Starting /dee2/code/volunteer_pipeline.sh ERR1864420 current disk space = 3052045897728 free memory = 1572582300 ERR1864420 SRAfilesize a02200dfab71f5b40e5644b23581d70e ERR1864420.sra ERR1864420.sra file validated ERR1864420 is paired end ERR1864420 is conventional basespace ERR1864420 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864420_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.71875 34.0 31.0 34.0 30.0 34.0 2 31.8965 34.0 31.0 34.0 28.0 34.0 3 32.29625 34.0 31.0 34.0 30.0 34.0 4 35.75225 37.0 35.0 37.0 35.0 37.0 5 35.556 37.0 35.0 37.0 33.0 37.0 6 35.4665 37.0 35.0 37.0 33.0 37.0 7 35.4965 37.0 35.0 37.0 33.0 37.0 8 35.47575 37.0 35.0 37.0 33.0 37.0 9 37.10275 39.0 37.0 39.0 33.0 39.0 10-11 37.042125 39.0 37.0 39.0 33.0 39.0 12-13 36.967 39.0 37.0 39.0 33.0 39.0 14-15 38.391000000000005 41.0 38.0 41.0 33.0 41.0 16-17 38.339625 41.0 38.0 41.0 33.0 41.0 18-19 38.247749999999996 40.0 38.0 41.0 33.0 41.0 20-21 38.15175 40.0 38.0 41.0 33.0 41.0 22-23 38.053250000000006 40.0 38.0 41.0 33.0 41.0 24-25 38.03075 40.0 38.0 41.0 33.0 41.0 26-27 37.85975 40.0 38.0 41.0 32.5 41.0 28-29 37.847750000000005 40.0 38.0 41.0 33.0 41.0 30-31 37.69525 40.0 38.0 41.0 32.0 41.0 32-33 37.64075 40.0 38.0 41.0 32.0 41.0 34-35 37.41775 40.0 37.5 41.0 31.0 41.0 36-37 37.28475 40.0 37.0 41.0 31.5 41.0 38-39 37.068625 40.0 37.0 41.0 30.5 41.0 40-41 37.03725 40.0 37.0 41.0 31.0 41.0 42-43 36.872875 40.0 37.0 41.0 30.0 41.0 44-45 36.85425 40.0 36.5 41.0 30.5 41.0 46-47 36.977875 40.0 37.0 41.0 31.0 41.0 48-49 36.861 40.0 37.0 41.0 30.5 41.0 50-51 36.680375 40.0 36.0 41.0 30.0 41.0 52-53 36.370125 39.5 36.0 41.0 29.5 41.0 54-55 36.230875 39.0 35.0 41.0 29.5 41.0 56-57 35.927375 39.0 35.0 41.0 28.0 41.0 58-59 35.7265 39.0 35.0 40.0 28.5 41.0 60-61 35.5085 39.0 35.0 40.0 28.0 41.0 62-63 35.13175 38.0 34.0 40.0 27.5 41.0 64-65 34.709500000000006 37.5 34.0 40.0 26.5 41.0 66-67 34.406625000000005 37.0 34.0 39.5 27.0 41.0 68-69 33.965 36.5 33.5 39.0 26.0 40.5 70-71 33.474625 36.0 33.0 39.0 25.5 40.0 72-73 32.984624999999994 35.0 33.0 38.0 25.0 40.0 74-75 32.662499999999994 35.0 32.5 37.0 25.5 39.0 76-77 31.602375 34.5 31.0 36.0 23.0 39.0 78-79 31.87125 35.0 32.0 36.0 24.0 38.5 80-81 31.64075 35.0 32.0 36.0 24.0 37.0 82-83 31.3125 35.0 32.0 35.0 22.5 37.0 84-85 31.048375 34.0 31.5 35.0 21.5 36.0 86-87 30.78 34.0 31.0 35.0 20.5 36.0 88-89 30.430500000000002 34.0 31.0 35.0 20.0 35.5 90-91 30.105125 34.0 31.0 35.0 17.5 35.0 92-93 29.812625 34.0 30.5 35.0 11.0 35.0 94-95 29.594375 34.0 30.5 35.0 6.5 35.0 96-97 29.371625 34.0 30.0 35.0 2.0 35.0 98-99 29.162625 34.0 30.0 35.0 2.0 35.0 100-101 28.41575 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 7.0 4 7.0 5 6.0 6 9.0 7 6.0 8 8.0 9 9.0 10 3.0 11 12.0 12 11.0 13 11.0 14 15.0 15 13.0 16 15.0 17 12.0 18 15.0 19 11.0 20 21.0 21 10.0 22 20.0 23 12.0 24 13.0 25 27.0 26 27.0 27 41.0 28 49.0 29 59.0 30 63.0 31 81.0 32 119.0 33 153.0 34 204.0 35 307.0 36 458.0 37 957.0 38 1084.0 39 92.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.283938086780005 6.698807409286983 7.63765541740675 44.37959908652626 2 25.650000000000002 9.025 32.5 32.824999999999996 3 24.099999999999998 11.75 21.95 42.199999999999996 4 29.975 17.2 20.525 32.300000000000004 5 29.25 23.400000000000002 24.224999999999998 23.125 6 21.099999999999998 29.975 25.6 23.325000000000003 7 18.575 23.974999999999998 39.375 18.075 8 18.85 24.425 32.85 23.875 9 18.575 24.15 34.925 22.35 10-11 20.1625 32.737500000000004 27.700000000000003 19.400000000000002 12-13 22.1375 25.825 28.537499999999998 23.5 14-15 20.4625 27.462500000000002 29.062500000000004 23.0125 16-17 21.4 28.725 27.525 22.35 18-19 21.475 28.037499999999998 27.450000000000003 23.0375 20-21 21.1625 28.1625 26.950000000000003 23.724999999999998 22-23 21.3 27.200000000000003 28.462500000000002 23.0375 24-25 21.912499999999998 26.8625 27.437499999999996 23.7875 26-27 21.224999999999998 28.249999999999996 26.6625 23.8625 28-29 21.2 27.787499999999998 26.85 24.1625 30-31 21.1125 27.700000000000003 27.3125 23.875 32-33 21.1625 26.900000000000002 28.275 23.6625 34-35 22.1 27.1125 27.025 23.7625 36-37 21.099999999999998 26.924999999999997 27.875 24.099999999999998 38-39 21.637500000000003 27.35 27.650000000000002 23.3625 40-41 21.9 27.750000000000004 27.0875 23.2625 42-43 21.712500000000002 26.987499999999997 27.55 23.75 44-45 21.3 27.6375 27.737499999999997 23.325000000000003 46-47 23.075000000000003 27.712500000000002 26.974999999999998 22.237499999999997 48-49 22.1375 26.8375 27.750000000000004 23.275000000000002 50-51 21.25 27.287499999999998 27.425 24.0375 52-53 22.125 27.675 27.1375 23.0625 54-55 21.3125 26.55 28.275 23.8625 56-57 22.025 26.950000000000003 27.750000000000004 23.275000000000002 58-59 22.3 27.5125 27.900000000000002 22.287499999999998 60-61 21.5 26.724999999999998 27.6125 24.1625 62-63 22.9875 27.400000000000002 27.0875 22.525000000000002 64-65 22.1875 28.275 25.8625 23.674999999999997 66-67 20.9875 28.1 27.675 23.2375 68-69 22.4375 26.787499999999998 27.525 23.25 70-71 22.225 27.8125 26.4125 23.549999999999997 72-73 21.925 27.3625 27.537499999999998 23.175 74-75 21.725 26.3 28.0625 23.9125 76-77 21.7375 27.125 27.55 23.5875 78-79 22.525000000000002 26.7125 27.462500000000002 23.3 80-81 21.9625 27.675 27.1125 23.25 82-83 22.075 26.787499999999998 27.500000000000004 23.6375 84-85 21.9625 27.237499999999997 27.450000000000003 23.35 86-87 22.95 26.4625 26.4625 24.125 88-89 21.925 27.5625 26.55 23.962500000000002 90-91 21.85 27.675 26.474999999999998 24.0 92-93 23.2125 26.674999999999997 26.7125 23.400000000000002 94-95 22.7 27.2625 26.325 23.7125 96-97 22.525000000000002 26.8 27.037499999999998 23.6375 98-99 21.825 27.6375 28.012500000000003 22.525000000000002 100-101 22.575 26.974999999999998 26.6125 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 3.5 28 5.0 29 7.0 30 11.0 31 16.0 32 20.0 33 25.0 34 37.5 35 46.0 36 55.5 37 79.5 38 99.5 39 123.5 40 154.5 41 186.5 42 210.5 43 224.5 44 232.0 45 247.0 46 259.5 47 255.5 48 238.5 49 214.5 50 210.5 51 185.0 52 146.5 53 130.0 54 111.0 55 94.5 56 78.0 57 64.5 58 55.5 59 44.5 60 35.5 61 24.0 62 16.0 63 11.0 64 8.0 65 7.0 66 4.0 67 2.5 68 2.5 69 1.5 70 1.5 71 2.5 72 2.0 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.00204918032787 95.65 2 1.639344262295082 3.2 3 0.2817622950819672 0.8250000000000001 4 0.05122950819672131 0.2 5 0.025614754098360656 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864420 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864420_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.994 34.0 31.0 34.0 30.0 34.0 2 32.14225 34.0 31.0 34.0 30.0 34.0 3 32.165 34.0 31.0 34.0 30.0 34.0 4 35.46825 37.0 35.0 37.0 33.0 37.0 5 35.5485 37.0 35.0 37.0 33.0 37.0 6 35.4715 37.0 35.0 37.0 33.0 37.0 7 35.43975 37.0 35.0 37.0 33.0 37.0 8 35.4275 37.0 35.0 37.0 33.0 37.0 9 37.0385 39.0 37.0 39.0 33.0 39.0 10-11 36.986000000000004 39.0 37.0 39.0 33.0 39.0 12-13 36.930875 39.0 37.0 39.0 33.0 39.0 14-15 38.286125 41.0 38.0 41.0 33.0 41.0 16-17 38.080749999999995 40.5 38.0 41.0 33.0 41.0 18-19 38.137125 40.0 38.0 41.0 33.0 41.0 20-21 38.093375 40.0 38.0 41.0 33.0 41.0 22-23 38.02075 40.0 38.0 41.0 32.5 41.0 24-25 37.923625 40.0 38.0 41.0 32.5 41.0 26-27 37.813500000000005 40.0 38.0 41.0 32.0 41.0 28-29 37.61625 40.0 38.0 41.0 32.0 41.0 30-31 37.58225 40.0 38.0 41.0 31.5 41.0 32-33 37.366875 40.0 38.0 41.0 31.0 41.0 34-35 37.426125 40.0 38.0 41.0 31.0 41.0 36-37 37.282375 40.0 37.5 41.0 30.5 41.0 38-39 37.164249999999996 40.0 37.5 41.0 30.0 41.0 40-41 37.009875 40.0 37.0 41.0 30.0 41.0 42-43 36.950125 40.0 37.0 41.0 30.5 41.0 44-45 36.79375 40.0 37.0 41.0 30.0 41.0 46-47 36.58525 40.0 36.5 41.0 30.0 41.0 48-49 36.32062500000001 39.0 36.0 41.0 30.0 41.0 50-51 36.129000000000005 39.5 35.5 40.5 29.5 41.0 52-53 36.2805 39.0 36.0 40.5 29.5 41.0 54-55 36.547125 40.0 36.0 41.0 30.0 41.0 56-57 36.360625 39.5 36.0 41.0 29.5 41.0 58-59 35.850125000000006 39.0 35.0 41.0 27.5 41.0 60-61 35.594750000000005 39.0 35.0 41.0 27.5 41.0 62-63 35.49125 38.5 35.0 40.5 28.0 41.0 64-65 35.106875 38.0 35.0 40.0 27.5 41.0 66-67 34.622125 37.0 34.0 40.0 26.0 41.0 68-69 34.20675 36.5 34.0 39.0 26.0 41.0 70-71 33.778375 36.0 34.0 39.0 26.0 40.0 72-73 33.37325 36.0 33.5 38.5 26.0 39.5 74-75 32.848 35.0 33.0 37.0 24.5 39.0 76-77 32.471374999999995 35.0 33.0 37.0 25.0 39.0 78-79 32.114125 35.0 32.5 36.0 24.5 38.0 80-81 31.674 35.0 32.0 36.0 23.0 37.0 82-83 31.281625 35.0 32.0 35.0 21.5 37.0 84-85 30.9055 35.0 31.5 35.0 20.5 36.0 86-87 30.43275 34.0 31.0 35.0 18.0 36.0 88-89 30.334 34.0 31.0 35.0 18.0 35.5 90-91 30.167625 34.0 31.0 35.0 17.5 35.0 92-93 29.872374999999998 34.0 31.0 35.0 11.5 35.0 94-95 29.544249999999998 34.0 30.0 35.0 4.5 35.0 96-97 29.176000000000002 34.0 30.0 35.0 2.0 35.0 98-99 28.801375 34.0 29.5 35.0 2.0 35.0 100-101 27.7685 33.5 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 7.0 4 9.0 5 7.0 6 8.0 7 6.0 8 8.0 9 9.0 10 12.0 11 13.0 12 11.0 13 10.0 14 14.0 15 11.0 16 6.0 17 10.0 18 8.0 19 23.0 20 15.0 21 20.0 22 18.0 23 31.0 24 22.0 25 39.0 26 45.0 27 40.0 28 55.0 29 57.0 30 66.0 31 90.0 32 94.0 33 141.0 34 191.0 35 275.0 36 444.0 37 981.0 38 1051.0 39 137.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.400000000000002 18.65 15.5 38.45 2 24.625 24.099999999999998 32.9 18.375 3 20.65 25.974999999999998 30.725 22.650000000000002 4 22.2 31.6 24.6 21.6 5 24.775 34.325 23.325000000000003 17.575 6 20.95 37.3 22.5 19.25 7 19.675 22.125 36.375 21.825 8 20.849999999999998 26.424999999999997 28.275 24.45 9 22.025 24.55 29.625 23.799999999999997 10-11 22.2625 31.125000000000004 25.3 21.3125 12-13 24.099999999999998 25.4875 25.724999999999998 24.6875 14-15 22.4625 28.6875 26.6125 22.237499999999997 16-17 23.724999999999998 27.3 25.637500000000003 23.3375 18-19 22.3375 28.849999999999998 26.25 22.5625 20-21 22.6875 28.175 26.55 22.5875 22-23 23.425 27.737499999999997 26.487500000000004 22.35 24-25 23.6875 27.450000000000003 26.724999999999998 22.1375 26-27 22.1375 28.3875 27.3125 22.162499999999998 28-29 23.05 27.625 26.174999999999997 23.150000000000002 30-31 23.0125 28.249999999999996 26.450000000000003 22.287499999999998 32-33 23.375 28.0625 26.8375 21.725 34-35 22.8875 28.037499999999998 26.987499999999997 22.0875 36-37 22.775000000000002 27.6125 26.6625 22.95 38-39 22.2625 27.625 27.1625 22.95 40-41 23.9125 26.8625 26.825 22.400000000000002 42-43 22.6 27.5875 27.287499999999998 22.525000000000002 44-45 22.8 29.125 26.450000000000003 21.625 46-47 23.175 28.012500000000003 26.637499999999996 22.175 48-49 22.5875 28.3625 26.474999999999998 22.575 50-51 23.7875 28.15 26.05 22.0125 52-53 23.7 26.8 27.375 22.125 54-55 23.5875 27.437499999999996 26.8625 22.112499999999997 56-57 23.6125 28.375 26.3625 21.65 58-59 23.3625 27.6375 26.637499999999996 22.3625 60-61 22.6375 27.700000000000003 27.474999999999998 22.1875 62-63 23.65 26.9125 27.3375 22.1 64-65 23.7375 27.325 26.487500000000004 22.45 66-67 23.150000000000002 28.4 25.887500000000003 22.5625 68-69 23.5625 27.3875 26.674999999999997 22.375 70-71 24.3125 26.6625 26.825 22.2 72-73 23.3 27.437499999999996 26.737499999999997 22.525000000000002 74-75 23.5 27.200000000000003 27.05 22.25 76-77 23.1625 27.487499999999997 27.3625 21.987499999999997 78-79 23.6375 26.974999999999998 27.212500000000002 22.175 80-81 23.8875 27.987499999999997 26.1 22.025 82-83 23.3 27.187499999999996 27.575 21.9375 84-85 22.9875 28.000000000000004 26.75 22.2625 86-87 23.674999999999997 27.0625 27.175 22.0875 88-89 23.6125 27.575 27.150000000000002 21.6625 90-91 23.075000000000003 27.325 26.987499999999997 22.6125 92-93 23.7625 27.5625 26.3 22.375 94-95 23.8125 27.5125 26.6625 22.0125 96-97 23.075000000000003 28.5875 26.0375 22.3 98-99 23.8375 28.5625 25.8625 21.7375 100-101 23.7 28.175 26.0125 22.112499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.0 26 1.5 27 4.0 28 6.5 29 6.5 30 8.0 31 12.0 32 21.5 33 30.5 34 32.5 35 43.5 36 57.0 37 90.0 38 123.5 39 140.0 40 158.5 41 194.5 42 238.5 43 247.0 44 232.0 45 255.0 46 268.0 47 264.0 48 247.5 49 206.0 50 183.0 51 163.5 52 130.5 53 112.5 54 120.0 55 96.0 56 65.5 57 53.5 58 43.5 59 39.0 60 29.5 61 15.0 62 13.5 63 13.5 64 7.0 65 3.0 66 3.0 67 3.5 68 2.5 69 1.5 70 2.0 71 1.0 72 1.0 73 1.0 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.7826306488260539 1.55 3 0.10098459984852311 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.5625 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741888 spots for ERR1864420.sra Written 741888 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra Read 741887 spots for ERR1864420.sra Written 741887 spots for ERR1864420.sra SRR ids: ['ERR1864420.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b3f4v3ms ERR1864420.sra spots: 14837741 blocks: [[1, 741887], [741888, 1483774], [1483775, 2225661], [2225662, 2967548], [2967549, 3709435], [3709436, 4451322], [4451323, 5193209], [5193210, 5935096], [5935097, 6676983], [6676984, 7418870], [7418871, 8160757], [8160758, 8902644], [8902645, 9644531], [9644532, 10386418], [10386419, 11128305], [11128306, 11870192], [11870193, 12612079], [12612080, 13353966], [13353967, 14095853], [14095854, 14837741]] ERR1864420 file size 3557325 ERR1864420 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864420 ERR1864420_1.fastq ERR1864420_2.fastq Input file: ERR1864420_1.fastq Paired file: ERR1864420_2.fastq trimmed: ERR1864420-trimmed-pair1.fastq, ERR1864420-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:30:13 2025 >> started Thu Feb 13 04:41:38 2025 >> done (684.892s) 14837741 read pairs processed; of these: 231203 ( 1.56%) short read pairs filtered out after trimming by size control 252579 ( 1.70%) empty read pairs filtered out after trimming by size control 14353959 (96.74%) read pairs available; of these: 3470628 (24.18%) trimmed read pairs available after processing 10883331 (75.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 95 0.00% 19 281 0.00% 20 409 0.00% 21 549 0.00% 22 694 0.00% 23 875 0.01% 24 1049 0.01% 25 1229 0.01% 26 1453 0.01% 27 1680 0.01% 28 1974 0.01% 29 2237 0.02% 30 2655 0.02% 31 2886 0.02% 32 3348 0.02% 33 3652 0.03% 34 4016 0.03% 35 4324 0.03% 36 4674 0.03% 37 5003 0.03% 38 5431 0.04% 39 5832 0.04% 40 6167 0.04% 41 6587 0.05% 42 7019 0.05% 43 7221 0.05% 44 7561 0.05% 45 8270 0.06% 46 8736 0.06% 47 8931 0.06% 48 9591 0.07% 49 9785 0.07% 50 10285 0.07% 51 10585 0.07% 52 10874 0.08% 53 11602 0.08% 54 12063 0.08% 55 12562 0.09% 56 13209 0.09% 57 14181 0.10% 58 15040 0.10% 59 18371 0.13% 60 21889 0.15% 61 22000 0.15% 62 22371 0.16% 63 23495 0.16% 64 24400 0.17% 65 25186 0.18% 66 26142 0.18% 67 27045 0.19% 68 28111 0.20% 69 28975 0.20% 70 30362 0.21% 71 31551 0.22% 72 32633 0.23% 73 33943 0.24% 74 35547 0.25% 75 36412 0.25% 76 36936 0.26% 77 38619 0.27% 78 40672 0.28% 79 43832 0.31% 80 45899 0.32% 81 47803 0.33% 82 51211 0.36% 83 52302 0.36% 84 54589 0.38% 85 57980 0.40% 86 61478 0.43% 87 64283 0.45% 88 66768 0.47% 89 71094 0.50% 90 78079 0.54% 91 85589 0.60% 92 93987 0.65% 93 105455 0.73% 94 118048 0.82% 95 138439 0.96% 96 162399 1.13% 97 199147 1.39% 98 255608 1.78% 99 340081 2.37% 100 447282 3.12% 101 10883331 75.82% 14353959 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.62 fanout-score-rank=37 prefix-density=0.58 prefix-fanout=1.0 sequence=GCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=13.58 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=6.7 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=36 prefix-density=0.44 prefix-fanout=1.9 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=90.33 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=1.7 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC ERR1864420 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:19:16 Started mapping on | Feb 13 05:19:26 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 24.07 Number of input reads | 14353959 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 13839049 Uniquely mapped reads % | 96.41% Average mapped length | 195.05 Number of splices: Total | 8290635 Number of splices: Annotated (sjdb) | 8175980 Number of splices: GT/AG | 8135160 Number of splices: GC/AG | 134370 Number of splices: AT/AC | 8534 Number of splices: Non-canonical | 12571 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.89 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372242 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 51234 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 162128 162128 162128 N_multimapping 372242 372242 372242 N_noFeature 263076 13676922 320295 N_ambiguous 173723 693 68372 UnstrandedReadsAssigned:13402250 PositiveStrandReadsAssigned:161434 NegativeStrandReadsAssigned:13450382 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864420 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864420-trimmed-pair1.fastq ERR1864420-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,353,959 reads, 13,641,914 reads pseudoaligned [quant] estimated average fragment length: 157.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 ERR1864420.ke.tsv 34699 ERR1864420.se.tsv 87100 total ==> ERR1864420.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1861.87 524 16.629 Potri.005G024800.1.v4.1 1035 878.87 406 27.2951 Potri.004G059700.1.v4.1 961 804.883 70 5.13864 Potri.007G009000.2.v4.1 1416 1259.87 0 0 Potri.003G141000.2.v4.1 2943 2786.87 532.505 11.2899 Potri.016G087400.1.v4.1 270 119.412 1562.62 773.199 Potri.015G069301.1.v4.1 564 407.94 0 0 Potri.010G195200.1.v4.1 1773 1616.87 15 0.54815 Potri.012G127500.1.v4.1 977 820.879 294 21.1617 ==> ERR1864420.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 ERR1864420 completed mapping pipeline successfully