Starting /dee2/code/volunteer_pipeline.sh ERR1864422 current disk space = 3052049592320 free memory = 1577158088 ERR1864422 SRAfilesize d1e62d2dd4ca5c57affbd2db3e5e60d6 ERR1864422.sra ERR1864422.sra file validated ERR1864422 is paired end ERR1864422 is conventional basespace ERR1864422 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864422_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.77975 34.0 31.0 34.0 30.0 34.0 2 32.0155 34.0 31.0 34.0 30.0 34.0 3 32.3045 34.0 31.0 34.0 30.0 34.0 4 35.704 37.0 35.0 37.0 35.0 37.0 5 35.47325 37.0 35.0 37.0 33.0 37.0 6 35.4595 37.0 35.0 37.0 33.0 37.0 7 35.46025 37.0 35.0 37.0 33.0 37.0 8 35.41825 37.0 35.0 37.0 33.0 37.0 9 37.07125 39.0 38.0 39.0 34.0 39.0 10-11 37.041 39.0 37.5 39.0 34.0 39.0 12-13 36.993 39.0 37.0 39.0 33.0 39.0 14-15 38.39075 41.0 38.5 41.0 33.5 41.0 16-17 38.328625 41.0 38.0 41.0 33.5 41.0 18-19 38.2895 41.0 38.5 41.0 33.5 41.0 20-21 38.1725 40.5 38.0 41.0 33.5 41.0 22-23 38.133375 40.0 38.0 41.0 33.0 41.0 24-25 38.029375 40.0 38.0 41.0 33.0 41.0 26-27 37.969375 40.0 38.0 41.0 33.0 41.0 28-29 37.939375 40.0 38.0 41.0 33.0 41.0 30-31 37.7875 40.0 38.0 41.0 32.5 41.0 32-33 37.598 40.0 38.0 41.0 32.0 41.0 34-35 37.453375 40.0 38.0 41.0 31.5 41.0 36-37 37.287 40.0 38.0 41.0 31.0 41.0 38-39 37.153875 40.0 37.5 41.0 30.5 41.0 40-41 37.071250000000006 40.0 37.0 41.0 31.0 41.0 42-43 37.08775 40.0 37.0 41.0 31.0 41.0 44-45 37.004875 40.0 37.0 41.0 30.5 41.0 46-47 37.152125 40.0 37.0 41.0 31.0 41.0 48-49 36.996875 40.0 37.0 41.0 31.0 41.0 50-51 36.843 40.0 37.0 41.0 30.5 41.0 52-53 36.532624999999996 40.0 36.0 41.0 30.0 41.0 54-55 36.415625000000006 39.5 36.0 41.0 29.5 41.0 56-57 36.054249999999996 39.0 35.0 41.0 28.5 41.0 58-59 35.804625 39.0 35.0 40.5 28.0 41.0 60-61 35.69775 39.0 35.0 40.0 28.5 41.0 62-63 35.32825 38.0 35.0 40.0 28.0 41.0 64-65 34.875249999999994 37.5 34.0 40.0 27.0 41.0 66-67 34.473875 37.0 34.0 39.5 26.0 41.0 68-69 34.104375000000005 36.5 34.0 39.0 26.0 41.0 70-71 33.72725 36.0 33.5 39.0 26.0 40.0 72-73 33.241875 35.5 33.0 38.5 26.0 40.0 74-75 32.818125 35.0 32.5 37.0 25.5 39.0 76-77 31.893625 34.5 31.5 36.0 24.5 39.0 78-79 32.00975 35.0 32.0 36.0 24.5 38.5 80-81 31.823625 35.0 32.0 36.0 24.5 37.0 82-83 31.566125 35.0 32.0 35.5 24.5 37.0 84-85 31.181 34.5 32.0 35.0 23.0 36.5 86-87 30.88525 34.0 31.5 35.0 20.0 36.0 88-89 30.571125000000002 34.0 31.0 35.0 20.0 36.0 90-91 30.343875 34.0 31.0 35.0 18.5 35.0 92-93 30.016125000000002 34.0 31.0 35.0 16.5 35.0 94-95 29.835875 34.0 30.5 35.0 14.0 35.0 96-97 29.698875 34.0 31.0 35.0 4.5 35.0 98-99 29.301000000000002 34.0 30.0 35.0 2.0 35.0 100-101 28.696125000000002 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 13.0 4 10.0 5 4.0 6 1.0 7 5.0 8 5.0 9 7.0 10 9.0 11 6.0 12 13.0 13 6.0 14 10.0 15 14.0 16 11.0 17 9.0 18 19.0 19 11.0 20 17.0 21 16.0 22 21.0 23 14.0 24 23.0 25 25.0 26 31.0 27 38.0 28 51.0 29 52.0 30 51.0 31 76.0 32 101.0 33 130.0 34 193.0 35 292.0 36 471.0 37 972.0 38 1114.0 39 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75949367088607 6.506329113924051 8.506329113924052 46.22784810126582 2 26.3 9.049999999999999 32.550000000000004 32.1 3 25.68784392196098 10.98049024512256 23.08654327163582 40.24512256128064 4 28.925 17.75 20.474999999999998 32.85 5 28.225 24.325 24.349999999999998 23.1 6 22.475 29.575000000000003 25.650000000000002 22.3 7 16.7 24.875 40.825 17.599999999999998 8 19.525000000000002 24.2 34.050000000000004 22.225 9 18.925 22.55 35.6 22.925 10-11 19.7 32.75 27.575 19.975 12-13 21.8125 25.6125 29.375 23.200000000000003 14-15 21.2375 27.325 29.925 21.512500000000003 16-17 21.1125 27.962500000000002 28.199999999999996 22.725 18-19 21.15 28.599999999999998 26.5625 23.6875 20-21 21.7375 26.8125 28.4125 23.0375 22-23 22.662499999999998 26.474999999999998 26.8625 24.0 24-25 21.0125 27.525 27.875 23.5875 26-27 21.4 26.85 27.9375 23.8125 28-29 22.35 26.625 27.9375 23.0875 30-31 21.5 27.537499999999998 27.3125 23.65 32-33 21.837500000000002 27.5875 27.5625 23.0125 34-35 22.037499999999998 27.700000000000003 27.450000000000003 22.8125 36-37 21.6 26.8125 27.712500000000002 23.875 38-39 22.175 27.224999999999998 27.250000000000004 23.35 40-41 21.6125 28.199999999999996 26.950000000000003 23.2375 42-43 21.5 27.4125 27.375 23.7125 44-45 22.55 26.450000000000003 28.15 22.85 46-47 21.7375 27.6875 27.0625 23.5125 48-49 20.962500000000002 27.6875 27.8375 23.5125 50-51 22.575 27.025 26.85 23.549999999999997 52-53 22.06525815726966 27.69096137017127 27.51593949243655 22.727840980122515 54-55 22.075 27.8375 26.875 23.2125 56-57 21.7 26.787499999999998 28.712500000000002 22.8 58-59 22.412499999999998 26.0625 28.1875 23.3375 60-61 20.625 27.9125 28.762500000000003 22.7 62-63 21.9375 27.750000000000004 27.037499999999998 23.275000000000002 64-65 21.817954488622153 27.7569392348087 27.131782945736433 23.293323330832706 66-67 22.115264408051004 26.828353544193025 27.928491061382672 23.1278909863733 68-69 21.092773193298324 27.7569392348087 27.906976744186046 23.243310827706924 70-71 21.54288572143036 27.569392348087025 28.132033008252062 22.755688922230558 72-73 21.517879469867466 27.656914228557138 27.106776694173547 23.718429607401852 74-75 22.640330041255158 26.115764470558823 27.340917614701837 23.902987873484186 76-77 21.352669083635455 27.428428553569194 27.97849731216402 23.24040505063133 78-79 21.712500000000002 26.924999999999997 27.6375 23.724999999999998 80-81 22.2125 26.7625 28.1 22.925 82-83 21.4875 28.1375 26.875 23.5 84-85 22.3 27.750000000000004 27.0 22.95 86-87 22.240280035004375 27.303412926615827 27.340917614701837 23.11538942367796 88-89 22.125 28.050000000000004 26.724999999999998 23.1 90-91 21.8875 27.0125 26.924999999999997 24.175 92-93 21.8625 27.712500000000002 27.3875 23.0375 94-95 22.4375 28.0875 26.674999999999997 22.8 96-97 22.0875 27.987499999999997 27.05 22.875 98-99 21.575 27.4125 28.025 22.9875 100-101 22.477809726215778 27.528441055131893 26.978372296537067 23.015376922115262 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 5.0 28 6.5 29 5.5 30 9.0 31 14.5 32 18.0 33 20.0 34 31.0 35 44.5 36 60.5 37 85.0 38 105.5 39 126.0 40 159.5 41 188.0 42 216.0 43 237.0 44 252.0 45 264.0 46 257.5 47 275.0 48 268.0 49 233.5 50 204.5 51 167.5 52 142.5 53 119.0 54 99.5 55 84.0 56 65.0 57 52.5 58 44.5 59 34.0 60 27.5 61 24.0 62 15.0 63 7.0 64 6.5 65 7.5 66 5.5 67 1.5 68 1.5 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0125 68-69 0.025 70-71 0.025 72-73 0.025 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55035605289929 96.875 2 1.2207527975584944 2.4 3 0.1780264496439471 0.525 4 0.050864699898270596 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.7125 0.0 0.0 0.0 0.0 82-83 0.9 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.1749999999999998 0.0 0.0 0.0 0.0 88-89 1.3875000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864422 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864422_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14 34.0 31.0 34.0 30.0 34.0 2 32.20925 34.0 31.0 34.0 30.0 34.0 3 32.22325 34.0 31.0 34.0 30.0 34.0 4 35.56675 37.0 35.0 37.0 33.0 37.0 5 35.451 37.0 35.0 37.0 33.0 37.0 6 35.42175 37.0 35.0 37.0 33.0 37.0 7 35.413 37.0 35.0 37.0 33.0 37.0 8 35.43925 37.0 35.0 37.0 33.0 37.0 9 37.08675 39.0 37.0 39.0 33.0 39.0 10-11 37.025625000000005 39.0 37.0 39.0 33.0 39.0 12-13 36.96275 39.0 37.0 39.0 33.0 39.0 14-15 38.396625 41.0 38.0 41.0 34.0 41.0 16-17 38.2995 41.0 38.0 41.0 33.0 41.0 18-19 38.2535 40.5 38.0 41.0 33.0 41.0 20-21 38.2025 40.0 38.0 41.0 33.5 41.0 22-23 38.063 40.0 38.0 41.0 33.0 41.0 24-25 38.061375 40.0 38.0 41.0 33.0 41.0 26-27 37.930875 40.0 38.0 41.0 33.0 41.0 28-29 37.84725 40.0 38.0 41.0 33.0 41.0 30-31 37.759375000000006 40.0 38.0 41.0 32.5 41.0 32-33 37.613 40.0 38.0 41.0 32.0 41.0 34-35 37.619749999999996 40.0 38.0 41.0 32.0 41.0 36-37 37.502250000000004 40.0 38.0 41.0 31.5 41.0 38-39 37.42775 40.0 38.0 41.0 31.0 41.0 40-41 37.213499999999996 40.0 37.5 41.0 31.0 41.0 42-43 37.115625 40.0 37.0 41.0 31.0 41.0 44-45 36.968625 40.0 37.0 41.0 30.0 41.0 46-47 36.705375000000004 40.0 36.5 41.0 30.0 41.0 48-49 36.49625 39.0 36.0 41.0 30.0 41.0 50-51 36.330875000000006 39.5 36.5 40.5 30.0 41.0 52-53 36.50475 39.0 37.0 40.5 30.5 41.0 54-55 36.70075 40.0 37.0 41.0 30.0 41.0 56-57 36.6375 40.0 36.0 41.0 30.5 41.0 58-59 36.14575 39.0 36.0 41.0 29.0 41.0 60-61 35.853 39.0 35.0 41.0 28.0 41.0 62-63 35.615875 39.0 35.0 40.5 28.0 41.0 64-65 35.302 38.0 35.0 40.0 28.0 41.0 66-67 34.957875 37.0 34.5 40.0 28.0 41.0 68-69 34.5325 37.0 34.0 39.0 27.5 41.0 70-71 33.981375 36.0 34.0 39.0 26.0 40.5 72-73 33.555 36.0 34.0 38.5 26.0 40.0 74-75 33.148875000000004 35.0 33.5 37.0 26.0 39.0 76-77 32.7025 35.0 33.0 37.0 26.0 39.0 78-79 32.21325 35.0 33.0 36.0 24.5 38.0 80-81 31.77 35.0 32.5 36.0 23.5 37.0 82-83 31.417749999999998 35.0 32.0 35.5 23.0 37.0 84-85 30.954875 35.0 31.5 35.0 20.0 36.0 86-87 30.664875000000002 34.5 31.0 35.0 19.5 36.0 88-89 30.500500000000002 34.0 31.0 35.0 18.5 36.0 90-91 30.336375 34.0 31.0 35.0 18.0 35.0 92-93 30.09875 34.0 31.0 35.0 14.5 35.0 94-95 29.6085 34.0 31.0 35.0 4.5 35.0 96-97 29.263624999999998 34.0 30.0 35.0 2.0 35.0 98-99 28.901 34.0 30.0 35.0 2.0 35.0 100-101 27.786125 33.5 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 5.0 4 5.0 5 3.0 6 6.0 7 7.0 8 5.0 9 9.0 10 8.0 11 10.0 12 11.0 13 7.0 14 13.0 15 11.0 16 15.0 17 9.0 18 14.0 19 19.0 20 16.0 21 15.0 22 16.0 23 27.0 24 18.0 25 32.0 26 32.0 27 39.0 28 62.0 29 55.0 30 66.0 31 73.0 32 104.0 33 128.0 34 175.0 35 263.0 36 492.0 37 961.0 38 1091.0 39 149.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.9 17.224999999999998 13.4 40.475 2 25.25 23.1 33.650000000000006 18.0 3 19.675 25.7 31.724999999999998 22.900000000000002 4 21.05 32.45 25.224999999999998 21.275 5 24.7 34.449999999999996 24.275 16.575 6 20.075000000000003 37.25 23.1 19.575 7 20.9 21.25 37.8 20.05 8 22.825 24.275 27.875 25.025 9 20.724999999999998 24.5 29.625 25.15 10-11 23.1375 32.025 23.9125 20.925 12-13 23.549999999999997 25.900000000000002 26.7125 23.8375 14-15 22.425 28.1375 27.487499999999997 21.95 16-17 22.425 27.537499999999998 27.325 22.7125 18-19 22.9875 28.4125 26.737499999999997 21.8625 20-21 24.0125 27.8125 26.487500000000004 21.6875 22-23 23.400000000000002 28.325 26.737499999999997 21.5375 24-25 22.2125 27.075 28.3875 22.325 26-27 22.325 28.449999999999996 27.212500000000002 22.0125 28-29 22.7125 28.325 26.8375 22.125 30-31 22.75 28.625 25.674999999999997 22.95 32-33 22.1 28.262500000000003 27.900000000000002 21.7375 34-35 23.4875 27.55 27.200000000000003 21.762500000000003 36-37 23.1 28.212500000000002 27.474999999999998 21.212500000000002 38-39 22.912499999999998 28.725 26.474999999999998 21.8875 40-41 23.4375 28.3625 26.025 22.175 42-43 22.7375 27.500000000000004 27.4125 22.35 44-45 23.0625 27.900000000000002 27.05 21.987499999999997 46-47 22.1875 28.599999999999998 27.150000000000002 22.0625 48-49 23.175 28.3125 26.375 22.1375 50-51 23.5 27.4125 26.687499999999996 22.400000000000002 52-53 23.625 27.950000000000003 27.175 21.25 54-55 22.775000000000002 27.725 27.4125 22.0875 56-57 22.85 28.1 27.500000000000004 21.55 58-59 23.425 27.962500000000002 26.7125 21.9 60-61 22.8 28.325 27.05 21.825 62-63 23.599999999999998 27.725 25.912499999999998 22.7625 64-65 23.849999999999998 26.887499999999996 27.5875 21.675 66-67 22.3875 27.212500000000002 28.262500000000003 22.1375 68-69 22.7375 26.9625 28.1875 22.112499999999997 70-71 23.175 28.675 26.5625 21.587500000000002 72-73 22.775000000000002 27.4125 27.0625 22.75 74-75 22.5625 28.325 27.0125 22.1 76-77 23.025000000000002 27.800000000000004 27.05 22.125 78-79 22.412499999999998 28.6125 26.6 22.375 80-81 23.5375 27.8875 26.387500000000003 22.1875 82-83 23.5875 27.9125 26.450000000000003 22.05 84-85 23.4625 27.725 26.5625 22.25 86-87 23.05 28.1125 26.387500000000003 22.45 88-89 23.799999999999997 28.799999999999997 26.0625 21.337500000000002 90-91 22.475 28.6125 26.650000000000002 22.2625 92-93 23.35 27.375 27.275 22.0 94-95 23.05 28.925 26.3 21.725 96-97 24.2 27.700000000000003 26.487500000000004 21.6125 98-99 24.1125 28.9375 25.45 21.5 100-101 24.375 28.237499999999997 26.687499999999996 20.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 4.0 28 6.5 29 6.0 30 8.0 31 13.0 32 17.0 33 28.5 34 36.5 35 48.5 36 68.0 37 83.5 38 112.5 39 150.0 40 184.5 41 213.0 42 240.5 43 255.0 44 257.5 45 266.5 46 267.0 47 264.0 48 256.5 49 227.0 50 189.0 51 151.5 52 125.5 53 96.0 54 85.0 55 82.5 56 57.0 57 47.5 58 37.5 59 29.5 60 28.0 61 18.0 62 10.5 63 5.5 64 3.0 65 3.0 66 2.0 67 2.0 68 2.5 69 2.0 70 1.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0911386013633 98.125 2 0.8836152486745772 1.7500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.85 0.0 0.0 0.0 0.0 84-85 1.0499999999999998 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787094 spots for ERR1864422.sra Written 787094 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra Read 787077 spots for ERR1864422.sra Written 787077 spots for ERR1864422.sra SRR ids: ['ERR1864422.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5rb23pqu ERR1864422.sra spots: 15741557 blocks: [[1, 787077], [787078, 1574154], [1574155, 2361231], [2361232, 3148308], [3148309, 3935385], [3935386, 4722462], [4722463, 5509539], [5509540, 6296616], [6296617, 7083693], [7083694, 7870770], [7870771, 8657847], [8657848, 9444924], [9444925, 10232001], [10232002, 11019078], [11019079, 11806155], [11806156, 12593232], [12593233, 13380309], [13380310, 14167386], [14167387, 14954463], [14954464, 15741557]] ERR1864422 file size 3775335 ERR1864422 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864422 ERR1864422_1.fastq ERR1864422_2.fastq Input file: ERR1864422_1.fastq Paired file: ERR1864422_2.fastq trimmed: ERR1864422-trimmed-pair1.fastq, ERR1864422-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:35:16 2025 >> started Thu Feb 13 04:38:08 2025 >> done (171.830s) 15741557 read pairs processed; of these: 243089 ( 1.54%) short read pairs filtered out after trimming by size control 266387 ( 1.69%) empty read pairs filtered out after trimming by size control 15232081 (96.76%) read pairs available; of these: 3586928 (23.55%) trimmed read pairs available after processing 11645153 (76.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 129 0.00% 19 238 0.00% 20 435 0.00% 21 529 0.00% 22 665 0.00% 23 817 0.01% 24 1012 0.01% 25 1242 0.01% 26 1497 0.01% 27 1646 0.01% 28 1947 0.01% 29 2284 0.01% 30 2594 0.02% 31 2835 0.02% 32 3321 0.02% 33 3545 0.02% 34 3995 0.03% 35 4376 0.03% 36 4609 0.03% 37 4981 0.03% 38 5429 0.04% 39 5731 0.04% 40 6196 0.04% 41 6473 0.04% 42 6836 0.04% 43 7247 0.05% 44 7578 0.05% 45 8047 0.05% 46 8448 0.06% 47 8801 0.06% 48 9452 0.06% 49 9588 0.06% 50 9869 0.06% 51 10211 0.07% 52 10987 0.07% 53 11549 0.08% 54 11981 0.08% 55 12490 0.08% 56 13198 0.09% 57 13871 0.09% 58 14624 0.10% 59 18173 0.12% 60 21740 0.14% 61 22045 0.14% 62 22850 0.15% 63 23843 0.16% 64 24358 0.16% 65 25385 0.17% 66 26429 0.17% 67 27163 0.18% 68 28114 0.18% 69 29213 0.19% 70 30918 0.20% 71 32382 0.21% 72 33816 0.22% 73 34461 0.23% 74 35914 0.24% 75 37008 0.24% 76 37883 0.25% 77 39541 0.26% 78 41869 0.27% 79 44393 0.29% 80 47463 0.31% 81 48955 0.32% 82 52373 0.34% 83 54204 0.36% 84 56972 0.37% 85 60223 0.40% 86 63764 0.42% 87 67102 0.44% 88 69340 0.46% 89 72669 0.48% 90 80794 0.53% 91 88880 0.58% 92 98311 0.65% 93 109290 0.72% 94 124128 0.81% 95 144161 0.95% 96 168974 1.11% 97 207156 1.36% 98 266157 1.75% 99 356839 2.34% 100 470372 3.09% 101 11645153 76.45% 15232081 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=12 prefix-density=0.33 prefix-fanout=4.1 sequence=CATCTTCTCATCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=24.88 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=5.7 sequence=TCTTCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAGTAGCTAACTCCTGAGTCTGAACTTGTTTTACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=28 prefix-density=0.32 prefix-fanout=2.8 sequence=TGCAAGTGCGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=82.58 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.0 sequence=AAGGGAAAGGGGGAGAAATGGCAGCACAAGCACTCGTGTCATCATCTCTTACCTCTTCAGTGGAGACTGCTAGGAAAGTGCTAGGAGCAAGACCAACCCAGTCACCATTCGTGTCCTCAAGGAAAAGCTCTTTTGTTGTTAGAGCAGCTTCTACTCCCCCTGTTAAGCAAGGAAACAGGCAGCTGTGGTTCGCATCGAAACAAAGCCTGTCTTACTTGGATGGCAGCCTTCCAGGTGACTTCGGATTCGACCCACTCGGACTTTCAGACCCTGAAGGCACAGGAGGTTTCATTGAGCCAAAATGGTTAGCCTACGGTGAGATCATTAACGGACGATATGCCATGTTGGGGGCGGTTGGTGCCATTGCACCAGAAATTCTTGGAAAGGCTGGCCTCATACCTCCGGAGACCGCCCTCCCTTGGTTCAGGACTGGTGTCATCCCACCGGCCGGGACATACAGCTACTGGGCAGATCCATACACGCTGTTTGTTTTCGAGATGGCACTCATGGG ERR1864422 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:49:21 Started mapping on | Feb 13 05:49:27 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 158.48 Number of input reads | 15232081 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14715854 Uniquely mapped reads % | 96.61% Average mapped length | 195.29 Number of splices: Total | 9084311 Number of splices: Annotated (sjdb) | 8950524 Number of splices: GT/AG | 8917372 Number of splices: GC/AG | 145389 Number of splices: AT/AC | 9269 Number of splices: Non-canonical | 12281 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 3.04 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391965 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 56827 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 143845 143845 143845 N_multimapping 391965 391965 391965 N_noFeature 304348 14564327 361096 N_ambiguous 157577 690 62368 UnstrandedReadsAssigned:14253929 PositiveStrandReadsAssigned:150837 NegativeStrandReadsAssigned:14292390 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864422 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864422-trimmed-pair1.fastq ERR1864422-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,232,081 reads, 14,496,694 reads pseudoaligned [quant] estimated average fragment length: 154.294 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 ERR1864422.ke.tsv 34699 ERR1864422.se.tsv 87100 total ==> ERR1864422.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1864.71 594 18.6284 Potri.005G024800.1.v4.1 1035 881.706 438 29.0502 Potri.004G059700.1.v4.1 961 807.706 327 23.6752 Potri.007G009000.2.v4.1 1416 1262.71 0 0 Potri.003G141000.2.v4.1 2943 2789.71 512 10.7327 Potri.016G087400.1.v4.1 270 121.652 1708 821.048 Potri.015G069301.1.v4.1 564 410.764 0 0 Potri.010G195200.1.v4.1 1773 1619.71 21 0.758196 Potri.012G127500.1.v4.1 977 823.706 220 15.6188 ==> ERR1864422.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 18 ERR1864422 completed mapping pipeline successfully