Starting /dee2/code/volunteer_pipeline.sh ERR1864417 current disk space = 3052010450944 free memory = 1571190084 ERR1864417 SRAfilesize 74b84a890daf2b2e43330ef1f3d4e333 ERR1864417.sra ERR1864417.sra file validated ERR1864417 is paired end ERR1864417 is conventional basespace ERR1864417 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864417_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.42825 33.0 31.0 34.0 30.0 34.0 2 31.77225 34.0 31.0 34.0 30.0 34.0 3 31.87425 34.0 31.0 34.0 30.0 34.0 4 35.4085 37.0 35.0 37.0 33.0 37.0 5 35.2005 37.0 35.0 37.0 33.0 37.0 6 35.09825 37.0 35.0 37.0 32.0 37.0 7 35.04775 37.0 35.0 37.0 32.0 37.0 8 35.16875 37.0 35.0 37.0 33.0 37.0 9 36.73925 39.0 37.0 39.0 33.0 39.0 10-11 36.711125 39.0 37.0 39.0 33.0 39.0 12-13 36.419 39.0 37.0 39.0 32.0 39.0 14-15 37.852625 40.0 38.0 41.0 33.0 41.0 16-17 37.82225 40.0 38.0 41.0 33.0 41.0 18-19 37.722 40.0 38.0 41.0 32.5 41.0 20-21 37.628875 40.0 38.0 41.0 32.0 41.0 22-23 37.455749999999995 40.0 38.0 41.0 32.0 41.0 24-25 37.437250000000006 40.0 38.0 41.0 32.0 41.0 26-27 37.204375 40.0 37.5 41.0 31.0 41.0 28-29 37.181625 40.0 37.0 41.0 31.5 41.0 30-31 36.939750000000004 40.0 37.0 41.0 30.5 41.0 32-33 36.770250000000004 40.0 37.0 41.0 30.0 41.0 34-35 36.624624999999995 40.0 36.5 41.0 30.0 41.0 36-37 36.689499999999995 40.0 37.0 41.0 30.0 41.0 38-39 36.499125 40.0 36.5 41.0 30.0 41.0 40-41 36.386750000000006 40.0 36.0 41.0 29.5 41.0 42-43 36.436 40.0 36.0 41.0 30.0 41.0 44-45 36.25425 39.5 36.0 41.0 29.5 41.0 46-47 36.156 39.0 35.5 41.0 29.5 41.0 48-49 36.35825 39.5 36.0 41.0 30.0 41.0 50-51 36.352 40.0 36.0 41.0 29.5 41.0 52-53 36.2575 40.0 36.0 41.0 29.0 41.0 54-55 35.965125 39.0 35.0 41.0 28.5 41.0 56-57 35.695875 39.0 35.0 41.0 28.0 41.0 58-59 35.530875 39.0 35.0 41.0 27.5 41.0 60-61 35.09375 38.5 34.0 40.0 26.0 41.0 62-63 34.835750000000004 38.0 34.0 40.0 26.0 41.0 64-65 34.43675 37.5 34.0 40.0 25.5 41.0 66-67 34.097624999999994 37.0 33.0 40.0 26.0 41.0 68-69 33.814750000000004 36.5 33.0 39.0 26.0 41.0 70-71 33.18375 36.0 33.0 39.0 23.5 40.5 72-73 32.812250000000006 35.0 32.5 38.5 22.5 40.0 74-75 32.39425 35.0 32.0 37.0 22.5 39.0 76-77 31.31525 34.0 30.5 36.0 21.0 39.0 78-79 31.712 35.0 32.0 36.0 22.0 39.0 80-81 31.461750000000002 35.0 32.0 36.0 20.0 37.0 82-83 31.18075 35.0 32.0 36.0 20.5 37.0 84-85 30.764375 35.0 31.5 35.0 18.5 36.5 86-87 30.517125 34.5 31.0 35.0 18.0 36.0 88-89 30.173125 34.0 31.0 35.0 9.5 36.0 90-91 30.017875 34.0 31.0 35.0 7.0 35.5 92-93 29.731 34.0 31.0 35.0 4.5 35.0 94-95 29.345625 34.0 30.0 35.0 2.0 35.0 96-97 29.018625 34.0 30.0 35.0 2.0 35.0 98-99 28.729374999999997 34.0 29.5 35.0 2.0 35.0 100-101 27.607125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 17.0 4 7.0 5 9.0 6 4.0 7 7.0 8 5.0 9 12.0 10 6.0 11 5.0 12 2.0 13 9.0 14 13.0 15 13.0 16 14.0 17 10.0 18 15.0 19 21.0 20 16.0 21 26.0 22 19.0 23 23.0 24 22.0 25 21.0 26 36.0 27 42.0 28 49.0 29 50.0 30 69.0 31 88.0 32 143.0 33 161.0 34 196.0 35 323.0 36 486.0 37 829.0 38 1030.0 39 142.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.373292867981796 6.423874557410217 3.388973191704603 33.81385938290339 2 29.75 5.3 32.025 32.925 3 25.75 8.575000000000001 24.15 41.525 4 31.225 13.975000000000001 21.625 33.175 5 30.575000000000003 19.15 25.874999999999996 24.4 6 26.25 24.275 24.425 25.05 7 18.95 23.0 40.400000000000006 17.65 8 17.675 24.825 35.075 22.425 9 17.925 22.025 39.050000000000004 21.0 10-11 20.7375 31.525 29.9 17.837500000000002 12-13 21.912499999999998 26.174999999999997 31.15 20.7625 14-15 20.8625 27.35 30.725 21.0625 16-17 22.0875 26.987499999999997 29.5375 21.3875 18-19 21.825 26.3625 28.512500000000003 23.3 20-21 22.35 26.8 29.099999999999998 21.75 22-23 22.287499999999998 27.1 27.825 22.787499999999998 24-25 22.7375 26.7625 28.262500000000003 22.237499999999997 26-27 21.2625 27.3125 28.725 22.7 28-29 21.837500000000002 27.6 27.950000000000003 22.6125 30-31 22.1875 27.025 28.375 22.412499999999998 32-33 21.8 27.212500000000002 27.650000000000002 23.3375 34-35 21.775 27.8625 27.6625 22.7 36-37 21.675 27.0625 27.2625 24.0 38-39 22.3625 26.8375 27.462500000000002 23.3375 40-41 20.7625 27.487499999999997 29.125 22.625 42-43 21.85 27.675 28.7375 21.7375 44-45 22.8875 27.200000000000003 27.5125 22.400000000000002 46-47 22.8 28.4125 26.424999999999997 22.3625 48-49 21.65 28.012500000000003 28.1125 22.225 50-51 21.6875 26.3625 28.825 23.125 52-53 22.0125 26.775 28.249999999999996 22.9625 54-55 21.375 26.924999999999997 28.349999999999998 23.35 56-57 22.3625 26.775 28.275 22.5875 58-59 22.0125 27.6375 28.375 21.975 60-61 21.6 27.425 28.299999999999997 22.675 62-63 22.6 26.8 27.6125 22.9875 64-65 22.537499999999998 27.125 27.375 22.9625 66-67 21.55 27.0875 28.349999999999998 23.0125 68-69 22.0125 26.974999999999998 28.749999999999996 22.2625 70-71 21.3 27.650000000000002 28.375 22.675 72-73 21.212500000000002 27.0 28.475 23.3125 74-75 21.712500000000002 27.325 28.9375 22.025 76-77 22.15 26.787499999999998 28.95 22.112499999999997 78-79 21.3 27.5625 27.712500000000002 23.425 80-81 21.6 27.9375 27.6625 22.8 82-83 22.55 27.8625 28.175 21.4125 84-85 22.05 27.625 28.025 22.3 86-87 21.5625 27.712500000000002 27.5125 23.2125 88-89 22.925 26.7125 28.1875 22.175 90-91 21.712500000000002 27.450000000000003 28.287499999999998 22.55 92-93 22.5125 26.8375 28.299999999999997 22.35 94-95 22.675 27.8875 27.474999999999998 21.9625 96-97 22.6375 27.250000000000004 27.4125 22.7 98-99 22.287499999999998 27.900000000000002 28.7 21.1125 100-101 22.525000000000002 28.037499999999998 27.800000000000004 21.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 2.0 27 2.5 28 3.0 29 7.0 30 10.5 31 16.0 32 24.5 33 24.5 34 23.0 35 37.5 36 61.0 37 84.5 38 106.0 39 126.5 40 163.5 41 195.5 42 223.0 43 253.5 44 284.5 45 294.0 46 292.5 47 268.5 48 245.5 49 229.5 50 189.0 51 164.0 52 140.0 53 107.5 54 90.0 55 73.0 56 50.5 57 43.5 58 35.0 59 23.5 60 22.0 61 23.5 62 16.5 63 7.0 64 6.0 65 7.5 66 4.0 67 2.0 68 1.5 69 2.0 70 1.5 71 1.5 72 1.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4725050916497 96.7 2 1.2729124236252547 2.5 3 0.20366598778004072 0.6 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.11249999999999999 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0125 0.0 0.0 0.0 0.0 88-89 1.1749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864417 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864417_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.434 33.0 31.0 34.0 28.0 34.0 2 31.439 33.0 31.0 34.0 28.0 34.0 3 31.60075 34.0 31.0 34.0 28.0 34.0 4 35.081 37.0 35.0 37.0 32.0 37.0 5 34.92275 37.0 35.0 37.0 32.0 37.0 6 35.04025 37.0 35.0 37.0 32.0 37.0 7 35.129 37.0 35.0 37.0 32.0 37.0 8 34.9355 37.0 35.0 37.0 32.0 37.0 9 36.6065 39.0 37.0 39.0 32.0 39.0 10-11 36.58425 39.0 37.0 39.0 32.5 39.0 12-13 36.48125 39.0 37.0 39.0 32.0 39.0 14-15 37.79375 40.0 38.0 41.0 32.5 41.0 16-17 37.682125 40.0 38.0 41.0 32.0 41.0 18-19 37.7225 40.0 38.0 41.0 32.5 41.0 20-21 37.60375 40.0 38.0 41.0 32.0 41.0 22-23 37.551249999999996 40.0 38.0 41.0 32.0 41.0 24-25 37.315875 40.0 38.0 41.0 31.5 41.0 26-27 37.20225 40.0 37.5 41.0 31.0 41.0 28-29 37.068375 40.0 37.0 41.0 30.5 41.0 30-31 37.01049999999999 40.0 37.0 41.0 30.0 41.0 32-33 36.847 40.0 37.0 41.0 30.0 41.0 34-35 36.784875 40.0 37.0 41.0 30.0 41.0 36-37 36.568749999999994 40.0 37.0 41.0 30.0 41.0 38-39 36.41475 40.0 36.0 41.0 30.0 41.0 40-41 36.220625 39.0 36.0 41.0 29.0 41.0 42-43 35.9805 39.0 35.5 41.0 27.5 41.0 44-45 35.832125000000005 39.0 35.0 40.0 27.0 41.0 46-47 35.992125 39.0 36.0 41.0 28.0 41.0 48-49 35.6455 39.0 35.0 40.5 26.5 41.0 50-51 34.955749999999995 38.0 34.0 39.5 26.5 40.5 52-53 34.821 38.0 34.5 39.5 26.0 40.5 54-55 35.716750000000005 39.0 35.5 40.5 27.0 41.0 56-57 35.797250000000005 39.0 35.5 41.0 27.5 41.0 58-59 35.717 39.0 35.0 41.0 28.0 41.0 60-61 35.500125 39.0 35.0 41.0 27.5 41.0 62-63 35.10225 38.5 35.0 41.0 26.0 41.0 64-65 34.735375000000005 38.0 34.0 40.0 26.0 41.0 66-67 34.3595 37.0 34.0 40.0 25.5 41.0 68-69 33.992999999999995 37.0 34.0 39.0 25.5 41.0 70-71 33.504625 36.0 33.5 39.0 24.5 40.5 72-73 33.016625000000005 36.0 33.0 38.5 23.0 40.0 74-75 32.35075 35.0 32.0 37.0 21.5 39.0 76-77 32.02775 35.0 32.0 37.0 21.0 39.0 78-79 31.521875 35.0 32.0 36.5 20.0 38.5 80-81 31.34025 35.0 32.0 36.0 20.0 37.0 82-83 30.9535 35.0 31.5 35.5 18.5 37.0 84-85 30.552500000000002 35.0 31.0 35.0 17.5 36.5 86-87 30.341124999999998 34.0 31.0 35.0 16.0 36.0 88-89 30.010875 34.0 30.0 35.0 11.0 36.0 90-91 29.843125 34.0 31.0 35.0 7.0 35.5 92-93 29.5745 34.0 30.5 35.0 3.5 35.0 94-95 29.215875 34.0 30.0 35.0 2.0 35.0 96-97 28.905 34.0 30.0 35.0 2.0 35.0 98-99 28.407125 34.0 29.0 35.0 2.0 35.0 100-101 27.472875000000002 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 11.0 4 7.0 5 10.0 6 9.0 7 7.0 8 11.0 9 6.0 10 12.0 11 9.0 12 14.0 13 14.0 14 18.0 15 13.0 16 11.0 17 8.0 18 15.0 19 12.0 20 18.0 21 30.0 22 16.0 23 23.0 24 24.0 25 30.0 26 37.0 27 49.0 28 53.0 29 58.0 30 76.0 31 92.0 32 133.0 33 145.0 34 206.0 35 253.0 36 502.0 37 913.0 38 985.0 39 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 26.700000000000003 7.825 31.6 2 25.1 27.55 31.900000000000002 15.45 3 17.8 27.975 32.875 21.349999999999998 4 22.35 33.125 23.925 20.599999999999998 5 23.9 36.625 21.55 17.925 6 19.6 41.025 20.9 18.475 7 19.75 23.974999999999998 36.675000000000004 19.6 8 19.825 26.25 28.875 25.05 9 20.45 25.074999999999996 29.225 25.25 10-11 22.3625 32.0625 24.337500000000002 21.2375 12-13 23.674999999999997 27.500000000000004 26.437500000000004 22.3875 14-15 21.95 28.9875 26.924999999999997 22.1375 16-17 22.2 28.6125 26.700000000000003 22.4875 18-19 22.225 28.825 27.150000000000002 21.8 20-21 22.662499999999998 30.2125 26.55 20.575 22-23 23.05 28.575 27.375 21.0 24-25 21.525 28.799999999999997 27.3875 22.287499999999998 26-27 22.625 28.6375 27.075 21.6625 28-29 22.3625 28.449999999999996 27.275 21.912499999999998 30-31 21.55 27.800000000000004 27.224999999999998 23.425 32-33 21.75 28.349999999999998 27.3125 22.5875 34-35 22.400000000000002 28.799999999999997 27.3125 21.4875 36-37 21.4875 27.775 28.012500000000003 22.725 38-39 22.8625 28.3125 26.8625 21.9625 40-41 22.625 28.212500000000002 27.287499999999998 21.875 42-43 22.275 27.9375 27.425 22.3625 44-45 21.7 28.425 27.737499999999997 22.1375 46-47 22.9875 28.549999999999997 26.7125 21.75 48-49 22.675 28.787499999999998 26.8625 21.675 50-51 22.6125 26.75 28.212500000000002 22.425 52-53 22.2125 28.249999999999996 27.800000000000004 21.7375 54-55 22.05 27.962500000000002 27.450000000000003 22.537499999999998 56-57 21.6625 28.625 27.55 22.162499999999998 58-59 22.912499999999998 28.0875 26.8625 22.1375 60-61 21.6875 28.975 27.400000000000002 21.9375 62-63 22.0 29.3375 27.05 21.6125 64-65 22.625 27.987499999999997 27.375 22.0125 66-67 22.4375 27.150000000000002 28.037499999999998 22.375 68-69 22.3875 28.575 27.6625 21.375 70-71 22.900000000000002 28.599999999999998 27.3125 21.1875 72-73 23.175 28.000000000000004 26.687499999999996 22.1375 74-75 22.412499999999998 28.65 26.674999999999997 22.2625 76-77 23.175 27.8875 27.950000000000003 20.9875 78-79 22.8625 28.249999999999996 26.35 22.537499999999998 80-81 22.85 28.237499999999997 27.35 21.5625 82-83 23.2875 28.125 25.924999999999997 22.662499999999998 84-85 22.4375 28.487499999999997 26.3125 22.7625 86-87 22.725 28.599999999999998 27.175 21.5 88-89 22.9875 27.6875 26.6125 22.7125 90-91 22.7 28.825 26.687499999999996 21.7875 92-93 23.4625 28.175 26.6 21.762500000000003 94-95 23.400000000000002 28.275 26.375 21.95 96-97 23.2375 28.549999999999997 26.0625 22.15 98-99 22.537499999999998 29.175 26.787499999999998 21.5 100-101 23.825 28.65 26.150000000000002 21.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 2.5 26 4.5 27 4.5 28 4.5 29 8.5 30 12.0 31 15.5 32 23.5 33 31.5 34 39.5 35 53.0 36 76.5 37 100.5 38 125.0 39 170.0 40 215.0 41 224.5 42 244.0 43 271.5 44 285.5 45 302.5 46 282.5 47 244.5 48 211.5 49 178.0 50 167.0 51 146.0 52 111.5 53 99.0 54 81.5 55 49.5 56 42.5 57 44.5 58 29.0 59 17.0 60 13.0 61 13.5 62 11.5 63 6.5 64 3.5 65 3.0 66 3.5 67 2.5 68 2.5 69 4.0 70 3.5 71 1.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.11249999999999999 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.32499999999999996 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.8625 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865679 spots for ERR1864417.sra Written 865679 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra Read 865671 spots for ERR1864417.sra Written 865671 spots for ERR1864417.sra SRR ids: ['ERR1864417.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cr666ipa ERR1864417.sra spots: 17313428 blocks: [[1, 865671], [865672, 1731342], [1731343, 2597013], [2597014, 3462684], [3462685, 4328355], [4328356, 5194026], [5194027, 6059697], [6059698, 6925368], [6925369, 7791039], [7791040, 8656710], [8656711, 9522381], [9522382, 10388052], [10388053, 11253723], [11253724, 12119394], [12119395, 12985065], [12985066, 13850736], [13850737, 14716407], [14716408, 15582078], [15582079, 16447749], [16447750, 17313428]] ERR1864417 file size 4154487 ERR1864417 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864417 ERR1864417_1.fastq ERR1864417_2.fastq Input file: ERR1864417_1.fastq Paired file: ERR1864417_2.fastq trimmed: ERR1864417-trimmed-pair1.fastq, ERR1864417-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:47:23 2025 >> started Thu Feb 13 05:00:19 2025 >> done (775.710s) 17313428 read pairs processed; of these: 360564 ( 2.08%) short read pairs filtered out after trimming by size control 467321 ( 2.70%) empty read pairs filtered out after trimming by size control 16485543 (95.22%) read pairs available; of these: 3974298 (24.11%) trimmed read pairs available after processing 12511245 (75.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 142 0.00% 19 332 0.00% 20 545 0.00% 21 728 0.00% 22 899 0.01% 23 1124 0.01% 24 1331 0.01% 25 1651 0.01% 26 1778 0.01% 27 2029 0.01% 28 2449 0.01% 29 2799 0.02% 30 3153 0.02% 31 3562 0.02% 32 3895 0.02% 33 4321 0.03% 34 4821 0.03% 35 5250 0.03% 36 5484 0.03% 37 5882 0.04% 38 6103 0.04% 39 6630 0.04% 40 6957 0.04% 41 7315 0.04% 42 7668 0.05% 43 8178 0.05% 44 8582 0.05% 45 8956 0.05% 46 9306 0.06% 47 9813 0.06% 48 10114 0.06% 49 10711 0.06% 50 11198 0.07% 51 11717 0.07% 52 12165 0.07% 53 12932 0.08% 54 13411 0.08% 55 14025 0.09% 56 14772 0.09% 57 15492 0.09% 58 16385 0.10% 59 22247 0.13% 60 26399 0.16% 61 27229 0.17% 62 27405 0.17% 63 27858 0.17% 64 28846 0.17% 65 29189 0.18% 66 30396 0.18% 67 31081 0.19% 68 32288 0.20% 69 33690 0.20% 70 35084 0.21% 71 35985 0.22% 72 37964 0.23% 73 38973 0.24% 74 39972 0.24% 75 41623 0.25% 76 41564 0.25% 77 42693 0.26% 78 45687 0.28% 79 47673 0.29% 80 50237 0.30% 81 52850 0.32% 82 54908 0.33% 83 58370 0.35% 84 62240 0.38% 85 66156 0.40% 86 70350 0.43% 87 74382 0.45% 88 74890 0.45% 89 78280 0.47% 90 87441 0.53% 91 95872 0.58% 92 107893 0.65% 93 122084 0.74% 94 135669 0.82% 95 156217 0.95% 96 185956 1.13% 97 227049 1.38% 98 295129 1.79% 99 390291 2.37% 100 529583 3.21% 101 12511245 75.89% 16485543 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=41 prefix-density=0.38 prefix-fanout=2.0 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=102.53 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.9 sequence=AAGGAAGAGTACATGGCTGGCGGGGGCTTAACATAGAGGAGGACTAACGTGGCGGTGGAGTTGTGAGAAATAAGGTTGCTGAGACACCATGAAAGAGCATGCATGCTCTCCTCACTCTCATCCACTGCCACCACTAT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.36 prefix-fanout=1.9 sequence=GAGAACGATGGCAAGTGCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=93.04 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=12.8 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864417 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:30:50 Started mapping on | Feb 13 05:30:53 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 40.65 Number of input reads | 16485543 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15871640 Uniquely mapped reads % | 96.28% Average mapped length | 195.00 Number of splices: Total | 9327295 Number of splices: Annotated (sjdb) | 9178839 Number of splices: GT/AG | 9161225 Number of splices: GC/AG | 147589 Number of splices: AT/AC | 6545 Number of splices: Non-canonical | 11936 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.92 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391884 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 20157 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 270314 270314 270314 N_multimapping 391884 391884 391884 N_noFeature 439218 15720865 503146 N_ambiguous 141539 692 54384 UnstrandedReadsAssigned:15290883 PositiveStrandReadsAssigned:150083 NegativeStrandReadsAssigned:15314110 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864417 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864417-trimmed-pair1.fastq ERR1864417-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,485,543 reads, 15,507,134 reads pseudoaligned [quant] estimated average fragment length: 156.602 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52401 ERR1864417.ke.tsv 34699 ERR1864417.se.tsv 87100 total ==> ERR1864417.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1862.4 836 31.0906 Potri.005G024800.1.v4.1 1035 879.398 309 24.3371 Potri.004G059700.1.v4.1 961 805.398 16 1.37596 Potri.007G009000.2.v4.1 1416 1260.4 0 0 Potri.003G141000.2.v4.1 2943 2787.4 1135.7 28.2201 Potri.016G087400.1.v4.1 270 120.808 399 228.756 Potri.015G069301.1.v4.1 564 408.496 0 0 Potri.010G195200.1.v4.1 1773 1617.4 113 4.83901 Potri.012G127500.1.v4.1 977 821.398 1241 104.644 ==> ERR1864417.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 408 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 ERR1864417 completed mapping pipeline successfully