Starting /dee2/code/volunteer_pipeline.sh ERR1864421 current disk space = 3052038684672 free memory = 1574559936 ERR1864421 SRAfilesize 9d05d767218315416f8b0848f1abf7ca ERR1864421.sra ERR1864421.sra file validated ERR1864421 is paired end ERR1864421 is conventional basespace ERR1864421 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864421_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.92275 34.0 31.0 34.0 30.0 34.0 2 32.01875 34.0 31.0 34.0 30.0 34.0 3 32.28725 34.0 31.0 34.0 30.0 34.0 4 35.76425 37.0 35.0 37.0 35.0 37.0 5 35.46075 37.0 35.0 37.0 33.0 37.0 6 35.3915 37.0 35.0 37.0 33.0 37.0 7 35.48725 37.0 35.0 37.0 35.0 37.0 8 35.471 37.0 35.0 37.0 33.0 37.0 9 37.16375 39.0 38.0 39.0 34.0 39.0 10-11 37.074875000000006 39.0 38.0 39.0 33.5 39.0 12-13 37.042375 39.0 37.5 39.0 33.5 39.0 14-15 38.446250000000006 41.0 38.5 41.0 34.0 41.0 16-17 38.32825 41.0 38.0 41.0 34.0 41.0 18-19 38.26025 41.0 38.0 41.0 33.5 41.0 20-21 38.183499999999995 40.5 38.0 41.0 33.0 41.0 22-23 38.08925 40.0 38.0 41.0 33.0 41.0 24-25 37.99825 40.0 38.0 41.0 33.0 41.0 26-27 37.937125 40.0 38.0 41.0 33.0 41.0 28-29 37.871375 40.0 38.0 41.0 33.0 41.0 30-31 37.783625 40.0 38.0 41.0 33.0 41.0 32-33 37.633250000000004 40.0 38.0 41.0 32.5 41.0 34-35 37.535125 40.0 38.0 41.0 32.0 41.0 36-37 37.407125 40.0 38.0 41.0 32.0 41.0 38-39 37.19125 40.0 37.5 41.0 31.0 41.0 40-41 37.050250000000005 40.0 37.0 41.0 31.0 41.0 42-43 37.051500000000004 40.0 37.0 41.0 31.0 41.0 44-45 37.032375 40.0 37.0 41.0 31.0 41.0 46-47 37.202124999999995 40.0 37.0 41.0 32.0 41.0 48-49 37.039 40.0 37.0 41.0 31.0 41.0 50-51 36.861374999999995 40.0 37.0 41.0 31.0 41.0 52-53 36.509875 40.0 36.0 41.0 30.0 41.0 54-55 36.4675 39.0 36.0 41.0 30.5 41.0 56-57 36.234750000000005 39.0 35.5 41.0 30.0 41.0 58-59 36.004125 39.0 35.0 40.5 29.0 41.0 60-61 35.810625 39.0 35.0 40.0 29.0 41.0 62-63 35.45625 38.0 35.0 40.0 28.0 41.0 64-65 34.966125000000005 37.5 34.5 40.0 27.5 41.0 66-67 34.595375000000004 37.0 34.0 39.5 27.5 41.0 68-69 34.166624999999996 36.5 34.0 39.0 26.0 40.5 70-71 33.859875 36.0 34.0 39.0 26.0 40.0 72-73 33.43375 35.5 33.5 38.0 26.0 40.0 74-75 32.949749999999995 35.0 33.0 37.0 26.0 39.0 76-77 31.9455 34.5 31.5 36.0 25.0 39.0 78-79 32.04575 35.0 32.0 36.0 25.0 38.5 80-81 31.863374999999998 35.0 32.0 36.0 25.0 37.0 82-83 31.6045 35.0 32.0 35.5 24.0 37.0 84-85 31.286625 35.0 32.0 35.0 24.0 36.5 86-87 31.054625 34.0 32.0 35.0 23.5 36.0 88-89 30.746625 34.0 31.5 35.0 20.5 36.0 90-91 30.472375 34.0 31.0 35.0 20.0 35.0 92-93 30.254375 34.0 31.0 35.0 18.5 35.0 94-95 29.97475 34.0 31.0 35.0 17.5 35.0 96-97 29.901125 34.0 31.0 35.0 16.5 35.0 98-99 29.643124999999998 34.0 31.0 35.0 2.0 35.0 100-101 28.836750000000002 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 10.0 4 8.0 5 7.0 6 9.0 7 11.0 8 5.0 9 9.0 10 6.0 11 9.0 12 5.0 13 4.0 14 12.0 15 8.0 16 11.0 17 10.0 18 8.0 19 11.0 20 14.0 21 25.0 22 12.0 23 18.0 24 10.0 25 29.0 26 26.0 27 29.0 28 46.0 29 48.0 30 61.0 31 75.0 32 98.0 33 144.0 34 184.0 35 288.0 36 526.0 37 999.0 38 1067.0 39 120.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.812720848056536 6.865219586067643 7.29429581019687 45.027763755678954 2 25.624999999999996 8.725 31.3 34.35 3 24.712356178089045 10.880440220110055 23.13656828414207 41.27063531765883 4 29.225 18.2 20.225 32.35 5 28.199999999999996 24.525 23.925 23.35 6 21.925 28.275 26.575 23.225 7 17.05 24.7 39.85 18.4 8 18.075 24.425 35.25 22.25 9 18.65 23.200000000000003 36.825 21.325 10-11 20.65 31.9875 26.75 20.6125 12-13 20.625 26.1625 30.099999999999998 23.1125 14-15 20.875 27.962500000000002 29.4125 21.75 16-17 21.587500000000002 27.9375 28.212500000000002 22.2625 18-19 21.1125 27.5875 28.262500000000003 23.0375 20-21 21.3625 28.299999999999997 27.1 23.2375 22-23 21.15 27.9125 27.775 23.1625 24-25 21.8125 27.287499999999998 27.224999999999998 23.674999999999997 26-27 21.8125 28.5625 26.424999999999997 23.200000000000003 28-29 20.65 29.549999999999997 26.8125 22.9875 30-31 22.175 26.8375 26.787499999999998 24.2 32-33 20.962500000000002 28.0625 27.8875 23.0875 34-35 22.1 27.075 27.187499999999996 23.6375 36-37 21.45 26.375 28.575 23.599999999999998 38-39 21.125 28.000000000000004 27.55 23.325000000000003 40-41 20.65 28.425 27.900000000000002 23.025000000000002 42-43 21.987499999999997 28.0875 26.85 23.075000000000003 44-45 21.85 27.8125 26.5125 23.825 46-47 21.2625 28.1125 27.125 23.5 48-49 22.5875 27.187499999999996 27.925 22.3 50-51 21.1625 27.9375 27.700000000000003 23.200000000000003 52-53 22.825 27.175 27.175 22.825 54-55 21.525 27.85 27.487499999999997 23.1375 56-57 21.3625 27.4125 27.5125 23.7125 58-59 22.112499999999997 27.675 27.2625 22.95 60-61 20.5875 27.3875 28.0625 23.962500000000002 62-63 21.7875 27.0 27.325 23.8875 64-65 20.820307615355755 27.77291484306615 27.522821057896714 23.88395648368138 66-67 21.6125 27.1625 27.4125 23.8125 68-69 21.76088044022011 27.788894447223612 27.426213106553277 23.024012006003 70-71 20.817704426106527 27.981995498874717 28.657164291072768 22.543135783945985 72-73 21.642910727681922 26.91922980745186 28.319579894973746 23.118279569892472 74-75 21.955488872218055 26.51912978244561 27.894473618404604 23.63090772693173 76-77 21.517879469867466 26.70667666916729 27.981995498874717 23.793448362090523 78-79 22.4375 27.6 27.212500000000002 22.75 80-81 21.8 27.237499999999997 28.1125 22.85 82-83 21.775 28.025 26.237500000000004 23.962500000000002 84-85 22.112499999999997 27.400000000000002 27.487499999999997 23.0 86-87 21.712500000000002 26.474999999999998 28.1875 23.625 88-89 21.575 27.4125 28.1 22.912499999999998 90-91 22.775000000000002 27.075 26.7125 23.4375 92-93 20.7625 27.212500000000002 28.6125 23.4125 94-95 22.8125 26.650000000000002 27.175 23.3625 96-97 21.525 28.3125 27.6125 22.55 98-99 22.025 27.450000000000003 27.5875 22.9375 100-101 22.525000000000002 27.025 26.700000000000003 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 2.5 26 3.5 27 5.5 28 6.5 29 8.5 30 12.0 31 12.0 32 14.0 33 23.0 34 35.0 35 49.0 36 66.5 37 88.5 38 107.5 39 142.5 40 169.0 41 187.0 42 212.0 43 221.5 44 244.5 45 267.5 46 268.0 47 254.0 48 245.5 49 234.5 50 203.5 51 158.0 52 130.5 53 122.5 54 103.0 55 83.0 56 72.0 57 66.0 58 47.0 59 32.0 60 28.0 61 18.0 62 11.5 63 8.0 64 7.0 65 4.5 66 3.5 67 4.0 68 2.0 69 2.5 70 2.5 71 0.5 72 1.0 73 1.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0375 66-67 0.0 68-69 0.05 70-71 0.025 72-73 0.025 74-75 0.025 76-77 0.025 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.175 #Duplication Level Percentage of deduplicated Percentage of total 1 97.76177000257267 95.0 2 1.7236943658348343 3.35 3 0.4373552868536146 1.275 4 0.0 0.0 5 0.07718034473887317 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTC 5 0.125 No Hit GTCCTCATCAAGTTTCTCCGACAGATTCTTGATAAATTTCTTAATCTGTG 5 0.125 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.07500000000000001 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864421 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864421_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95525 34.0 31.0 34.0 30.0 34.0 2 32.106 34.0 31.0 34.0 30.0 34.0 3 32.2005 34.0 31.0 34.0 30.0 34.0 4 35.51425 37.0 37.0 37.0 33.0 37.0 5 35.471 37.0 35.0 37.0 33.0 37.0 6 35.399 37.0 36.0 37.0 33.0 37.0 7 35.45325 37.0 35.0 37.0 33.0 37.0 8 35.40725 37.0 35.0 37.0 33.0 37.0 9 37.0305 39.0 38.0 39.0 33.0 39.0 10-11 37.075 39.0 37.5 39.0 33.5 39.0 12-13 36.93662500000001 39.0 37.5 39.0 33.0 39.0 14-15 38.325625 41.0 38.0 41.0 33.5 41.0 16-17 38.2155 41.0 38.0 41.0 33.0 41.0 18-19 38.189125 40.0 38.0 41.0 33.5 41.0 20-21 38.258125 40.0 38.0 41.0 34.0 41.0 22-23 38.087375 40.0 38.0 41.0 33.0 41.0 24-25 37.99925 40.0 38.0 41.0 33.0 41.0 26-27 37.83425 40.0 38.0 41.0 32.5 41.0 28-29 37.7915 40.0 38.0 41.0 33.0 41.0 30-31 37.596500000000006 40.0 38.0 41.0 32.0 41.0 32-33 37.4745 40.0 38.0 41.0 31.5 41.0 34-35 37.413125 40.0 38.0 41.0 31.0 41.0 36-37 37.349125 40.0 38.0 41.0 31.5 41.0 38-39 37.251625000000004 40.0 38.0 41.0 31.0 41.0 40-41 37.07875 40.0 37.0 41.0 30.5 41.0 42-43 36.959 40.0 37.0 41.0 30.5 41.0 44-45 36.819375 40.0 37.0 41.0 30.0 41.0 46-47 36.6195 40.0 37.0 41.0 30.0 41.0 48-49 36.36825 39.5 36.0 41.0 29.5 41.0 50-51 36.168125 39.5 36.5 40.5 29.5 41.0 52-53 36.37525 39.0 37.0 40.5 30.0 41.0 54-55 36.6125 40.0 37.0 41.0 30.0 41.0 56-57 36.441375 40.0 36.0 41.0 30.0 41.0 58-59 36.022125 39.0 35.5 41.0 28.5 41.0 60-61 35.771375 39.0 35.0 41.0 28.0 41.0 62-63 35.536500000000004 39.0 35.0 40.5 28.0 41.0 64-65 35.198125000000005 38.0 35.0 40.0 27.0 41.0 66-67 34.8265 37.5 34.5 40.0 27.0 41.0 68-69 34.3935 37.0 34.0 39.0 27.0 41.0 70-71 33.952749999999995 36.0 34.0 39.0 26.0 40.5 72-73 33.568 36.0 34.0 38.5 26.0 40.0 74-75 33.178625 35.0 34.0 37.0 26.0 39.0 76-77 32.65775 35.0 33.0 37.0 26.0 39.0 78-79 32.304249999999996 35.0 33.0 36.0 25.5 38.0 80-81 31.898249999999997 35.0 32.5 36.0 24.0 37.0 82-83 31.49875 35.0 32.0 35.5 23.5 37.0 84-85 31.061625 35.0 31.5 35.0 20.5 36.0 86-87 30.839 34.5 31.5 35.0 20.0 36.0 88-89 30.615375 34.0 31.0 35.0 20.0 36.0 90-91 30.306375000000003 34.0 31.0 35.0 18.0 35.0 92-93 30.164375 34.0 31.0 35.0 16.5 35.0 94-95 29.83275 34.0 31.0 35.0 8.0 35.0 96-97 29.405124999999998 34.0 30.0 35.0 2.0 35.0 98-99 28.984 34.0 30.0 35.0 2.0 35.0 100-101 28.086875 33.5 28.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 5.0 4 5.0 5 6.0 6 5.0 7 12.0 8 7.0 9 15.0 10 12.0 11 10.0 12 9.0 13 7.0 14 13.0 15 17.0 16 5.0 17 21.0 18 11.0 19 15.0 20 14.0 21 15.0 22 14.0 23 15.0 24 18.0 25 21.0 26 39.0 27 40.0 28 43.0 29 51.0 30 67.0 31 71.0 32 94.0 33 144.0 34 177.0 35 286.0 36 461.0 37 988.0 38 1111.0 39 126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.999999999999996 18.05 14.249999999999998 38.7 2 24.375 24.775 32.5 18.35 3 21.075 26.55 29.475 22.900000000000002 4 23.525 31.674999999999997 24.5 20.3 5 26.224999999999998 33.5 22.05 18.224999999999998 6 20.599999999999998 37.45 23.05 18.9 7 20.075000000000003 21.475 37.925 20.525 8 20.8 26.0 27.275 25.924999999999997 9 21.6 22.900000000000002 29.9 25.6 10-11 22.6375 31.2625 24.462500000000002 21.637500000000003 12-13 24.212500000000002 24.962500000000002 26.900000000000002 23.925 14-15 23.1375 28.325 26.375 22.162499999999998 16-17 22.525000000000002 29.1375 26.5125 21.825 18-19 23.0625 28.287499999999998 26.525 22.125 20-21 23.7375 28.0875 26.3625 21.8125 22-23 22.75 28.762500000000003 27.3125 21.175 24-25 22.900000000000002 28.575 27.0625 21.462500000000002 26-27 23.875 27.800000000000004 27.212500000000002 21.1125 28-29 23.549999999999997 28.4375 26.25 21.762500000000003 30-31 23.5125 28.1375 27.5625 20.7875 32-33 23.8625 28.5625 26.400000000000002 21.175 34-35 22.775000000000002 28.325 27.037499999999998 21.8625 36-37 23.200000000000003 27.5625 27.6125 21.625 38-39 23.025000000000002 27.85 27.200000000000003 21.925 40-41 23.474999999999998 28.262500000000003 26.6625 21.6 42-43 22.900000000000002 27.85 27.725 21.525 44-45 23.2125 27.825 26.575 22.3875 46-47 23.400000000000002 27.800000000000004 26.75 22.05 48-49 22.4875 28.225 26.575 22.7125 50-51 22.575 28.799999999999997 27.0 21.625 52-53 22.8375 27.6 27.675 21.8875 54-55 22.3625 28.050000000000004 27.1 22.4875 56-57 23.5875 28.287499999999998 26.787499999999998 21.337500000000002 58-59 22.875 26.924999999999997 27.1 23.1 60-61 23.875 27.9125 26.625 21.587500000000002 62-63 22.412499999999998 27.875 27.487499999999997 22.225 64-65 23.4625 27.075 27.425 22.037499999999998 66-67 22.6 27.6125 27.05 22.7375 68-69 23.799999999999997 28.4 26.6 21.2 70-71 23.7875 27.737499999999997 26.85 21.625 72-73 23.3625 27.462500000000002 27.750000000000004 21.425 74-75 23.45 28.549999999999997 26.3125 21.6875 76-77 23.8375 27.037499999999998 27.6625 21.462500000000002 78-79 23.9125 27.0875 26.637499999999996 22.3625 80-81 23.200000000000003 28.599999999999998 26.1 22.1 82-83 23.825 28.3375 26.325 21.512500000000003 84-85 23.1125 26.825 27.9125 22.15 86-87 23.075000000000003 27.474999999999998 27.2625 22.1875 88-89 23.3625 27.6 27.025 22.0125 90-91 22.6875 27.775 27.737499999999997 21.8 92-93 24.3875 28.3375 26.900000000000002 20.375 94-95 23.5375 27.187499999999996 26.8125 22.4625 96-97 23.3 28.15 27.0625 21.4875 98-99 23.6625 28.4 26.737499999999997 21.2 100-101 24.5 27.725 25.45 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 2.0 27 1.5 28 5.5 29 7.0 30 9.5 31 18.5 32 22.5 33 24.5 34 31.5 35 52.0 36 66.0 37 73.0 38 96.5 39 128.5 40 180.5 41 216.0 42 232.0 43 257.5 44 271.5 45 276.5 46 272.0 47 268.0 48 258.5 49 236.0 50 198.5 51 152.0 52 113.5 53 100.5 54 92.0 55 72.5 56 58.0 57 48.5 58 44.5 59 33.0 60 21.5 61 12.5 62 5.5 63 8.5 64 8.0 65 2.0 66 1.5 67 2.5 68 2.0 69 2.0 70 1.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8357377879018 97.625 2 1.088332067830929 2.15 3 0.07593014426727411 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.07500000000000001 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684928 spots for ERR1864421.sra Written 684928 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra Read 684912 spots for ERR1864421.sra Written 684912 spots for ERR1864421.sra SRR ids: ['ERR1864421.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z__t41t5 ERR1864421.sra spots: 13698256 blocks: [[1, 684912], [684913, 1369824], [1369825, 2054736], [2054737, 2739648], [2739649, 3424560], [3424561, 4109472], [4109473, 4794384], [4794385, 5479296], [5479297, 6164208], [6164209, 6849120], [6849121, 7534032], [7534033, 8218944], [8218945, 8903856], [8903857, 9588768], [9588769, 10273680], [10273681, 10958592], [10958593, 11643504], [11643505, 12328416], [12328417, 13013328], [13013329, 13698256]] ERR1864421 file size 3282468 ERR1864421 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864421 ERR1864421_1.fastq ERR1864421_2.fastq Input file: ERR1864421_1.fastq Paired file: ERR1864421_2.fastq trimmed: ERR1864421-trimmed-pair1.fastq, ERR1864421-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:28:10 2025 >> started Thu Feb 13 04:30:58 2025 >> done (168.721s) 13698256 read pairs processed; of these: 203326 ( 1.48%) short read pairs filtered out after trimming by size control 211538 ( 1.54%) empty read pairs filtered out after trimming by size control 13283392 (96.97%) read pairs available; of these: 3067138 (23.09%) trimmed read pairs available after processing 10216254 (76.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 101 0.00% 19 233 0.00% 20 352 0.00% 21 515 0.00% 22 612 0.00% 23 724 0.01% 24 895 0.01% 25 1052 0.01% 26 1250 0.01% 27 1447 0.01% 28 1600 0.01% 29 1846 0.01% 30 2210 0.02% 31 2428 0.02% 32 2751 0.02% 33 3035 0.02% 34 3388 0.03% 35 3654 0.03% 36 3898 0.03% 37 4221 0.03% 38 4623 0.03% 39 4961 0.04% 40 5252 0.04% 41 5542 0.04% 42 5818 0.04% 43 6108 0.05% 44 6369 0.05% 45 6955 0.05% 46 7075 0.05% 47 7365 0.06% 48 7902 0.06% 49 8187 0.06% 50 8539 0.06% 51 8855 0.07% 52 9421 0.07% 53 9760 0.07% 54 10300 0.08% 55 10771 0.08% 56 11321 0.09% 57 11580 0.09% 58 12358 0.09% 59 15810 0.12% 60 18793 0.14% 61 19320 0.15% 62 19539 0.15% 63 20704 0.16% 64 20970 0.16% 65 21878 0.16% 66 22506 0.17% 67 23681 0.18% 68 24440 0.18% 69 24865 0.19% 70 26151 0.20% 71 27511 0.21% 72 28434 0.21% 73 29408 0.22% 74 30513 0.23% 75 31370 0.24% 76 31805 0.24% 77 33518 0.25% 78 35045 0.26% 79 37608 0.28% 80 39187 0.30% 81 41648 0.31% 82 44319 0.33% 83 44890 0.34% 84 47704 0.36% 85 50320 0.38% 86 53419 0.40% 87 56635 0.43% 88 57659 0.43% 89 61539 0.46% 90 68550 0.52% 91 75585 0.57% 92 82672 0.62% 93 92496 0.70% 94 105221 0.79% 95 122481 0.92% 96 145450 1.09% 97 178221 1.34% 98 230781 1.74% 99 309220 2.33% 100 409998 3.09% 101 10216254 76.91% 13283392 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=21 prefix-density=0.28 prefix-fanout=2.9 sequence=CTTGCCACCTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=11.71 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.1 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=38 prefix-density=0.31 prefix-fanout=1.9 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=87.24 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=1.7 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC ERR1864421 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 04:40:27 Started mapping on | Feb 13 04:40:38 Finished on | Feb 13 05:07:13 Mapping speed, Million of reads per hour | 29.98 Number of input reads | 13283392 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 12824796 Uniquely mapped reads % | 96.55% Average mapped length | 195.46 Number of splices: Total | 7663127 Number of splices: Annotated (sjdb) | 7553358 Number of splices: GT/AG | 7516800 Number of splices: GC/AG | 127062 Number of splices: AT/AC | 8210 Number of splices: Non-canonical | 11055 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.66 Insertion rate per base | 0.01% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339211 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 54963 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 138411 138411 138411 N_multimapping 339211 339211 339211 N_noFeature 263700 12678606 319039 N_ambiguous 152809 619 61551 UnstrandedReadsAssigned:12408287 PositiveStrandReadsAssigned:145571 NegativeStrandReadsAssigned:12444206 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864421 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864421-trimmed-pair1.fastq ERR1864421-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,283,392 reads, 12,620,746 reads pseudoaligned [quant] estimated average fragment length: 159.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 ERR1864421.ke.tsv 34699 ERR1864421.se.tsv 87100 total ==> ERR1864421.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.63 492 17.8258 Potri.005G024800.1.v4.1 1035 876.63 387 29.7445 Potri.004G059700.1.v4.1 961 802.63 109 9.15003 Potri.007G009000.2.v4.1 1416 1257.63 0 0 Potri.003G141000.2.v4.1 2943 2784.63 508 12.2916 Potri.016G087400.1.v4.1 270 117.564 1414 810.375 Potri.015G069301.1.v4.1 564 405.698 0 0 Potri.010G195200.1.v4.1 1773 1614.63 25 1.04323 Potri.012G127500.1.v4.1 977 818.63 308 25.3498 ==> ERR1864421.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 ERR1864421 completed mapping pipeline successfully