985 0.04% 46 4288 0.04% 47 4674 0.04% 48 5120 0.05% 49 5299 0.05% 50 5828 0.05% 51 6226 0.06% 52 6566 0.06% 53 7099 0.06% 54 7689 0.07% 55 8287 0.08% 56 8787 0.08% 57 9627 0.09% 58 10555 0.10% 59 13258 0.12% 60 15370 0.14% 61 16554 0.15% 62 17708 0.16% 63 18780 0.17% 64 20024 0.18% 65 21236 0.19% 66 22320 0.20% 67 23880 0.22% 68 25314 0.23% 69 26960 0.24% 70 29207 0.27% 71 30967 0.28% 72 33328 0.30% 73 36022 0.33% 74 38771 0.35% 75 40531 0.37% 76 42544 0.39% 77 45635 0.41% 78 48574 0.44% 79 52403 0.48% 80 55693 0.51% 81 59549 0.54% 82 63028 0.57% 83 66862 0.61% 84 71710 0.65% 85 75796 0.69% 86 80333 0.73% 87 82441 0.75% 88 86167 0.78% 89 89520 0.81% 90 95043 0.86% 91 101465 0.92% 92 106474 0.97% 93 114198 1.04% 94 123224 1.12% 95 133962 1.22% 96 148847 1.35% 97 170947 1.55% 98 204243 1.86% 99 249270 2.26% 100 358619 3.26% 101 7714844 70.10% 11005736 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=20 prefix-density=0.23 prefix-fanout=2.6 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=19.17 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=6.6 sequence=TTTTTTTTTTACACTAATTATAAGACTTCATTAAAACCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=6.30 fanout-score-rank=10 prefix-density=1.18 prefix-fanout=1.7 sequence=CACCTGCGACACCTGCGACTGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=113.77 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.7 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864416 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:03:39 Started mapping on | Feb 13 05:03:58 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 12.88 Number of input reads | 11005736 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 10627959 Uniquely mapped reads % | 96.57% Average mapped length | 193.51 Number of splices: Total | 6715524 Number of splices: Annotated (sjdb) | 6614179 Number of splices: GT/AG | 6597304 Number of splices: GC/AG | 99079 Number of splices: AT/AC | 4060 Number of splices: Non-canonical | 15081 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244191 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 28535 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 147396 147396 147396 N_multimapping 244191 244191 244191 N_noFeature 202570 10449821 287244 N_ambiguous 134419 302 40798 UnstrandedReadsAssigned:10290970 PositiveStrandReadsAssigned:177836 NegativeStrandReadsAssigned:10299917 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=98 echo kmer=93 ERR1864416 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864416-trimmed-pair1.fastq ERR1864416-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,005,736 reads, 10,425,914 reads pseudoaligned [quant] estimated average fragment length: 147.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 ERR1864416.ke.tsv 34699 ERR1864416.se.tsv 87100 total ==> ERR1864416.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1871.94 577 28.01 Potri.005G024800.1.v4.1 1035 888.942 340 34.7565 Potri.004G059700.1.v4.1 961 814.942 5 0.557537 Potri.007G009000.2.v4.1 1416 1269.94 0 0 Potri.003G141000.2.v4.1 2943 2796.94 944.527 30.6875 Potri.016G087400.1.v4.1 270 131.607 701 484.027 Potri.015G069301.1.v4.1 564 418.027 0 0 Potri.010G195200.1.v4.1 1773 1626.94 42 2.34589 Potri.012G127500.1.v4.1 977 830.942 89 9.73307 ==> ERR1864416.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 220 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 ERR1864416 completed mapping pipeline successfully