Starting /dee2/code/volunteer_pipeline.sh ERR1864423 current disk space = 3052005650432 free memory = 1576510748 ERR1864423 SRAfilesize 3a355c368a02195d5907b4dfd9338ea1 ERR1864423.sra ERR1864423.sra file validated ERR1864423 is paired end ERR1864423 is conventional basespace ERR1864423 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864423_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6665 33.0 31.0 34.0 30.0 34.0 2 31.93875 34.0 31.0 34.0 30.0 34.0 3 32.18225 34.0 31.0 34.0 30.0 34.0 4 35.63125 37.0 35.0 37.0 33.0 37.0 5 35.3695 37.0 35.0 37.0 33.0 37.0 6 35.333 37.0 35.0 37.0 33.0 37.0 7 35.36175 37.0 35.0 37.0 33.0 37.0 8 35.34825 37.0 35.0 37.0 33.0 37.0 9 37.016 39.0 37.0 39.0 34.0 39.0 10-11 36.860125 39.0 37.0 39.0 33.0 39.0 12-13 36.8675 39.0 37.0 39.0 33.0 39.0 14-15 38.1495 40.5 38.0 41.0 33.0 41.0 16-17 37.847875 40.0 38.0 41.0 32.5 41.0 18-19 37.96525 40.0 38.0 41.0 33.0 41.0 20-21 37.8645 40.0 38.0 41.0 33.0 41.0 22-23 37.794125 40.0 38.0 41.0 33.0 41.0 24-25 37.754374999999996 40.0 38.0 41.0 32.5 41.0 26-27 37.663125 40.0 38.0 41.0 32.5 41.0 28-29 37.2575 40.0 37.5 41.0 31.5 41.0 30-31 37.26575 40.0 37.5 41.0 31.0 41.0 32-33 37.120125 40.0 37.0 41.0 31.0 41.0 34-35 37.061375 40.0 37.0 41.0 31.0 41.0 36-37 36.99225 40.0 37.0 41.0 30.5 41.0 38-39 37.044624999999996 40.0 37.0 41.0 30.5 41.0 40-41 36.840875 40.0 37.0 41.0 30.0 41.0 42-43 36.61175 40.0 36.5 41.0 30.0 41.0 44-45 36.5155 40.0 36.0 41.0 30.0 41.0 46-47 36.397000000000006 39.0 36.0 41.0 30.0 41.0 48-49 36.54525 40.0 36.5 41.0 30.0 41.0 50-51 36.321375 40.0 36.0 41.0 29.0 41.0 52-53 36.357124999999996 39.5 36.0 41.0 29.5 41.0 54-55 36.196 39.0 35.5 41.0 28.5 41.0 56-57 35.906000000000006 39.0 35.0 41.0 28.5 41.0 58-59 35.69425 39.0 35.0 41.0 28.0 41.0 60-61 35.614125 39.0 35.0 40.5 28.0 41.0 62-63 35.250625 38.0 35.0 40.0 28.0 41.0 64-65 34.735749999999996 38.0 34.0 40.0 26.0 41.0 66-67 34.551500000000004 37.0 34.0 40.0 26.5 41.0 68-69 34.04025 36.5 34.0 39.0 26.0 41.0 70-71 33.67475 36.0 33.5 39.0 26.0 40.5 72-73 33.1105 35.5 33.0 39.0 23.5 40.0 74-75 32.826499999999996 35.0 33.0 37.5 24.5 39.0 76-77 31.5805 34.5 31.0 36.0 22.5 39.0 78-79 31.981125 35.0 32.0 36.5 23.5 39.0 80-81 31.849125 35.0 32.0 36.0 24.5 37.5 82-83 31.527250000000002 35.0 32.0 36.0 22.0 37.0 84-85 31.213875 35.0 32.0 35.5 21.0 36.5 86-87 30.71 34.5 31.5 35.0 19.0 36.0 88-89 30.432625 34.0 31.0 35.0 18.0 36.0 90-91 30.40375 34.0 31.0 35.0 18.0 36.0 92-93 30.06975 34.0 31.0 35.0 13.5 35.0 94-95 29.63975 34.0 30.5 35.0 4.5 35.0 96-97 29.440875 34.0 30.0 35.0 2.0 35.0 98-99 28.994374999999998 34.0 30.0 35.0 2.0 35.0 100-101 27.368125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 11.0 4 12.0 5 7.0 6 3.0 7 6.0 8 7.0 9 11.0 10 10.0 11 10.0 12 11.0 13 10.0 14 12.0 15 14.0 16 10.0 17 15.0 18 14.0 19 14.0 20 8.0 21 14.0 22 16.0 23 13.0 24 26.0 25 24.0 26 40.0 27 42.0 28 39.0 29 63.0 30 72.0 31 82.0 32 102.0 33 149.0 34 214.0 35 327.0 36 473.0 37 873.0 38 1060.0 39 147.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.579013906447535 5.891276864728192 6.2958280657395695 45.2338811630847 2 26.125 7.425 34.050000000000004 32.4 3 24.099999999999998 9.475 22.900000000000002 43.525000000000006 4 28.499999999999996 17.1 21.075 33.324999999999996 5 27.3 22.525000000000002 25.95 24.224999999999998 6 23.125 26.974999999999998 27.275 22.625 7 17.0 23.225 41.9 17.875 8 17.424999999999997 23.275000000000002 36.95 22.35 9 18.9 21.575 38.0 21.525 10-11 19.5625 32.5625 29.037499999999998 18.8375 12-13 20.775 25.75 30.8125 22.662499999999998 14-15 20.0875 26.887499999999996 29.799999999999997 23.225 16-17 21.3 27.8875 27.8625 22.95 18-19 21.2375 27.3125 28.775000000000002 22.675 20-21 21.75 28.15 27.450000000000003 22.650000000000002 22-23 20.275000000000002 27.975 29.525000000000002 22.225 24-25 21.05 27.187499999999996 27.900000000000002 23.8625 26-27 20.225 27.175 28.462500000000002 24.1375 28-29 21.025 27.462500000000002 27.9375 23.575 30-31 21.087500000000002 27.575 27.0125 24.325 32-33 20.3375 28.1625 28.287499999999998 23.2125 34-35 20.5375 26.987499999999997 28.025 24.45 36-37 20.674999999999997 27.925 27.925 23.474999999999998 38-39 21.712500000000002 27.3875 28.262500000000003 22.6375 40-41 21.25 27.250000000000004 28.075 23.425 42-43 20.962500000000002 27.474999999999998 28.4 23.1625 44-45 21.462500000000002 26.8125 28.8875 22.8375 46-47 21.7 27.250000000000004 27.875 23.175 48-49 21.212500000000002 27.075 28.762500000000003 22.95 50-51 20.6375 28.175 28.275 22.912499999999998 52-53 21.475 27.212500000000002 27.175 24.1375 54-55 21.1375 27.175 28.050000000000004 23.6375 56-57 20.7625 27.4125 28.375 23.45 58-59 20.3625 28.249999999999996 28.3125 23.075000000000003 60-61 21.3625 26.5875 28.15 23.9 62-63 20.6625 28.4125 27.4125 23.5125 64-65 21.3 27.325 28.3875 22.9875 66-67 21.8125 27.35 26.775 24.0625 68-69 20.25 28.299999999999997 29.099999999999998 22.35 70-71 20.6875 27.875 28.3125 23.125 72-73 21.337500000000002 27.8125 27.0125 23.8375 74-75 22.35 27.0 27.975 22.675 76-77 19.975 27.825 28.175 24.025 78-79 21.087500000000002 27.3375 29.2375 22.3375 80-81 21.25 27.650000000000002 28.349999999999998 22.75 82-83 20.7375 28.537499999999998 27.4125 23.3125 84-85 21.8 26.950000000000003 28.6375 22.6125 86-87 21.8125 27.750000000000004 28.249999999999996 22.1875 88-89 20.599999999999998 27.9375 27.650000000000002 23.8125 90-91 21.1375 27.575 28.050000000000004 23.2375 92-93 21.525 28.287499999999998 27.0875 23.1 94-95 22.45 27.437499999999996 27.3875 22.725 96-97 21.775 27.8875 26.6125 23.724999999999998 98-99 21.85 27.825 28.175 22.15 100-101 21.75 27.2625 26.8 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.5 25 1.5 26 4.0 27 6.5 28 5.0 29 7.0 30 13.0 31 17.5 32 20.0 33 28.0 34 35.0 35 51.0 36 62.5 37 73.0 38 109.0 39 141.0 40 165.0 41 187.5 42 234.5 43 272.5 44 279.0 45 273.5 46 287.5 47 280.0 48 236.0 49 225.5 50 196.5 51 165.0 52 140.0 53 113.0 54 91.0 55 60.5 56 52.0 57 43.0 58 31.0 59 24.5 60 14.5 61 13.0 62 12.5 63 8.0 64 6.0 65 5.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03870478117885 97.875 2 0.7589172780166962 1.5 3 0.17708069820389577 0.525 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTAATG 15 0.009962372 47.493755 34-35 >>END_MODULE ERR1864423 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864423_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.78225 33.0 31.0 34.0 30.0 34.0 2 31.90125 34.0 31.0 34.0 30.0 34.0 3 31.93875 34.0 31.0 34.0 30.0 34.0 4 35.4505 37.0 35.0 37.0 33.0 37.0 5 35.322 37.0 35.0 37.0 33.0 37.0 6 35.381 37.0 35.0 37.0 33.0 37.0 7 35.33075 37.0 35.0 37.0 33.0 37.0 8 35.358 37.0 35.0 37.0 33.0 37.0 9 37.033 39.0 37.0 39.0 33.0 39.0 10-11 36.828125 39.0 37.0 39.0 32.5 39.0 12-13 36.67725 39.0 37.0 39.0 32.5 39.0 14-15 37.91975 40.0 38.0 41.0 32.5 41.0 16-17 37.994875 40.0 38.0 41.0 33.0 41.0 18-19 38.02925 40.0 38.0 41.0 33.0 41.0 20-21 37.867875 40.0 38.0 41.0 32.5 41.0 22-23 37.957499999999996 40.0 38.0 41.0 33.0 41.0 24-25 37.902 40.0 38.0 41.0 32.5 41.0 26-27 37.6305 40.0 38.0 41.0 32.0 41.0 28-29 37.406125 40.0 38.0 41.0 31.5 41.0 30-31 37.458125 40.0 38.0 41.0 31.5 41.0 32-33 37.275625 40.0 38.0 41.0 31.0 41.0 34-35 37.1415 40.0 37.0 41.0 30.5 41.0 36-37 36.752125 40.0 36.5 41.0 30.0 41.0 38-39 36.4555 39.0 36.0 41.0 29.5 41.0 40-41 36.512874999999994 39.0 36.0 41.0 30.0 41.0 42-43 36.4295 39.0 36.0 41.0 30.0 41.0 44-45 36.110875 39.0 35.5 40.0 29.5 41.0 46-47 36.285125 39.0 36.0 40.5 30.0 41.0 48-49 35.814375 39.0 35.0 40.5 27.5 41.0 50-51 35.257125 38.5 34.5 39.5 27.5 40.5 52-53 35.2305 38.0 34.0 40.0 27.0 40.5 54-55 36.192625 39.0 36.0 40.5 28.5 41.0 56-57 36.29775 39.0 36.0 41.0 28.5 41.0 58-59 35.766625 39.0 35.0 41.0 28.0 41.0 60-61 35.706375 39.0 35.0 41.0 28.0 41.0 62-63 35.539 38.5 35.0 40.0 28.0 41.0 64-65 35.027625 37.5 34.5 40.0 27.0 41.0 66-67 34.544875000000005 37.0 34.0 40.0 26.0 41.0 68-69 34.2455 37.0 34.0 39.0 26.0 41.0 70-71 33.850875 36.0 34.0 39.0 26.0 40.5 72-73 33.247749999999996 35.5 33.0 38.5 24.5 40.0 74-75 32.771625 35.0 32.5 37.5 25.0 39.0 76-77 32.165875 35.0 32.0 37.0 22.5 39.0 78-79 31.6835 35.0 32.0 36.5 21.0 38.5 80-81 31.481625 35.0 32.0 36.0 21.5 37.0 82-83 31.169249999999998 35.0 32.0 35.5 20.5 37.0 84-85 30.810499999999998 35.0 31.0 35.0 19.0 36.0 86-87 30.566000000000003 34.0 31.0 35.0 18.5 36.0 88-89 30.303625 34.0 31.0 35.0 17.0 36.0 90-91 29.924374999999998 34.0 31.0 35.0 9.0 35.0 92-93 29.09575 34.0 29.0 35.0 3.5 35.0 94-95 28.926000000000002 34.0 29.0 35.0 2.0 35.0 96-97 28.908875000000002 34.0 29.5 35.0 2.0 35.0 98-99 28.575875 34.0 29.5 35.0 2.0 35.0 100-101 27.543125000000003 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 9.0 4 3.0 5 7.0 6 6.0 7 11.0 8 4.0 9 8.0 10 19.0 11 4.0 12 14.0 13 13.0 14 9.0 15 13.0 16 10.0 17 17.0 18 20.0 19 13.0 20 28.0 21 21.0 22 17.0 23 19.0 24 32.0 25 41.0 26 34.0 27 44.0 28 56.0 29 68.0 30 75.0 31 71.0 32 116.0 33 152.0 34 215.0 35 314.0 36 487.0 37 934.0 38 949.0 39 125.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.5 19.775000000000002 12.475 38.25 2 24.099999999999998 26.375 34.0 15.525 3 18.75 27.875 30.925000000000004 22.45 4 22.525000000000002 32.75 23.65 21.075 5 23.799999999999997 36.575 22.95 16.675 6 20.150000000000002 38.125 24.0 17.724999999999998 7 20.0 20.75 37.45 21.8 8 19.375 25.85 29.425 25.35 9 21.05 24.9 30.825000000000003 23.225 10-11 23.7 31.5375 23.6375 21.125 12-13 23.4125 25.9625 27.4125 23.2125 14-15 22.0875 28.5875 28.4 20.925 16-17 24.3 27.037499999999998 26.987499999999997 21.675 18-19 23.0125 28.462500000000002 27.487499999999997 21.0375 20-21 24.175 28.9875 26.5375 20.3 22-23 22.5125 28.7375 27.237499999999997 21.512500000000003 24-25 22.6875 28.9 27.175 21.2375 26-27 22.525000000000002 28.749999999999996 27.5625 21.1625 28-29 22.9875 28.725 26.3125 21.975 30-31 22.7625 28.199999999999996 27.750000000000004 21.2875 32-33 23.3125 28.812500000000004 27.025 20.849999999999998 34-35 23.0125 28.749999999999996 27.6125 20.625 36-37 22.7 28.15 28.1125 21.0375 38-39 23.0375 28.075 27.025 21.8625 40-41 22.9625 28.762500000000003 26.4625 21.8125 42-43 23.825 27.6125 27.150000000000002 21.4125 44-45 22.5875 29.175 27.3125 20.925 46-47 23.375 28.462500000000002 26.125 22.037499999999998 48-49 22.6375 29.2 27.212500000000002 20.95 50-51 22.575 28.537499999999998 26.924999999999997 21.9625 52-53 22.912499999999998 28.0875 27.037499999999998 21.9625 54-55 23.5875 28.037499999999998 26.875 21.5 56-57 22.287499999999998 28.525 27.237499999999997 21.95 58-59 23.25 28.775000000000002 27.1625 20.8125 60-61 23.0375 28.1375 27.650000000000002 21.175 62-63 22.5 29.5375 27.275 20.6875 64-65 23.375 28.375 26.8375 21.4125 66-67 23.4625 27.750000000000004 27.275 21.512500000000003 68-69 22.35 28.9 27.6125 21.1375 70-71 23.5 27.925 27.150000000000002 21.425 72-73 23.0 28.175 27.8875 20.9375 74-75 23.4625 29.175 26.174999999999997 21.1875 76-77 23.400000000000002 28.000000000000004 27.750000000000004 20.849999999999998 78-79 23.2875 28.425 26.424999999999997 21.8625 80-81 22.5 29.4 26.924999999999997 21.175 82-83 23.4625 27.650000000000002 27.6125 21.275 84-85 23.674999999999997 28.712500000000002 26.025 21.587500000000002 86-87 22.5875 29.3875 26.375 21.65 88-89 23.2375 28.1625 26.825 21.775 90-91 23.25 27.625 26.987499999999997 22.1375 92-93 24.337500000000002 28.262500000000003 27.0125 20.3875 94-95 24.337500000000002 27.9125 26.924999999999997 20.825 96-97 23.3375 27.375 27.8625 21.425 98-99 24.375 27.55 26.9125 21.1625 100-101 24.0125 27.825 27.037499999999998 21.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 3.0 26 2.0 27 1.5 28 5.0 29 8.5 30 10.5 31 14.0 32 19.5 33 27.5 34 43.5 35 62.0 36 74.0 37 99.5 38 127.5 39 167.5 40 199.0 41 221.5 42 264.5 43 271.0 44 274.5 45 286.0 46 267.5 47 250.5 48 237.0 49 201.5 50 169.0 51 147.0 52 119.5 53 102.5 54 88.5 55 62.5 56 47.0 57 37.0 58 22.5 59 15.5 60 11.5 61 7.5 62 6.0 63 7.5 64 6.5 65 4.0 66 1.0 67 1.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793497 spots for ERR1864423.sra Written 793497 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra Read 793489 spots for ERR1864423.sra Written 793489 spots for ERR1864423.sra SRR ids: ['ERR1864423.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2aerhoxn ERR1864423.sra spots: 15869788 blocks: [[1, 793489], [793490, 1586978], [1586979, 2380467], [2380468, 3173956], [3173957, 3967445], [3967446, 4760934], [4760935, 5554423], [5554424, 6347912], [6347913, 7141401], [7141402, 7934890], [7934891, 8728379], [8728380, 9521868], [9521869, 10315357], [10315358, 11108846], [11108847, 11902335], [11902336, 12695824], [12695825, 13489313], [13489314, 14282802], [14282803, 15076291], [15076292, 15869788]] ERR1864423 file size 3806266 ERR1864423 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864423 ERR1864423_1.fastq ERR1864423_2.fastq Input file: ERR1864423_1.fastq Paired file: ERR1864423_2.fastq trimmed: ERR1864423-trimmed-pair1.fastq, ERR1864423-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:44:51 2025 >> started Thu Feb 13 04:55:18 2025 >> done (626.912s) 15869788 read pairs processed; of these: 217218 ( 1.37%) short read pairs filtered out after trimming by size control 249705 ( 1.57%) empty read pairs filtered out after trimming by size control 15402865 (97.06%) read pairs available; of these: 3544684 (23.01%) trimmed read pairs available after processing 11858181 (76.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 110 0.00% 19 227 0.00% 20 365 0.00% 21 455 0.00% 22 623 0.00% 23 813 0.01% 24 894 0.01% 25 1114 0.01% 26 1256 0.01% 27 1543 0.01% 28 1724 0.01% 29 2035 0.01% 30 2368 0.02% 31 2618 0.02% 32 2915 0.02% 33 3238 0.02% 34 3624 0.02% 35 3693 0.02% 36 4077 0.03% 37 4549 0.03% 38 4998 0.03% 39 5041 0.03% 40 5361 0.03% 41 5692 0.04% 42 6097 0.04% 43 6499 0.04% 44 6948 0.05% 45 7237 0.05% 46 7560 0.05% 47 7915 0.05% 48 8274 0.05% 49 8913 0.06% 50 9208 0.06% 51 9540 0.06% 52 10041 0.07% 53 10662 0.07% 54 11092 0.07% 55 11518 0.07% 56 12171 0.08% 57 12976 0.08% 58 13614 0.09% 59 16699 0.11% 60 19812 0.13% 61 20000 0.13% 62 20944 0.14% 63 21523 0.14% 64 22355 0.15% 65 23521 0.15% 66 24362 0.16% 67 25562 0.17% 68 26311 0.17% 69 27952 0.18% 70 29550 0.19% 71 30358 0.20% 72 31878 0.21% 73 32856 0.21% 74 33896 0.22% 75 35459 0.23% 76 35446 0.23% 77 36958 0.24% 78 39062 0.25% 79 41344 0.27% 80 43811 0.28% 81 45326 0.29% 82 47804 0.31% 83 49821 0.32% 84 52765 0.34% 85 56955 0.37% 86 59916 0.39% 87 63949 0.42% 88 64742 0.42% 89 68732 0.45% 90 76374 0.50% 91 84654 0.55% 92 94409 0.61% 93 105941 0.69% 94 120620 0.78% 95 138026 0.90% 96 167319 1.09% 97 210360 1.37% 98 275654 1.79% 99 369956 2.40% 100 532104 3.45% 101 11858181 76.99% 15402865 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=2.7 sequence=GCTCTCCACCTCCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=209.50 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=22.4 sequence=CTTCTTCTTCTTTTTCT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=30 prefix-density=0.19 prefix-fanout=2.5 sequence=TGCAAGTGCGGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=42.06 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.5 sequence=TCATCATCAACAATGGTGGCATTGACACTGAAGATGACTATCCCTACCTTGGTCGTGATGGTAGATGTGACACGTACAGGAAAAATGCCAAAGTTGTTTCAATCGATTCTTATGAAGATGTTCCTGAAAATGATGAGACGGCATTGAAAAAGGCAGTGGCAAATCAGCCAGTGAGTGTTGCAATTGAAGGTGGTGGCAGAAATTTCCAGTTATATAATTCGGGTGTATTTACTGGAGAATGTGGGACAAGTCTGGACCATGGTGTTGCTGCCGTGGGTTACGGAACTGAAAAGGGTAAAGATTACTGGATTGTGAGGAACTCATGGGGCAAGAGCTGGGGAGAGAGCGGCTATATCAGAATGGAGAGAAACATTGCTAGTCCAACAGGAAAATGTGGAATTGCAATAGAACCCTCTTACCCTATCAAGAAAGGCCAAAATCCCCCCAATCCTGGTCCATCGCCTCCATCTCCAGTAAAACCTCCTTCCGTGTGTGATAATTACTTTTCCTG ERR1864423 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:55:17 Started mapping on | Feb 13 05:55:17 Finished on | Feb 13 05:58:36 Mapping speed, Million of reads per hour | 278.64 Number of input reads | 15402865 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14826218 Uniquely mapped reads % | 96.26% Average mapped length | 195.74 Number of splices: Total | 8924057 Number of splices: Annotated (sjdb) | 8788951 Number of splices: GT/AG | 8783358 Number of splices: GC/AG | 120771 Number of splices: AT/AC | 8139 Number of splices: Non-canonical | 11789 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480762 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 10976 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 117206 117206 117206 N_multimapping 480762 480762 480762 N_noFeature 265359 14689573 313759 N_ambiguous 147512 536 58987 UnstrandedReadsAssigned:14413347 PositiveStrandReadsAssigned:136109 NegativeStrandReadsAssigned:14453472 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864423 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864423-trimmed-pair1.fastq ERR1864423-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,402,865 reads, 14,736,470 reads pseudoaligned [quant] estimated average fragment length: 163.14 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 ERR1864423.ke.tsv 34699 ERR1864423.se.tsv 87100 total ==> ERR1864423.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1855.86 2513.62 89.2258 Potri.005G024800.1.v4.1 1035 872.86 735 55.4727 Potri.004G059700.1.v4.1 961 798.867 4 0.329854 Potri.007G009000.2.v4.1 1416 1253.86 0 0 Potri.003G141000.2.v4.1 2943 2780.86 1045.47 24.7668 Potri.016G087400.1.v4.1 270 115.852 1479.56 841.329 Potri.015G069301.1.v4.1 564 401.974 0 0 Potri.010G195200.1.v4.1 1773 1610.86 2175 88.9483 Potri.012G127500.1.v4.1 977 814.867 19 1.53604 ==> ERR1864423.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 4 ERR1864423 completed mapping pipeline successfully