Starting /dee2/code/volunteer_pipeline.sh ERR1864419 current disk space = 3052034437120 free memory = 1582141916 ERR1864419 SRAfilesize 64fc868b7c83a53690a84e9267a65849 ERR1864419.sra ERR1864419.sra file validated ERR1864419 is paired end ERR1864419 is conventional basespace ERR1864419 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864419_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5095 33.0 31.0 34.0 30.0 34.0 2 31.934 34.0 31.0 34.0 30.0 34.0 3 32.036 34.0 31.0 34.0 30.0 34.0 4 35.58775 37.0 35.0 37.0 33.0 37.0 5 35.3685 37.0 35.0 37.0 33.0 37.0 6 35.25875 37.0 35.0 37.0 33.0 37.0 7 35.21975 37.0 35.0 37.0 33.0 37.0 8 35.27525 37.0 35.0 37.0 33.0 37.0 9 36.84875 39.0 37.0 39.0 33.0 39.0 10-11 36.856625 39.0 37.0 39.0 33.0 39.0 12-13 36.608125 39.0 37.0 39.0 32.5 39.0 14-15 38.064 40.0 38.0 41.0 33.0 41.0 16-17 37.963375 40.0 38.0 41.0 33.0 41.0 18-19 37.890125 40.0 38.0 41.0 33.0 41.0 20-21 37.89275000000001 40.0 38.0 41.0 32.5 41.0 22-23 37.708625 40.0 38.0 41.0 32.0 41.0 24-25 37.657 40.0 38.0 41.0 32.0 41.0 26-27 37.53575 40.0 38.0 41.0 32.0 41.0 28-29 37.369 40.0 38.0 41.0 32.0 41.0 30-31 37.193375 40.0 37.0 41.0 31.5 41.0 32-33 37.04025 40.0 37.0 41.0 30.5 41.0 34-35 36.953875 40.0 37.0 41.0 31.0 41.0 36-37 36.999750000000006 40.0 37.0 41.0 31.0 41.0 38-39 36.7565 40.0 37.0 41.0 30.0 41.0 40-41 36.682874999999996 40.0 36.5 41.0 30.0 41.0 42-43 36.659375 40.0 37.0 41.0 30.0 41.0 44-45 36.421 40.0 36.0 41.0 30.0 41.0 46-47 36.29025 39.0 36.0 41.0 29.5 41.0 48-49 36.575375 40.0 36.5 41.0 30.0 41.0 50-51 36.606 40.0 36.5 41.0 30.0 41.0 52-53 36.5095 40.0 36.0 41.0 30.0 41.0 54-55 36.157375 39.0 35.5 41.0 29.5 41.0 56-57 35.9615 39.0 35.0 41.0 28.0 41.0 58-59 35.668 39.0 35.0 41.0 28.0 41.0 60-61 35.393874999999994 39.0 35.0 40.5 27.0 41.0 62-63 35.07125 38.0 34.0 40.0 27.0 41.0 64-65 34.690749999999994 37.5 34.0 40.0 26.5 41.0 66-67 34.364999999999995 37.0 34.0 40.0 26.0 41.0 68-69 33.9875 37.0 34.0 39.5 26.0 41.0 70-71 33.486875 36.0 33.0 39.0 25.0 40.5 72-73 33.057500000000005 36.0 33.0 39.0 24.5 40.0 74-75 32.64775 35.0 32.0 37.5 23.5 39.5 76-77 31.557375 34.5 31.0 36.0 22.0 39.0 78-79 31.944375 35.0 32.0 36.5 23.0 39.0 80-81 31.790375 35.0 32.0 36.0 23.5 37.5 82-83 31.464125000000003 35.0 32.0 36.0 22.5 37.0 84-85 31.15475 35.0 32.0 35.0 21.0 37.0 86-87 30.813125 35.0 31.0 35.0 20.0 36.0 88-89 30.599249999999998 34.5 31.0 35.0 18.5 36.0 90-91 30.20675 34.0 31.0 35.0 16.0 36.0 92-93 29.914749999999998 34.0 31.0 35.0 7.0 35.0 94-95 29.570625 34.0 30.0 35.0 2.0 35.0 96-97 29.422875 34.0 30.5 35.0 2.0 35.0 98-99 29.122999999999998 34.0 30.5 35.0 2.0 35.0 100-101 27.895125 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 22.0 4 13.0 5 12.0 6 10.0 7 5.0 8 4.0 9 8.0 10 6.0 11 9.0 12 7.0 13 10.0 14 13.0 15 19.0 16 7.0 17 18.0 18 10.0 19 13.0 20 22.0 21 11.0 22 17.0 23 20.0 24 17.0 25 27.0 26 31.0 27 36.0 28 40.0 29 70.0 30 73.0 31 88.0 32 95.0 33 161.0 34 197.0 35 317.0 36 461.0 37 916.0 38 1002.0 39 182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.152284263959395 7.233502538071066 3.451776649746193 34.162436548223354 2 27.474999999999998 5.975 33.275 33.275 3 24.6 9.6 22.775000000000002 43.025000000000006 4 29.599999999999998 14.649999999999999 22.825 32.925 5 29.2 20.7 25.074999999999996 25.025 6 24.9 25.6 25.624999999999996 23.875 7 17.9 22.0 43.35 16.75 8 17.45 23.25 36.375 22.925 9 17.849999999999998 22.825 38.574999999999996 20.75 10-11 20.3375 33.0875 29.2 17.375 12-13 20.75 26.174999999999997 32.6 20.474999999999998 14-15 20.4 28.537499999999998 30.2625 20.8 16-17 21.349999999999998 27.3 29.599999999999998 21.75 18-19 21.6625 27.625 28.8625 21.85 20-21 21.3875 27.5125 28.475 22.625 22-23 21.2375 27.875 28.462500000000002 22.425 24-25 20.4875 27.250000000000004 28.775000000000002 23.4875 26-27 19.775000000000002 27.55 28.9875 23.6875 28-29 21.95 28.5875 27.212500000000002 22.25 30-31 21.175 27.725 28.9 22.2 32-33 21.837500000000002 25.924999999999997 28.4375 23.799999999999997 34-35 21.5375 28.125 27.650000000000002 22.6875 36-37 20.8625 26.8375 28.875 23.425 38-39 21.5 26.4125 29.175 22.912499999999998 40-41 22.1875 27.0625 27.875 22.875 42-43 21.5375 28.1375 28.249999999999996 22.075 44-45 22.3 27.474999999999998 28.425 21.8 46-47 22.5875 27.275 27.737499999999997 22.400000000000002 48-49 21.4375 27.650000000000002 28.375 22.537499999999998 50-51 21.224999999999998 27.3125 28.462500000000002 23.0 52-53 21.275 27.425 28.7375 22.5625 54-55 21.762500000000003 27.237499999999997 28.4375 22.5625 56-57 21.65 26.3625 29.7375 22.25 58-59 22.05 27.6 27.712500000000002 22.6375 60-61 21.05 28.3875 27.787499999999998 22.775000000000002 62-63 21.224999999999998 28.475 27.675 22.625 64-65 21.1125 26.8375 29.375 22.675 66-67 21.4375 27.400000000000002 28.475 22.6875 68-69 21.6875 27.5625 27.9125 22.8375 70-71 21.45 28.1 28.1625 22.287499999999998 72-73 21.325 27.425 28.3625 22.8875 74-75 21.3125 27.975 28.0875 22.625 76-77 22.0125 27.900000000000002 27.224999999999998 22.8625 78-79 22.3375 27.85 28.075 21.7375 80-81 22.287499999999998 26.5375 28.787499999999998 22.3875 82-83 21.3125 28.1375 28.075 22.475 84-85 21.4 27.725 28.375 22.5 86-87 21.6 27.6125 27.500000000000004 23.2875 88-89 22.5125 26.775 28.262500000000003 22.45 90-91 21.7 27.55 28.025 22.725 92-93 21.5625 28.3625 27.8875 22.1875 94-95 20.925 28.15 28.012500000000003 22.912499999999998 96-97 22.05 26.737499999999997 28.487499999999997 22.725 98-99 22.125 27.85 27.537499999999998 22.4875 100-101 22.4875 27.6 27.35 22.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 2.5 24 4.5 25 4.0 26 6.0 27 5.5 28 7.5 29 9.5 30 8.5 31 17.5 32 24.0 33 30.0 34 46.0 35 55.0 36 67.5 37 92.5 38 116.0 39 142.5 40 178.0 41 214.0 42 232.0 43 250.0 44 273.5 45 289.5 46 275.0 47 236.5 48 214.0 49 207.0 50 190.5 51 160.5 52 130.5 53 112.0 54 94.5 55 71.5 56 51.0 57 40.0 58 35.0 59 26.0 60 20.5 61 14.5 62 8.5 63 7.5 64 7.0 65 4.0 66 3.5 67 5.0 68 3.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78172588832487 97.3 2 0.9898477157360406 1.95 3 0.15228426395939085 0.44999999999999996 4 0.07614213197969542 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.5375 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864419 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864419_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.581 33.0 31.0 34.0 30.0 34.0 2 31.56025 34.0 31.0 34.0 28.0 34.0 3 31.6455 34.0 31.0 34.0 28.0 34.0 4 35.056 37.0 35.0 37.0 33.0 37.0 5 35.1215 37.0 35.0 37.0 33.0 37.0 6 35.167 37.0 35.0 37.0 33.0 37.0 7 35.251 37.0 35.0 37.0 33.0 37.0 8 35.17075 37.0 35.0 37.0 33.0 37.0 9 36.8435 39.0 37.0 39.0 33.0 39.0 10-11 36.759625 39.0 37.0 39.0 33.0 39.0 12-13 36.67675 39.0 37.0 39.0 32.5 39.0 14-15 38.065 40.5 38.0 41.0 33.0 41.0 16-17 37.953374999999994 40.0 38.0 41.0 32.5 41.0 18-19 37.905375 40.0 38.0 41.0 32.5 41.0 20-21 37.863749999999996 40.0 38.0 41.0 32.0 41.0 22-23 37.855999999999995 40.0 38.0 41.0 32.5 41.0 24-25 37.767250000000004 40.0 38.0 41.0 32.5 41.0 26-27 37.53275 40.0 38.0 41.0 32.0 41.0 28-29 37.45925 40.0 38.0 41.0 32.0 41.0 30-31 37.248625000000004 40.0 38.0 41.0 31.0 41.0 32-33 37.0155 40.0 37.5 41.0 30.5 41.0 34-35 36.999875 40.0 37.0 41.0 30.5 41.0 36-37 36.75025 40.0 37.0 41.0 30.0 41.0 38-39 36.55775 40.0 37.0 41.0 29.5 41.0 40-41 36.431375 40.0 36.5 41.0 30.0 41.0 42-43 36.22125 39.0 36.0 41.0 29.5 41.0 44-45 36.11775 39.0 36.0 40.5 29.5 41.0 46-47 36.2085 39.0 36.0 41.0 29.5 41.0 48-49 35.8735 39.0 36.0 41.0 27.5 41.0 50-51 35.065 38.0 34.0 39.5 27.0 40.5 52-53 35.09525 38.0 34.5 39.5 26.5 40.5 54-55 35.916624999999996 39.0 36.0 40.5 28.0 41.0 56-57 35.8515 39.0 35.5 41.0 27.5 41.0 58-59 35.9015 39.0 35.5 41.0 28.0 41.0 60-61 35.5265 39.0 35.0 41.0 27.5 41.0 62-63 35.31575 38.5 35.0 40.5 27.0 41.0 64-65 34.93825 38.0 35.0 40.0 26.5 41.0 66-67 34.588 37.5 34.0 40.0 26.0 41.0 68-69 34.162125 37.0 34.0 39.0 26.0 41.0 70-71 33.680875 36.0 34.0 39.0 25.5 41.0 72-73 33.20225 36.0 33.0 38.5 25.0 40.0 74-75 32.78425 35.0 33.0 37.0 24.5 39.0 76-77 32.373374999999996 35.0 32.5 37.0 23.5 39.0 78-79 31.935499999999998 35.0 32.0 36.5 22.5 38.5 80-81 31.570875 35.0 32.0 36.0 21.0 37.0 82-83 31.155875 35.0 32.0 35.5 20.0 37.0 84-85 30.773375 35.0 31.5 35.0 18.0 36.5 86-87 30.507125 34.0 31.0 35.0 18.5 36.0 88-89 30.185375 34.0 31.0 35.0 14.0 36.0 90-91 30.062125 34.0 31.0 35.0 11.0 35.0 92-93 29.715249999999997 34.0 30.5 35.0 4.5 35.0 94-95 29.387875 34.0 30.0 35.0 2.0 35.0 96-97 29.002249999999997 34.0 30.0 35.0 2.0 35.0 98-99 28.4315 34.0 29.0 35.0 2.0 35.0 100-101 27.57125 33.5 27.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 44.0 3 8.0 4 6.0 5 8.0 6 3.0 7 13.0 8 8.0 9 7.0 10 11.0 11 17.0 12 12.0 13 7.0 14 13.0 15 11.0 16 14.0 17 15.0 18 13.0 19 15.0 20 13.0 21 17.0 22 26.0 23 24.0 24 31.0 25 30.0 26 23.0 27 42.0 28 55.0 29 61.0 30 78.0 31 72.0 32 110.0 33 134.0 34 193.0 35 297.0 36 530.0 37 927.0 38 973.0 39 139.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.5 27.125 7.825 30.55 2 26.275 25.424999999999997 32.574999999999996 15.725 3 18.8 27.474999999999998 32.85 20.875 4 22.2 33.900000000000006 24.375 19.525000000000002 5 24.125 36.275 21.8 17.8 6 19.7 38.9 21.6 19.8 7 19.6 23.150000000000002 36.85 20.4 8 20.825 26.325 28.050000000000004 24.8 9 21.0 23.974999999999998 31.5 23.525 10-11 22.725 32.425 24.0125 20.837500000000002 12-13 22.9625 26.487500000000004 28.512500000000003 22.037499999999998 14-15 22.175 28.799999999999997 27.8125 21.212500000000002 16-17 22.3375 27.950000000000003 27.6625 22.05 18-19 21.675 29.475 27.35 21.5 20-21 22.45 29.099999999999998 26.5625 21.8875 22-23 22.2625 28.712500000000002 26.825 22.2 24-25 22.237499999999997 27.8875 28.375 21.5 26-27 22.875 29.0875 26.5625 21.475 28-29 21.975 29.349999999999998 27.224999999999998 21.45 30-31 22.5875 27.950000000000003 27.6 21.8625 32-33 22.4625 28.8625 27.700000000000003 20.974999999999998 34-35 22.1875 28.7 27.6875 21.425 36-37 22.912499999999998 28.3125 27.450000000000003 21.325 38-39 22.725 28.925 26.875 21.475 40-41 23.3125 27.712500000000002 27.200000000000003 21.775 42-43 22.1375 28.375 27.224999999999998 22.2625 44-45 22.3375 29.175 27.2625 21.224999999999998 46-47 22.7375 28.449999999999996 26.5875 22.225 48-49 22.3375 28.1375 27.8375 21.6875 50-51 22.3625 28.749999999999996 27.187499999999996 21.7 52-53 22.237499999999997 28.199999999999996 27.375 22.1875 54-55 21.6 27.9375 28.825 21.637500000000003 56-57 22.8125 27.8625 26.987499999999997 22.3375 58-59 22.662499999999998 28.537499999999998 27.2625 21.5375 60-61 22.3 27.962500000000002 28.449999999999996 21.2875 62-63 22.037499999999998 29.4 27.0125 21.55 64-65 23.0375 28.487499999999997 27.0875 21.3875 66-67 22.325 28.3625 27.025 22.287499999999998 68-69 22.237499999999997 28.9875 27.0 21.775 70-71 23.375 28.237499999999997 27.200000000000003 21.1875 72-73 23.5125 28.475 27.3875 20.625 74-75 21.912499999999998 29.625 27.1125 21.349999999999998 76-77 23.425 28.1875 27.1375 21.25 78-79 23.075000000000003 28.375 27.0125 21.5375 80-81 22.45 28.225 27.975 21.349999999999998 82-83 23.599999999999998 27.237499999999997 27.0625 22.1 84-85 22.225 28.725 26.650000000000002 22.400000000000002 86-87 22.15 29.15 27.150000000000002 21.55 88-89 22.8 28.499999999999996 26.937499999999996 21.762500000000003 90-91 23.175 27.9375 26.8125 22.075 92-93 22.900000000000002 28.537499999999998 27.6875 20.875 94-95 22.9875 28.599999999999998 26.7625 21.65 96-97 23.6125 28.237499999999997 27.500000000000004 20.65 98-99 23.4125 28.499999999999996 26.150000000000002 21.9375 100-101 23.1375 29.762499999999996 26.3 20.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 5.5 26 4.5 27 4.0 28 8.5 29 11.0 30 13.5 31 18.0 32 25.0 33 38.5 34 48.5 35 55.0 36 80.5 37 115.5 38 141.0 39 166.5 40 193.5 41 235.5 42 267.0 43 276.5 44 271.0 45 274.5 46 265.5 47 234.5 48 214.0 49 185.0 50 162.5 51 139.0 52 108.0 53 85.0 54 72.5 55 59.0 56 45.5 57 39.0 58 29.0 59 19.5 60 19.5 61 16.5 62 9.5 63 5.5 64 4.0 65 3.0 66 3.0 67 3.0 68 2.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794582 spots for ERR1864419.sra Written 794582 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra Read 794577 spots for ERR1864419.sra Written 794577 spots for ERR1864419.sra SRR ids: ['ERR1864419.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w8ho6qrq ERR1864419.sra spots: 15891545 blocks: [[1, 794577], [794578, 1589154], [1589155, 2383731], [2383732, 3178308], [3178309, 3972885], [3972886, 4767462], [4767463, 5562039], [5562040, 6356616], [6356617, 7151193], [7151194, 7945770], [7945771, 8740347], [8740348, 9534924], [9534925, 10329501], [10329502, 11124078], [11124079, 11918655], [11918656, 12713232], [12713233, 13507809], [13507810, 14302386], [14302387, 15096963], [15096964, 15891545]] ERR1864419 file size 3811514 ERR1864419 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864419 ERR1864419_1.fastq ERR1864419_2.fastq Input file: ERR1864419_1.fastq Paired file: ERR1864419_2.fastq trimmed: ERR1864419-trimmed-pair1.fastq, ERR1864419-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:39:33 2025 >> started Thu Feb 13 04:47:28 2025 >> done (475.332s) 15891545 read pairs processed; of these: 317203 ( 2.00%) short read pairs filtered out after trimming by size control 401608 ( 2.53%) empty read pairs filtered out after trimming by size control 15172734 (95.48%) read pairs available; of these: 3605227 (23.76%) trimmed read pairs available after processing 11567507 (76.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 143 0.00% 19 299 0.00% 20 484 0.00% 21 603 0.00% 22 795 0.01% 23 1048 0.01% 24 1131 0.01% 25 1453 0.01% 26 1664 0.01% 27 1841 0.01% 28 2148 0.01% 29 2461 0.02% 30 2817 0.02% 31 3210 0.02% 32 3561 0.02% 33 3894 0.03% 34 4287 0.03% 35 4637 0.03% 36 4862 0.03% 37 5240 0.03% 38 5533 0.04% 39 5888 0.04% 40 6126 0.04% 41 6621 0.04% 42 6857 0.05% 43 7470 0.05% 44 7542 0.05% 45 8154 0.05% 46 8433 0.06% 47 8647 0.06% 48 9286 0.06% 49 9518 0.06% 50 10151 0.07% 51 10828 0.07% 52 11025 0.07% 53 11346 0.07% 54 12168 0.08% 55 12644 0.08% 56 13410 0.09% 57 14031 0.09% 58 14856 0.10% 59 19807 0.13% 60 24024 0.16% 61 24426 0.16% 62 24627 0.16% 63 24994 0.16% 64 25588 0.17% 65 26433 0.17% 66 27253 0.18% 67 27884 0.18% 68 29302 0.19% 69 30836 0.20% 70 31830 0.21% 71 32916 0.22% 72 34612 0.23% 73 35638 0.23% 74 36441 0.24% 75 38239 0.25% 76 37854 0.25% 77 39413 0.26% 78 41767 0.28% 79 43717 0.29% 80 46037 0.30% 81 48413 0.32% 82 50804 0.33% 83 53356 0.35% 84 56962 0.38% 85 60079 0.40% 86 63685 0.42% 87 67792 0.45% 88 68038 0.45% 89 71159 0.47% 90 79455 0.52% 91 87589 0.58% 92 98044 0.65% 93 110643 0.73% 94 123732 0.82% 95 141400 0.93% 96 167950 1.11% 97 205278 1.35% 98 265794 1.75% 99 353688 2.33% 100 480616 3.17% 101 11567507 76.24% 15172734 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=34 prefix-density=0.50 prefix-fanout=1.9 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAG criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=264.55 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=30.6 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.49 prefix-fanout=2.0 sequence=GAGAACGATGGCAAGTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=302.55 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=28.4 sequence=AAGAAGAAGAAG ERR1864419 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:30:39 Started mapping on | Feb 13 05:30:54 Finished on | Feb 13 05:55:14 Mapping speed, Million of reads per hour | 37.41 Number of input reads | 15172734 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14525866 Uniquely mapped reads % | 95.74% Average mapped length | 195.11 Number of splices: Total | 8502836 Number of splices: Annotated (sjdb) | 8362570 Number of splices: GT/AG | 8358812 Number of splices: GC/AG | 126353 Number of splices: AT/AC | 6138 Number of splices: Non-canonical | 11533 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 3.20 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382475 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 15968 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.63% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 306863 306863 306863 N_multimapping 382475 382475 382475 N_noFeature 421956 14378401 487377 N_ambiguous 129775 551 47474 UnstrandedReadsAssigned:13974135 PositiveStrandReadsAssigned:146914 NegativeStrandReadsAssigned:13991015 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864419 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864419-trimmed-pair1.fastq ERR1864419-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,172,734 reads, 14,200,740 reads pseudoaligned [quant] estimated average fragment length: 158.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52401 ERR1864419.ke.tsv 34699 ERR1864419.se.tsv 87100 total ==> ERR1864419.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1860.83 899 35.6734 Potri.005G024800.1.v4.1 1035 877.83 369 31.039 Potri.004G059700.1.v4.1 961 803.83 27 2.48022 Potri.007G009000.2.v4.1 1416 1258.83 0 0 Potri.003G141000.2.v4.1 2943 2785.83 1186 31.4356 Potri.016G087400.1.v4.1 270 119.442 381.663 235.947 Potri.015G069301.1.v4.1 564 406.922 0 0 Potri.010G195200.1.v4.1 1773 1615.83 241 11.0132 Potri.012G127500.1.v4.1 977 819.83 2604 234.535 ==> ERR1864419.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 130 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 ERR1864419 completed mapping pipeline successfully