Starting /dee2/code/volunteer_pipeline.sh ERR1864418 current disk space = 3051994759168 free memory = 1582080688 ERR1864418 SRAfilesize 6d1c43eaa99f2fea69bf507af42198b9 ERR1864418.sra ERR1864418.sra file validated ERR1864418 is paired end ERR1864418 is conventional basespace ERR1864418 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864418_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.48775 33.0 31.0 34.0 30.0 34.0 2 31.886 34.0 31.0 34.0 30.0 34.0 3 32.01775 34.0 31.0 34.0 29.0 34.0 4 35.57025 37.0 35.0 37.0 33.0 37.0 5 35.25625 37.0 35.0 37.0 33.0 37.0 6 35.111 37.0 35.0 37.0 32.0 37.0 7 35.13925 37.0 35.0 37.0 32.0 37.0 8 35.1545 37.0 35.0 37.0 32.0 37.0 9 36.8145 39.0 37.0 39.0 33.0 39.0 10-11 36.76175 39.0 37.0 39.0 33.0 39.0 12-13 36.46575 39.0 37.0 39.0 32.0 39.0 14-15 37.938500000000005 40.0 38.0 41.0 33.0 41.0 16-17 37.8575 40.0 38.0 41.0 33.0 41.0 18-19 37.796499999999995 40.0 38.0 41.0 32.0 41.0 20-21 37.789874999999995 40.0 38.0 41.0 33.0 41.0 22-23 37.617875 40.0 38.0 41.0 32.0 41.0 24-25 37.52825 40.0 38.0 41.0 32.0 41.0 26-27 37.336375000000004 40.0 38.0 41.0 31.5 41.0 28-29 37.2475 40.0 37.5 41.0 31.5 41.0 30-31 37.07 40.0 37.5 41.0 30.5 41.0 32-33 36.913875000000004 40.0 37.0 41.0 30.5 41.0 34-35 36.797625 40.0 37.0 41.0 30.0 41.0 36-37 36.841499999999996 40.0 37.0 41.0 30.0 41.0 38-39 36.61425 40.0 36.5 41.0 30.0 41.0 40-41 36.489875 40.0 36.0 41.0 29.5 41.0 42-43 36.36425 40.0 36.0 41.0 29.5 41.0 44-45 36.2905 40.0 36.0 41.0 29.5 41.0 46-47 36.00775 39.0 35.5 41.0 28.5 41.0 48-49 36.366875 40.0 36.0 41.0 29.5 41.0 50-51 36.3025 40.0 36.0 41.0 29.5 41.0 52-53 36.196875000000006 40.0 36.0 41.0 29.0 41.0 54-55 35.963750000000005 39.5 35.5 41.0 28.5 41.0 56-57 35.709500000000006 39.0 35.0 41.0 28.0 41.0 58-59 35.549625000000006 39.0 35.0 41.0 27.5 41.0 60-61 35.32475 38.5 35.0 40.5 28.0 41.0 62-63 34.937 38.0 34.5 40.0 26.5 41.0 64-65 34.53275 37.5 34.0 40.0 26.0 41.0 66-67 34.111625000000004 37.0 33.5 40.0 25.0 41.0 68-69 33.831375 36.5 34.0 39.0 25.0 41.0 70-71 33.288624999999996 36.0 33.0 39.0 23.0 40.5 72-73 32.87925 35.5 32.5 39.0 23.0 40.0 74-75 32.422 35.0 32.0 37.5 22.5 39.0 76-77 31.339125 34.0 30.5 36.0 21.0 39.0 78-79 31.785375000000002 35.0 32.0 36.0 22.5 39.0 80-81 31.62475 35.0 32.0 36.0 22.0 37.0 82-83 31.22925 35.0 32.0 36.0 20.0 37.0 84-85 30.86225 35.0 31.5 35.0 19.0 36.5 86-87 30.473625 34.5 31.0 35.0 17.0 36.0 88-89 30.35725 34.0 31.0 35.0 13.5 36.0 90-91 30.031625 34.0 31.0 35.0 7.0 35.5 92-93 29.858375000000002 34.0 31.0 35.0 6.0 35.0 94-95 29.444499999999998 34.0 30.0 35.0 2.0 35.0 96-97 29.293375 34.0 30.0 35.0 2.0 35.0 98-99 29.031750000000002 34.0 30.0 35.0 2.0 35.0 100-101 27.708750000000002 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 43.0 3 24.0 4 9.0 5 6.0 6 9.0 7 10.0 8 9.0 9 5.0 10 9.0 11 7.0 12 9.0 13 17.0 14 15.0 15 10.0 16 7.0 17 19.0 18 11.0 19 18.0 20 14.0 21 18.0 22 14.0 23 11.0 24 22.0 25 25.0 26 38.0 27 47.0 28 39.0 29 57.0 30 73.0 31 86.0 32 130.0 33 143.0 34 229.0 35 281.0 36 485.0 37 855.0 38 1018.0 39 178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.82463253928028 6.969082615306639 3.7506335529650277 37.45565129244805 2 27.975 6.625 30.825000000000003 34.575 3 24.3 8.825 24.625 42.25 4 30.599999999999998 13.8 21.6 34.0 5 31.900000000000002 19.15 23.35 25.6 6 24.85 24.8 23.9 26.450000000000003 7 18.025 23.075000000000003 41.699999999999996 17.2 8 17.424999999999997 23.5 37.35 21.725 9 17.825 23.200000000000003 39.0 19.975 10-11 20.225 32.625 28.999999999999996 18.15 12-13 20.5375 26.325 31.900000000000002 21.2375 14-15 20.674999999999997 27.450000000000003 30.012499999999996 21.8625 16-17 21.987499999999997 27.925 28.5625 21.525 18-19 21.525 27.3125 28.625 22.537499999999998 20-21 19.8875 29.15 28.425 22.537499999999998 22-23 21.4875 28.0625 28.125 22.325 24-25 21.3625 27.5625 27.3625 23.7125 26-27 20.775 27.425 28.237499999999997 23.5625 28-29 21.8875 28.475 27.2625 22.375 30-31 21.975 28.15 26.7625 23.1125 32-33 21.5 28.037499999999998 27.8625 22.6 34-35 21.875 27.125 28.5875 22.412499999999998 36-37 21.9 26.650000000000002 27.8875 23.5625 38-39 21.8 26.875 27.5875 23.7375 40-41 21.725 27.775 27.900000000000002 22.6 42-43 21.8125 27.0625 28.7 22.425 44-45 21.125 26.924999999999997 29.625 22.325 46-47 21.875 27.575 27.962500000000002 22.5875 48-49 21.2625 26.974999999999998 29.15 22.6125 50-51 21.275 27.3625 28.025 23.3375 52-53 21.212500000000002 27.3625 28.000000000000004 23.425 54-55 21.125 27.462500000000002 28.299999999999997 23.1125 56-57 21.3625 27.625 28.5875 22.425 58-59 20.9125 27.200000000000003 28.7 23.1875 60-61 20.849999999999998 27.1625 27.8125 24.175 62-63 21.575 28.0875 27.55 22.787499999999998 64-65 22.325 27.762500000000003 27.55 22.3625 66-67 21.5375 27.712500000000002 28.237499999999997 22.5125 68-69 21.6 27.6625 27.725 23.0125 70-71 20.849999999999998 27.750000000000004 28.5875 22.8125 72-73 22.1 26.5375 28.65 22.7125 74-75 21.775 26.950000000000003 28.000000000000004 23.275000000000002 76-77 21.925 27.975 27.450000000000003 22.650000000000002 78-79 21.987499999999997 27.487499999999997 27.825 22.7 80-81 21.8 27.575 28.5875 22.037499999999998 82-83 22.2625 28.1 27.375 22.2625 84-85 21.85 27.1 28.375 22.675 86-87 22.275 26.6 27.700000000000003 23.425 88-89 21.1875 27.275 27.987499999999997 23.549999999999997 90-91 21.775 27.425 28.075 22.725 92-93 21.375 27.625 27.737499999999997 23.2625 94-95 21.212500000000002 27.5875 28.1625 23.0375 96-97 22.9375 27.750000000000004 26.674999999999997 22.6375 98-99 21.837500000000002 27.900000000000002 27.3125 22.95 100-101 22.3375 27.650000000000002 27.400000000000002 22.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 0.5 25 1.0 26 1.0 27 3.5 28 7.5 29 7.5 30 13.5 31 19.0 32 19.0 33 22.0 34 34.5 35 48.0 36 57.5 37 72.0 38 99.0 39 140.5 40 178.5 41 217.0 42 246.5 43 255.5 44 261.5 45 268.5 46 269.5 47 252.5 48 244.5 49 226.0 50 185.5 51 164.5 52 144.0 53 113.0 54 88.5 55 79.0 56 62.0 57 48.0 58 37.0 59 26.5 60 22.5 61 16.0 62 12.5 63 8.0 64 5.0 65 2.5 66 3.0 67 3.0 68 1.0 69 0.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78326996197718 97.425 2 1.0899873257287707 2.15 3 0.07604562737642585 0.22499999999999998 4 0.050697084917617236 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.1375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864418 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864418_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.413 33.0 31.0 34.0 30.0 34.0 2 31.37875 34.0 31.0 34.0 28.0 34.0 3 31.5085 34.0 31.0 34.0 28.0 34.0 4 34.93825 37.0 35.0 37.0 32.0 37.0 5 34.9415 37.0 35.0 37.0 32.0 37.0 6 34.933 37.0 35.0 37.0 32.0 37.0 7 34.99 37.0 35.0 37.0 33.0 37.0 8 34.891 37.0 35.0 37.0 32.0 37.0 9 36.6625 39.0 37.0 39.0 33.0 39.0 10-11 36.585375 39.0 37.0 39.0 33.0 39.0 12-13 36.46662499999999 39.0 37.0 39.0 32.0 39.0 14-15 37.818 40.0 38.0 41.0 33.0 41.0 16-17 37.664625 40.0 38.0 41.0 32.0 41.0 18-19 37.72475 40.0 38.0 41.0 32.5 41.0 20-21 37.626875 40.0 38.0 41.0 32.0 41.0 22-23 37.560375 40.0 38.0 41.0 32.0 41.0 24-25 37.443124999999995 40.0 38.0 41.0 32.0 41.0 26-27 37.286500000000004 40.0 38.0 41.0 31.0 41.0 28-29 37.205375000000004 40.0 38.0 41.0 31.0 41.0 30-31 37.131125 40.0 38.0 41.0 31.0 41.0 32-33 36.91625 40.0 37.0 41.0 30.0 41.0 34-35 36.843999999999994 40.0 37.0 41.0 30.0 41.0 36-37 36.604 40.0 37.0 41.0 30.0 41.0 38-39 36.41625 40.0 37.0 41.0 30.0 41.0 40-41 36.289875 40.0 36.0 41.0 29.5 41.0 42-43 36.031875 39.5 36.0 41.0 28.0 41.0 44-45 35.8715 39.0 35.5 40.5 28.0 41.0 46-47 35.97925 39.0 36.0 41.0 27.5 41.0 48-49 35.684125 39.0 35.0 41.0 27.0 41.0 50-51 34.8935 38.5 34.0 40.0 25.5 40.5 52-53 34.862 38.0 34.0 39.5 26.0 40.5 54-55 35.765875 39.0 35.5 40.5 27.5 41.0 56-57 35.637125 39.0 35.0 41.0 27.0 41.0 58-59 35.61725 39.0 35.0 41.0 27.5 41.0 60-61 35.39075 39.0 35.0 41.0 26.5 41.0 62-63 35.103125 38.5 34.5 40.5 26.5 41.0 64-65 34.6245 38.0 34.0 40.0 26.0 41.0 66-67 34.28475 37.0 34.0 40.0 26.0 41.0 68-69 33.96525 37.0 34.0 39.0 26.0 41.0 70-71 33.507875 36.0 33.5 39.0 24.5 41.0 72-73 32.964749999999995 35.5 33.0 38.5 23.0 40.0 74-75 32.41 35.0 33.0 37.0 21.0 39.0 76-77 32.01675 35.0 32.0 37.0 20.5 39.0 78-79 31.542749999999998 35.0 32.0 36.5 20.0 38.5 80-81 31.374375 35.0 32.0 36.0 20.5 37.0 82-83 30.872 35.0 31.0 35.5 18.0 37.0 84-85 30.582875 35.0 31.0 35.0 18.0 36.5 86-87 30.3875 34.0 31.0 35.0 17.5 36.0 88-89 30.068125000000002 34.0 31.0 35.0 9.0 36.0 90-91 29.85125 34.0 31.0 35.0 7.0 35.5 92-93 29.543750000000003 34.0 30.0 35.0 2.0 35.0 94-95 29.231250000000003 34.0 30.0 35.0 2.0 35.0 96-97 28.829250000000002 34.0 29.5 35.0 2.0 35.0 98-99 28.339624999999998 34.0 29.0 35.0 2.0 35.0 100-101 27.458375 33.5 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 14.0 4 9.0 5 8.0 6 5.0 7 8.0 8 12.0 9 8.0 10 15.0 11 8.0 12 12.0 13 8.0 14 9.0 15 13.0 16 11.0 17 14.0 18 21.0 19 6.0 20 21.0 21 22.0 22 21.0 23 18.0 24 30.0 25 28.0 26 39.0 27 35.0 28 48.0 29 49.0 30 83.0 31 98.0 32 106.0 33 143.0 34 182.0 35 307.0 36 472.0 37 959.0 38 965.0 39 133.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.25 26.700000000000003 8.450000000000001 30.599999999999998 2 26.6 25.1 31.3 17.0 3 18.675 26.924999999999997 31.924999999999997 22.475 4 22.825 32.175 25.05 19.950000000000003 5 25.624999999999996 35.4 21.45 17.525 6 20.4 39.75 21.7 18.15 7 20.625 23.400000000000002 36.525 19.45 8 20.625 25.6 29.025000000000002 24.75 9 21.55 24.8 29.775000000000002 23.875 10-11 22.237499999999997 31.65 24.5625 21.55 12-13 22.725 26.787499999999998 28.1125 22.375 14-15 22.400000000000002 27.55 27.200000000000003 22.85 16-17 22.7375 29.037499999999998 26.525 21.7 18-19 22.6875 29.825000000000003 27.400000000000002 20.0875 20-21 22.650000000000002 29.2 26.974999999999998 21.175 22-23 22.375 28.9125 27.3375 21.375 24-25 21.6625 28.3875 27.187499999999996 22.7625 26-27 22.7125 28.7375 27.2625 21.2875 28-29 22.237499999999997 29.1375 26.787499999999998 21.837500000000002 30-31 22.825 28.4125 26.900000000000002 21.8625 32-33 22.825 28.9375 27.1625 21.075 34-35 22.4375 28.787499999999998 27.6 21.175 36-37 22.4375 27.650000000000002 27.8875 22.025 38-39 22.0625 28.8375 26.8375 22.2625 40-41 22.225 29.4125 28.000000000000004 20.3625 42-43 22.6 28.6375 27.0625 21.7 44-45 22.725 27.800000000000004 26.937499999999996 22.537499999999998 46-47 22.9875 27.500000000000004 27.737499999999997 21.775 48-49 22.9875 28.212500000000002 27.6625 21.1375 50-51 22.7625 28.775000000000002 26.35 22.112499999999997 52-53 23.225 28.125 26.55 22.1 54-55 22.625 28.5625 27.3 21.512500000000003 56-57 22.8625 28.712500000000002 26.924999999999997 21.5 58-59 22.650000000000002 28.275 27.250000000000004 21.825 60-61 22.85 28.262500000000003 26.8 22.0875 62-63 22.8 28.525 26.937499999999996 21.7375 64-65 22.5125 28.825 26.85 21.8125 66-67 22.45 28.299999999999997 27.625 21.625 68-69 22.412499999999998 29.1375 26.987499999999997 21.462500000000002 70-71 23.5625 27.675 27.675 21.087500000000002 72-73 23.1875 29.0875 27.4125 20.3125 74-75 23.3625 28.025 27.474999999999998 21.1375 76-77 22.85 29.062500000000004 26.5625 21.525 78-79 23.225 28.1375 26.8125 21.825 80-81 22.95 27.800000000000004 27.5875 21.6625 82-83 23.5625 29.15 26.1625 21.125 84-85 22.45 28.287499999999998 27.55 21.712500000000002 86-87 23.3 28.8875 27.037499999999998 20.775 88-89 23.4625 28.5875 26.2875 21.6625 90-91 22.575 28.537499999999998 27.175 21.712500000000002 92-93 22.8875 29.15 27.325 20.6375 94-95 23.150000000000002 27.6125 26.7625 22.475 96-97 22.95 28.287499999999998 27.325 21.4375 98-99 23.9125 27.825 26.8 21.462500000000002 100-101 23.3625 28.4125 26.05 22.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 2.0 22 2.5 23 1.5 24 2.0 25 3.0 26 5.5 27 6.5 28 5.5 29 9.0 30 12.0 31 13.0 32 19.0 33 30.0 34 49.5 35 55.0 36 65.5 37 98.0 38 135.0 39 172.5 40 203.0 41 236.0 42 268.0 43 283.5 44 282.0 45 274.0 46 250.0 47 235.5 48 228.5 49 210.5 50 173.5 51 133.0 52 105.5 53 83.0 54 81.0 55 71.5 56 49.5 57 33.0 58 27.0 59 20.0 60 12.5 61 9.5 62 7.0 63 6.5 64 6.0 65 5.5 66 3.0 67 2.5 68 2.0 69 1.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra Read 821211 spots for ERR1864418.sra Written 821211 spots for ERR1864418.sra SRR ids: ['ERR1864418.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z4ygq2_y ERR1864418.sra spots: 16424220 blocks: [[1, 821211], [821212, 1642422], [1642423, 2463633], [2463634, 3284844], [3284845, 4106055], [4106056, 4927266], [4927267, 5748477], [5748478, 6569688], [6569689, 7390899], [7390900, 8212110], [8212111, 9033321], [9033322, 9854532], [9854533, 10675743], [10675744, 11496954], [11496955, 12318165], [12318166, 13139376], [13139377, 13960587], [13960588, 14781798], [14781799, 15603009], [15603010, 16424220]] ERR1864418 file size 3940001 ERR1864418 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864418 ERR1864418_1.fastq ERR1864418_2.fastq Input file: ERR1864418_1.fastq Paired file: ERR1864418_2.fastq trimmed: ERR1864418-trimmed-pair1.fastq, ERR1864418-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:51:42 2025 >> started Thu Feb 13 05:01:16 2025 >> done (574.730s) 16424220 read pairs processed; of these: 314549 ( 1.92%) short read pairs filtered out after trimming by size control 406371 ( 2.47%) empty read pairs filtered out after trimming by size control 15703300 (95.61%) read pairs available; of these: 3685659 (23.47%) trimmed read pairs available after processing 12017641 (76.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 135 0.00% 19 305 0.00% 20 434 0.00% 21 594 0.00% 22 753 0.00% 23 977 0.01% 24 1198 0.01% 25 1345 0.01% 26 1616 0.01% 27 1883 0.01% 28 2185 0.01% 29 2337 0.01% 30 2773 0.02% 31 3111 0.02% 32 3448 0.02% 33 3754 0.02% 34 4165 0.03% 35 4550 0.03% 36 4898 0.03% 37 5137 0.03% 38 5373 0.03% 39 6018 0.04% 40 6336 0.04% 41 6420 0.04% 42 6923 0.04% 43 7144 0.05% 44 7654 0.05% 45 7925 0.05% 46 8265 0.05% 47 8728 0.06% 48 9037 0.06% 49 9482 0.06% 50 9944 0.06% 51 10465 0.07% 52 10896 0.07% 53 11284 0.07% 54 11870 0.08% 55 12617 0.08% 56 13323 0.08% 57 13885 0.09% 58 14624 0.09% 59 19819 0.13% 60 23804 0.15% 61 24340 0.15% 62 24402 0.16% 63 25502 0.16% 64 25951 0.17% 65 26727 0.17% 66 27149 0.17% 67 28107 0.18% 68 29495 0.19% 69 30799 0.20% 70 31558 0.20% 71 33079 0.21% 72 34789 0.22% 73 35495 0.23% 74 36868 0.23% 75 37993 0.24% 76 37929 0.24% 77 39597 0.25% 78 41868 0.27% 79 44068 0.28% 80 46880 0.30% 81 48326 0.31% 82 51080 0.33% 83 54143 0.34% 84 57715 0.37% 85 61649 0.39% 86 64829 0.41% 87 69339 0.44% 88 69175 0.44% 89 72270 0.46% 90 80907 0.52% 91 89835 0.57% 92 100247 0.64% 93 112944 0.72% 94 126870 0.81% 95 146939 0.94% 96 173219 1.10% 97 212023 1.35% 98 276085 1.76% 99 367920 2.34% 100 500114 3.18% 101 12017641 76.53% 15703300 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.47 prefix-fanout=2.0 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=299.94 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=30.7 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=33 prefix-density=0.45 prefix-fanout=2.0 sequence=GAGAACGATGGCAAGTGCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=330.01 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=29.5 sequence=AAGAAGAAGAAA ERR1864418 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:37:45 Started mapping on | Feb 13 05:37:57 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 54.57 Number of input reads | 15703300 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15063503 Uniquely mapped reads % | 95.93% Average mapped length | 195.28 Number of splices: Total | 8913420 Number of splices: Annotated (sjdb) | 8772311 Number of splices: GT/AG | 8761785 Number of splices: GC/AG | 133191 Number of splices: AT/AC | 6544 Number of splices: Non-canonical | 11900 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 3.05 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410156 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 18453 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.33% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 271708 271708 271708 N_multimapping 410156 410156 410156 N_noFeature 396430 14901766 475198 N_ambiguous 132376 577 49098 UnstrandedReadsAssigned:14534697 PositiveStrandReadsAssigned:161160 NegativeStrandReadsAssigned:14539207 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864418 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864418-trimmed-pair1.fastq ERR1864418-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,703,300 reads, 14,766,953 reads pseudoaligned [quant] estimated average fragment length: 157.511 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 ERR1864418.ke.tsv 34699 ERR1864418.se.tsv 87100 total ==> ERR1864418.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1861.49 1139 43.1517 Potri.005G024800.1.v4.1 1035 878.489 388 31.148 Potri.004G059700.1.v4.1 961 804.489 31 2.71754 Potri.007G009000.2.v4.1 1416 1259.49 0 0 Potri.003G141000.2.v4.1 2943 2786.49 1064 26.9289 Potri.016G087400.1.v4.1 270 119.738 573 337.487 Potri.015G069301.1.v4.1 564 407.557 0 0 Potri.010G195200.1.v4.1 1773 1616.49 162 7.06767 Potri.012G127500.1.v4.1 977 820.489 2343 201.388 ==> ERR1864418.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 225 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 ERR1864418 completed mapping pipeline successfully