Starting /dee2/code/volunteer_pipeline.sh ERR1864424 current disk space = 3052015812608 free memory = 1582106044 ERR1864424 SRAfilesize 77896006cab283051d9c359e32c14abe ERR1864424.sra ERR1864424.sra file validated ERR1864424 is paired end ERR1864424 is conventional basespace ERR1864424 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864424_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.72775 33.0 31.0 34.0 30.0 34.0 2 31.942 34.0 31.0 34.0 30.0 34.0 3 32.14525 34.0 31.0 34.0 30.0 34.0 4 35.55425 37.0 35.0 37.0 33.0 37.0 5 35.31525 37.0 35.0 37.0 33.0 37.0 6 35.2935 37.0 35.0 37.0 32.0 37.0 7 35.31775 37.0 35.0 37.0 33.0 37.0 8 35.338 37.0 35.0 37.0 33.0 37.0 9 36.9415 39.0 37.0 39.0 33.0 39.0 10-11 36.731750000000005 39.0 37.0 39.0 32.5 39.0 12-13 36.747125 39.0 37.0 39.0 33.0 39.0 14-15 37.959875 40.0 38.0 41.0 32.5 41.0 16-17 37.747875 40.0 38.0 41.0 32.0 41.0 18-19 37.864375 40.0 38.0 41.0 32.5 41.0 20-21 37.80825 40.0 38.0 41.0 32.5 41.0 22-23 37.736875 40.0 38.0 41.0 32.0 41.0 24-25 37.64425 40.0 38.0 41.0 32.0 41.0 26-27 37.600875 40.0 38.0 41.0 32.0 41.0 28-29 37.144625 40.0 37.0 41.0 31.0 41.0 30-31 37.148875000000004 40.0 37.0 41.0 31.0 41.0 32-33 36.979749999999996 40.0 37.0 41.0 30.5 41.0 34-35 36.785 40.0 37.0 41.0 30.0 41.0 36-37 36.8775 40.0 37.0 41.0 30.0 41.0 38-39 36.841375 40.0 37.0 41.0 30.0 41.0 40-41 36.667874999999995 40.0 36.5 41.0 30.0 41.0 42-43 36.4125 40.0 36.0 41.0 30.0 41.0 44-45 36.40375 40.0 36.0 41.0 30.0 41.0 46-47 36.22475 39.5 36.0 41.0 29.5 41.0 48-49 36.376374999999996 40.0 36.0 41.0 30.0 41.0 50-51 36.1755 39.5 36.0 41.0 28.0 41.0 52-53 36.195 39.5 35.5 41.0 29.0 41.0 54-55 36.06375 39.0 35.5 41.0 28.5 41.0 56-57 35.87125 39.0 35.0 41.0 28.0 41.0 58-59 35.549625 39.0 35.0 41.0 27.5 41.0 60-61 35.502125 39.0 35.0 41.0 28.0 41.0 62-63 35.130875 38.0 34.0 40.0 27.0 41.0 64-65 34.726375000000004 38.0 34.0 40.0 26.0 41.0 66-67 34.311625 37.0 34.0 40.0 26.0 41.0 68-69 33.86525 36.5 33.0 39.5 25.5 41.0 70-71 33.38375 36.0 33.0 39.0 24.5 41.0 72-73 32.85625 35.5 32.0 38.5 23.0 40.0 74-75 32.588875 35.0 32.5 37.5 23.0 39.0 76-77 31.33 34.0 30.5 36.0 21.0 39.0 78-79 31.783625 35.0 32.0 36.0 21.5 39.0 80-81 31.654125 35.0 32.0 36.0 22.0 37.5 82-83 31.50525 35.0 32.0 36.0 23.0 37.0 84-85 31.035375000000002 35.0 31.5 35.0 20.0 37.0 86-87 30.52525 34.5 31.0 35.0 17.5 36.0 88-89 30.255375 34.0 31.0 35.0 17.0 36.0 90-91 30.108625 34.0 31.0 35.0 14.0 35.5 92-93 29.6995 34.0 30.5 35.0 7.0 35.0 94-95 29.469 34.0 30.0 35.0 2.0 35.0 96-97 29.17825 34.0 30.0 35.0 2.0 35.0 98-99 28.780875 34.0 30.0 35.0 2.0 35.0 100-101 27.070125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 25.0 4 10.0 5 6.0 6 5.0 7 8.0 8 4.0 9 7.0 10 14.0 11 11.0 12 8.0 13 9.0 14 7.0 15 9.0 16 10.0 17 12.0 18 19.0 19 16.0 20 15.0 21 18.0 22 18.0 23 29.0 24 25.0 25 26.0 26 37.0 27 40.0 28 62.0 29 62.0 30 67.0 31 94.0 32 99.0 33 168.0 34 199.0 35 302.0 36 457.0 37 856.0 38 1044.0 39 167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.75157788437264 6.589245140116132 5.049229992426155 44.60994698308508 2 24.85 7.625 34.1 33.425 3 23.599999999999998 10.475 22.575 43.35 4 30.025000000000002 16.400000000000002 21.45 32.125 5 28.725 23.400000000000002 24.525 23.35 6 20.724999999999998 27.6 25.575 26.1 7 16.975 24.3 42.025 16.7 8 16.675 24.325 37.175000000000004 21.825 9 16.7 24.45 36.95 21.9 10-11 19.3375 33.675 28.237499999999997 18.75 12-13 20.7375 26.3625 31.05 21.85 14-15 19.2375 28.075 30.4 22.287499999999998 16-17 20.1125 28.3625 29.312500000000004 22.2125 18-19 20.3 27.950000000000003 28.037499999999998 23.7125 20-21 20.825 28.675 27.775 22.725 22-23 20.7125 28.575 27.3 23.4125 24-25 20.837500000000002 27.6125 28.050000000000004 23.5 26-27 20.4875 28.1375 29.1875 22.1875 28-29 21.8 27.85 27.725 22.625 30-31 20.7625 28.262500000000003 27.6125 23.3625 32-33 20.7625 28.025 28.3375 22.875 34-35 20.9125 28.549999999999997 27.437499999999996 23.1 36-37 20.9875 28.4375 27.700000000000003 22.875 38-39 20.724999999999998 27.3 27.800000000000004 24.175 40-41 20.0125 28.6875 28.249999999999996 23.05 42-43 20.474999999999998 27.525 27.8875 24.1125 44-45 20.599999999999998 27.425 27.6625 24.3125 46-47 21.0125 27.6875 28.425 22.875 48-49 20.075000000000003 27.250000000000004 28.6625 24.0125 50-51 20.424999999999997 27.375 29.175 23.025000000000002 52-53 20.599999999999998 27.987499999999997 28.012500000000003 23.400000000000002 54-55 21.0 27.900000000000002 28.275 22.825 56-57 19.8125 27.474999999999998 29.65 23.0625 58-59 21.075 28.3375 27.8375 22.75 60-61 20.5125 27.825 28.9 22.7625 62-63 21.712500000000002 27.0 27.85 23.4375 64-65 21.625 27.275 28.0625 23.0375 66-67 21.25 28.1625 26.787499999999998 23.799999999999997 68-69 20.6125 27.762500000000003 28.3875 23.2375 70-71 21.224999999999998 27.425 27.737499999999997 23.6125 72-73 20.6875 27.2625 28.7 23.35 74-75 20.9125 27.487499999999997 28.299999999999997 23.3 76-77 20.4625 28.287499999999998 28.7375 22.5125 78-79 20.5625 27.5875 28.375 23.474999999999998 80-81 20.825 27.3875 28.962500000000002 22.825 82-83 20.974999999999998 28.462500000000002 26.950000000000003 23.6125 84-85 20.5 28.6125 27.400000000000002 23.4875 86-87 20.7 28.212500000000002 28.1 22.9875 88-89 21.762500000000003 27.0875 28.0875 23.0625 90-91 20.549999999999997 28.125 27.224999999999998 24.099999999999998 92-93 21.4375 27.2625 28.212500000000002 23.0875 94-95 21.175 28.0875 27.3 23.4375 96-97 20.4875 28.7 27.500000000000004 23.3125 98-99 21.7375 27.200000000000003 28.237499999999997 22.825 100-101 21.1625 27.6625 27.500000000000004 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 4.0 27 5.0 28 5.5 29 10.5 30 20.0 31 23.5 32 29.5 33 41.0 34 50.0 35 64.5 36 80.0 37 101.0 38 119.0 39 128.0 40 156.5 41 188.5 42 226.5 43 250.5 44 262.0 45 287.0 46 291.5 47 277.5 48 249.0 49 216.0 50 169.0 51 141.0 52 126.0 53 104.5 54 87.5 55 66.5 56 51.0 57 34.5 58 32.0 59 27.5 60 16.5 61 11.0 62 8.0 63 9.0 64 6.5 65 5.5 66 4.5 67 0.5 68 1.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864424 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864424_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.603 33.0 31.0 34.0 30.0 34.0 2 31.681 34.0 31.0 34.0 30.0 34.0 3 31.68375 34.0 31.0 34.0 28.0 34.0 4 35.2055 37.0 35.0 37.0 33.0 37.0 5 35.124 37.0 35.0 37.0 32.0 37.0 6 35.26025 37.0 35.0 37.0 33.0 37.0 7 35.1715 37.0 35.0 37.0 32.0 37.0 8 35.29825 37.0 35.0 37.0 33.0 37.0 9 36.7725 39.0 37.0 39.0 32.0 39.0 10-11 36.671625000000006 39.0 37.0 39.0 32.0 39.0 12-13 36.50175 39.0 37.0 39.0 32.5 39.0 14-15 37.74625 40.0 38.0 41.0 32.0 41.0 16-17 37.79075 40.0 38.0 41.0 32.0 41.0 18-19 37.814750000000004 40.0 38.0 41.0 32.5 41.0 20-21 37.655375 40.0 38.0 41.0 32.0 41.0 22-23 37.7045 40.0 38.0 41.0 32.0 41.0 24-25 37.75 40.0 38.0 41.0 32.0 41.0 26-27 37.41525 40.0 38.0 41.0 31.5 41.0 28-29 37.246125 40.0 37.5 41.0 31.0 41.0 30-31 37.234750000000005 40.0 37.5 41.0 31.0 41.0 32-33 37.066375 40.0 37.0 41.0 30.5 41.0 34-35 36.827375 40.0 37.0 41.0 30.0 41.0 36-37 36.482625 40.0 36.5 41.0 30.0 41.0 38-39 36.157375 39.5 36.0 41.0 28.5 41.0 40-41 36.210750000000004 39.0 36.0 41.0 29.0 41.0 42-43 36.131625 39.0 36.0 41.0 29.0 41.0 44-45 35.830124999999995 39.0 35.0 40.0 27.0 41.0 46-47 35.930375 39.0 36.0 41.0 27.0 41.0 48-49 35.4215 39.0 34.5 40.5 25.5 41.0 50-51 35.03075 38.5 34.0 39.5 26.5 40.5 52-53 35.037625 38.0 34.5 40.0 26.5 40.5 54-55 35.932500000000005 39.0 35.5 40.5 28.0 41.0 56-57 36.014875 39.0 36.0 41.0 28.0 41.0 58-59 35.51 39.0 35.0 41.0 26.5 41.0 60-61 35.37025 39.0 35.0 41.0 26.5 41.0 62-63 35.22475 38.5 35.0 40.5 26.0 41.0 64-65 34.723875 37.5 34.5 40.0 25.5 41.0 66-67 34.336875 37.0 34.0 40.0 26.0 41.0 68-69 33.939750000000004 36.5 34.0 39.0 26.0 41.0 70-71 33.609125 36.0 34.0 39.0 25.0 40.5 72-73 33.01875 35.5 32.5 38.5 24.0 40.0 74-75 32.52825 35.0 32.5 37.5 22.0 39.0 76-77 31.917499999999997 35.0 32.0 37.0 20.5 39.0 78-79 31.52375 35.0 32.0 36.0 19.5 38.5 80-81 31.069875 35.0 31.0 36.0 19.0 37.0 82-83 30.871625 35.0 31.0 35.0 18.5 37.0 84-85 30.62075 35.0 31.0 35.0 18.5 36.5 86-87 30.312625 34.5 31.0 35.0 13.0 36.0 88-89 30.06375 34.0 31.0 35.0 9.0 36.0 90-91 29.737625 34.0 30.5 35.0 4.5 35.0 92-93 28.949625 34.0 29.0 35.0 2.0 35.0 94-95 28.665625 34.0 29.0 35.0 2.0 35.0 96-97 28.629625 34.0 29.0 35.0 2.0 35.0 98-99 28.34875 34.0 29.0 35.0 2.0 35.0 100-101 27.339375 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 8.0 4 6.0 5 10.0 6 7.0 7 8.0 8 23.0 9 8.0 10 17.0 11 15.0 12 5.0 13 12.0 14 9.0 15 16.0 16 9.0 17 7.0 18 25.0 19 20.0 20 26.0 21 19.0 22 19.0 23 23.0 24 29.0 25 40.0 26 31.0 27 50.0 28 46.0 29 84.0 30 70.0 31 93.0 32 109.0 33 137.0 34 208.0 35 312.0 36 467.0 37 921.0 38 952.0 39 129.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.7 21.075 10.674999999999999 35.55 2 25.374999999999996 25.974999999999998 33.525 15.125 3 19.7 28.7 30.175 21.425 4 24.3 33.275 23.325000000000003 19.1 5 25.3 37.25 19.950000000000003 17.5 6 19.25 39.825 22.5 18.425 7 21.2 22.2 36.925000000000004 19.675 8 21.275 26.125 28.849999999999998 23.75 9 20.625 26.0 31.8 21.575 10-11 22.9625 32.824999999999996 23.599999999999998 20.6125 12-13 23.875 25.95 26.8375 23.3375 14-15 22.900000000000002 27.9125 27.8125 21.375 16-17 23.1875 28.537499999999998 27.125 21.15 18-19 23.0875 28.962500000000002 26.3 21.65 20-21 23.25 28.5625 27.1125 21.075 22-23 23.1625 28.7375 27.187499999999996 20.9125 24-25 23.0875 28.3875 27.037499999999998 21.4875 26-27 23.2375 28.6125 27.125 21.025 28-29 23.1 28.775000000000002 26.737499999999997 21.3875 30-31 22.9625 28.487499999999997 27.5125 21.0375 32-33 23.0 28.3875 27.725 20.8875 34-35 23.2625 28.625 26.687499999999996 21.425 36-37 23.1 28.575 26.687499999999996 21.637500000000003 38-39 21.987499999999997 28.6875 27.9125 21.4125 40-41 21.637500000000003 28.8875 27.9375 21.5375 42-43 23.325000000000003 27.800000000000004 27.575 21.3 44-45 22.9875 29.125 26.75 21.1375 46-47 23.4625 28.1375 27.3875 21.0125 48-49 22.55 28.1875 28.050000000000004 21.212500000000002 50-51 22.3875 28.512500000000003 27.437499999999996 21.6625 52-53 22.7625 28.249999999999996 27.525 21.462500000000002 54-55 22.7125 28.1375 27.962500000000002 21.1875 56-57 21.762500000000003 28.9125 27.962500000000002 21.3625 58-59 23.275000000000002 28.249999999999996 27.237499999999997 21.2375 60-61 23.6375 27.6875 27.375 21.3 62-63 22.3125 28.999999999999996 28.15 20.5375 64-65 23.1875 27.737499999999997 27.462500000000002 21.6125 66-67 23.2875 28.225 27.8875 20.599999999999998 68-69 23.7125 28.525 26.687499999999996 21.075 70-71 24.0125 27.275 27.175 21.5375 72-73 22.662499999999998 28.5875 27.6625 21.087500000000002 74-75 22.7375 28.475 28.0625 20.724999999999998 76-77 23.775 27.3125 27.750000000000004 21.1625 78-79 24.099999999999998 27.500000000000004 27.3 21.099999999999998 80-81 24.2875 28.5625 26.8125 20.3375 82-83 24.25 28.325 26.55 20.875 84-85 23.525 27.8875 27.775 20.8125 86-87 23.6875 27.3875 27.625 21.3 88-89 23.7625 28.525 26.974999999999998 20.7375 90-91 23.05 28.775000000000002 26.2875 21.8875 92-93 23.65 28.175 27.3375 20.837500000000002 94-95 24.4125 28.262500000000003 26.6625 20.6625 96-97 24.099999999999998 28.3875 27.125 20.3875 98-99 23.6875 28.462500000000002 27.55 20.3 100-101 23.9875 29.049999999999997 26.7625 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 2.5 26 4.0 27 6.0 28 7.5 29 10.0 30 13.5 31 21.5 32 29.5 33 34.5 34 46.5 35 65.5 36 82.5 37 95.5 38 122.0 39 156.0 40 191.5 41 221.5 42 240.0 43 279.0 44 280.5 45 262.0 46 277.5 47 263.5 48 229.5 49 203.5 50 170.5 51 139.0 52 119.0 53 97.0 54 74.0 55 59.0 56 49.0 57 36.0 58 24.5 59 22.5 60 18.0 61 8.0 62 5.5 63 5.0 64 4.0 65 3.5 66 1.5 67 3.0 68 2.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871406 spots for ERR1864424.sra Written 871406 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra Read 871395 spots for ERR1864424.sra Written 871395 spots for ERR1864424.sra SRR ids: ['ERR1864424.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qejbh977 ERR1864424.sra spots: 17427911 blocks: [[1, 871395], [871396, 1742790], [1742791, 2614185], [2614186, 3485580], [3485581, 4356975], [4356976, 5228370], [5228371, 6099765], [6099766, 6971160], [6971161, 7842555], [7842556, 8713950], [8713951, 9585345], [9585346, 10456740], [10456741, 11328135], [11328136, 12199530], [12199531, 13070925], [13070926, 13942320], [13942321, 14813715], [14813716, 15685110], [15685111, 16556505], [16556506, 17427911]] ERR1864424 file size 4182102 ERR1864424 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864424 ERR1864424_1.fastq ERR1864424_2.fastq Input file: ERR1864424_1.fastq Paired file: ERR1864424_2.fastq trimmed: ERR1864424-trimmed-pair1.fastq, ERR1864424-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:51:26 2025 >> started Thu Feb 13 04:58:37 2025 >> done (430.501s) 17427911 read pairs processed; of these: 303506 ( 1.74%) short read pairs filtered out after trimming by size control 358290 ( 2.06%) empty read pairs filtered out after trimming by size control 16766115 (96.20%) read pairs available; of these: 3958407 (23.61%) trimmed read pairs available after processing 12807708 (76.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 132 0.00% 19 317 0.00% 20 481 0.00% 21 690 0.00% 22 874 0.01% 23 1077 0.01% 24 1218 0.01% 25 1459 0.01% 26 1692 0.01% 27 1953 0.01% 28 2317 0.01% 29 2631 0.02% 30 2929 0.02% 31 3403 0.02% 32 3832 0.02% 33 4196 0.03% 34 4468 0.03% 35 4909 0.03% 36 5149 0.03% 37 5660 0.03% 38 6120 0.04% 39 6460 0.04% 40 6994 0.04% 41 7355 0.04% 42 7817 0.05% 43 8028 0.05% 44 8377 0.05% 45 8948 0.05% 46 9233 0.06% 47 9652 0.06% 48 10181 0.06% 49 10580 0.06% 50 11272 0.07% 51 11638 0.07% 52 12223 0.07% 53 12620 0.08% 54 13179 0.08% 55 14010 0.08% 56 14415 0.09% 57 15374 0.09% 58 16322 0.10% 59 20862 0.12% 60 24362 0.15% 61 24967 0.15% 62 25413 0.15% 63 26393 0.16% 64 26685 0.16% 65 27778 0.17% 66 28904 0.17% 67 30191 0.18% 68 31168 0.19% 69 32536 0.19% 70 33724 0.20% 71 35134 0.21% 72 36290 0.22% 73 37977 0.23% 74 39275 0.23% 75 40274 0.24% 76 40069 0.24% 77 42228 0.25% 78 44157 0.26% 79 46579 0.28% 80 49136 0.29% 81 50778 0.30% 82 53543 0.32% 83 55851 0.33% 84 59061 0.35% 85 62815 0.37% 86 67230 0.40% 87 70634 0.42% 88 71804 0.43% 89 75101 0.45% 90 83995 0.50% 91 92464 0.55% 92 103412 0.62% 93 116563 0.70% 94 132331 0.79% 95 151074 0.90% 96 183121 1.09% 97 230628 1.38% 98 301279 1.80% 99 403652 2.41% 100 578784 3.45% 101 12807708 76.39% 16766115 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=23 prefix-density=0.27 prefix-fanout=2.7 sequence=GCTCTCCACCTCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=78.64 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.7 sequence=AAGACCACCATTGCACCCTTCATTATAACTGGTATCACAATCCACCAACTCCTGCTCAGACAAAGCGATCAAATCACCAGTGACGATCTTGTTAATCCCTTCCACAGCAGCAATCGTTGAGAACGCCCAGCAACTCCCACAGCCTCCCTGATCTTTGACCTCAGCTACGGCACCTTCCTTCCTCCAGTCAACGGAATCCGGCAAAGAGTCTCCAACACGCGGAGCATAACGATCACTTGTCTTAGGCAACCTCTTCTTATGACCAGTTCGAGTACCCAAGTACATGGACCGGAACTCCTCGTTGGTCAGATCAGCAAATCGGTTCAACCCGACTGTGTAGGTCCGGTTCTCTGAATTATGCTGATCAATAAACATAAGATTATCCTTAAAAATCTCAAATCTCTTTTCTTTCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=1.9 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=35.51 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.6 sequence=TCATCATCAACAATGGTGGCATTGACACTGAAGATGACTATCCCTACCTTGGTCGTGATGGTAGATGTGACACGTACAGGAAAAATGCCAAAGTTGTTTCAATCGATTCTTATGAAGATGTTCCTGAAAATGATGAGACGGCATTGAAAAAGGCAGTGGCAAATCAGCCAGTGAGTGTTGCAATTGAAGGTGGTGGCAGAAATTTCCAGTTATATAATTCGGGTGTATTTACTGGAGAATGTGGGACAAGTCTGGACCATGGTGTTGCTGCCGTGGGTTACGGAACTGAAAAGGGTAAAGATTACTGGATTGTGAGGAACTCATGGGGCAAGAGCTGGGGAGAGAGCGGCTATATCAGAATGGAGAGAAACATTGCTAGTCCAACAGGAAAATGTGGAATTGCAATAGAACCCTCTTACCCTATCAAGAAAGGCCAAAATCCCCCCAATCCTGGTCCATCGCCTCCATCTCCAGTAAAACCTCCTTCCGTGTGTGATAATTACTTTTCCTG ERR1864424 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:09:40 Started mapping on | Feb 13 05:09:44 Finished on | Feb 13 05:47:29 Mapping speed, Million of reads per hour | 26.65 Number of input reads | 16766115 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16061516 Uniquely mapped reads % | 95.80% Average mapped length | 195.32 Number of splices: Total | 9469241 Number of splices: Annotated (sjdb) | 9325342 Number of splices: GT/AG | 9319942 Number of splices: GC/AG | 127589 Number of splices: AT/AC | 8427 Number of splices: Non-canonical | 13283 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 527610 % of reads mapped to multiple loci | 3.15% Number of reads mapped to too many loci | 30635 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 211285 211285 211285 N_multimapping 527610 527610 527610 N_noFeature 298474 15897083 351463 N_ambiguous 173843 648 62106 UnstrandedReadsAssigned:15589199 PositiveStrandReadsAssigned:163785 NegativeStrandReadsAssigned:15647947 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864424 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864424-trimmed-pair1.fastq ERR1864424-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,766,115 reads, 15,954,551 reads pseudoaligned [quant] estimated average fragment length: 164.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 ERR1864424.ke.tsv 34699 ERR1864424.se.tsv 87100 total ==> ERR1864424.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1854.26 2730 84.1827 Potri.005G024800.1.v4.1 1035 871.258 805 52.8298 Potri.004G059700.1.v4.1 961 797.258 3 0.215156 Potri.007G009000.2.v4.1 1416 1252.26 0 0 Potri.003G141000.2.v4.1 2943 2779.26 1113.49 22.9081 Potri.016G087400.1.v4.1 270 115.076 1686 837.726 Potri.015G069301.1.v4.1 564 400.319 0 0 Potri.010G195200.1.v4.1 1773 1609.26 2450.99 87.0855 Potri.012G127500.1.v4.1 977 813.258 15 1.05461 ==> ERR1864424.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 1 ERR1864424 completed mapping pipeline successfully