Starting /dee2/code/volunteer_pipeline.sh ERR1864425 current disk space = 3051913326592 free memory = 1502335976 ERR1864425 SRAfilesize a7acebcb47ce91c05da77c527a0aeefe ERR1864425.sra ERR1864425.sra file validated ERR1864425 is paired end ERR1864425 is conventional basespace ERR1864425 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864425_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.58625 33.0 31.0 34.0 30.0 34.0 2 31.83125 34.0 31.0 34.0 29.0 34.0 3 32.10625 34.0 31.0 34.0 30.0 34.0 4 35.4745 37.0 35.0 37.0 33.0 37.0 5 35.2865 37.0 35.0 37.0 33.0 37.0 6 35.1515 37.0 35.0 37.0 32.0 37.0 7 35.223 37.0 35.0 37.0 32.0 37.0 8 35.25075 37.0 35.0 37.0 32.0 37.0 9 36.83625 39.0 37.0 39.0 33.0 39.0 10-11 36.749625 39.0 37.0 39.0 33.0 39.0 12-13 36.681375 39.0 37.0 39.0 33.0 39.0 14-15 37.974625 40.0 38.0 41.0 32.5 41.0 16-17 37.60025 40.0 38.0 41.0 32.0 41.0 18-19 37.76575 40.0 38.0 41.0 32.0 41.0 20-21 37.634875 40.0 38.0 41.0 32.0 41.0 22-23 37.634375000000006 40.0 38.0 41.0 32.0 41.0 24-25 37.5275 40.0 38.0 41.0 32.0 41.0 26-27 37.40025 40.0 38.0 41.0 32.0 41.0 28-29 37.008624999999995 40.0 37.5 41.0 31.0 41.0 30-31 37.053 40.0 37.0 41.0 31.0 41.0 32-33 36.914 40.0 37.0 41.0 30.5 41.0 34-35 36.717625 40.0 36.5 41.0 30.0 41.0 36-37 36.7025 40.0 37.0 41.0 30.0 41.0 38-39 36.8165 40.0 37.0 41.0 30.0 41.0 40-41 36.70625 40.0 36.5 41.0 30.0 41.0 42-43 36.429125 40.0 36.0 41.0 30.0 41.0 44-45 36.3335 40.0 36.0 41.0 29.5 41.0 46-47 36.045500000000004 39.0 36.0 41.0 28.5 41.0 48-49 36.29075 40.0 36.0 41.0 29.5 41.0 50-51 36.08275 40.0 36.0 41.0 28.0 41.0 52-53 36.16275 39.0 36.0 41.0 29.0 41.0 54-55 35.978875 39.0 36.0 41.0 28.0 41.0 56-57 35.7875 39.0 35.0 41.0 28.0 41.0 58-59 35.548625 39.0 35.0 41.0 28.0 41.0 60-61 35.275125 38.5 35.0 40.5 27.0 41.0 62-63 34.92625 38.0 34.0 40.0 26.0 41.0 64-65 34.4655 38.0 34.0 40.0 26.0 41.0 66-67 34.182249999999996 37.0 34.0 40.0 25.5 41.0 68-69 33.74875 36.5 33.5 39.0 25.0 41.0 70-71 33.19825 36.0 33.0 39.0 22.5 40.0 72-73 32.718 35.5 32.0 38.5 22.0 40.0 74-75 32.527375 35.0 32.0 37.0 22.5 39.0 76-77 31.247999999999998 34.5 30.5 36.0 20.0 39.0 78-79 31.6485 35.0 32.0 36.0 21.5 39.0 80-81 31.514875 35.0 32.0 36.0 21.0 37.0 82-83 31.288 35.0 32.0 36.0 20.0 37.0 84-85 30.863125 35.0 31.5 35.0 19.0 36.5 86-87 30.402375 34.5 31.0 35.0 13.5 36.0 88-89 30.115625 34.0 31.0 35.0 11.5 36.0 90-91 29.933500000000002 34.0 31.0 35.0 7.0 35.5 92-93 29.622500000000002 34.0 30.0 35.0 4.0 35.0 94-95 29.319625000000002 34.0 30.0 35.0 2.0 35.0 96-97 29.132375 34.0 30.0 35.0 2.0 35.0 98-99 28.681625 34.0 30.0 35.0 2.0 35.0 100-101 27.078375 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 20.0 4 15.0 5 8.0 6 6.0 7 7.0 8 6.0 9 10.0 10 8.0 11 11.0 12 14.0 13 7.0 14 11.0 15 5.0 16 12.0 17 23.0 18 20.0 19 13.0 20 12.0 21 20.0 22 27.0 23 27.0 24 23.0 25 26.0 26 40.0 27 48.0 28 46.0 29 47.0 30 60.0 31 89.0 32 126.0 33 135.0 34 200.0 35 323.0 36 504.0 37 833.0 38 1044.0 39 137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.18907987866532 5.788675429726997 6.016177957532862 46.00606673407482 2 24.925 6.825 34.825 33.425 3 24.0 9.925 22.225 43.85 4 28.425 16.475 20.95 34.150000000000006 5 27.400000000000002 23.05 25.55 24.0 6 21.775 27.474999999999998 26.6 24.15 7 16.225 22.625 43.1 18.05 8 17.175 23.45 36.325 23.05 9 16.75 22.45 38.625 22.175 10-11 19.4875 32.05 29.212500000000002 19.25 12-13 19.525000000000002 26.387500000000003 31.5625 22.525000000000002 14-15 18.862499999999997 27.762500000000003 29.7 23.674999999999997 16-17 20.775 28.037499999999998 29.1125 22.075 18-19 20.3125 27.625 29.1125 22.95 20-21 21.4 27.400000000000002 28.675 22.525000000000002 22-23 20.575 28.125 28.025 23.275000000000002 24-25 20.575 27.8375 28.4125 23.175 26-27 20.4625 27.3 28.8625 23.375 28-29 20.1875 27.8875 27.1125 24.8125 30-31 21.075 27.1 28.3875 23.4375 32-33 20.4625 27.712500000000002 28.6375 23.1875 34-35 21.2875 26.8625 28.1125 23.7375 36-37 20.2875 27.025 29.037499999999998 23.65 38-39 21.5375 26.737499999999997 28.1125 23.6125 40-41 20.3625 28.812500000000004 28.037499999999998 22.787499999999998 42-43 20.9875 26.937499999999996 27.9125 24.1625 44-45 20.674999999999997 26.900000000000002 28.9 23.525 46-47 21.125 27.900000000000002 28.212500000000002 22.7625 48-49 20.349999999999998 27.9375 27.775 23.9375 50-51 21.25 28.1 28.000000000000004 22.650000000000002 52-53 21.55 28.1 27.825 22.525000000000002 54-55 20.2375 27.9375 27.775 24.05 56-57 20.2875 27.775 28.125 23.8125 58-59 21.2375 26.9125 28.1 23.75 60-61 20.3125 27.237499999999997 28.962500000000002 23.4875 62-63 22.05 27.175 27.8375 22.9375 64-65 21.0 27.762500000000003 28.025 23.2125 66-67 20.515064383047882 28.26603325415677 27.953494186773348 23.265408176022003 68-69 22.1875 28.299999999999997 27.4125 22.1 70-71 21.349999999999998 28.375 27.462500000000002 22.8125 72-73 20.1625 27.8875 28.1875 23.7625 74-75 21.2 27.6625 27.725 23.4125 76-77 20.674999999999997 27.900000000000002 27.987499999999997 23.4375 78-79 20.627578447305915 27.82847855981998 27.803475434429302 23.740467558444806 80-81 20.5375 27.500000000000004 27.9125 24.05 82-83 20.91511438929866 27.315914489311165 28.89111138892362 22.877859732466558 84-85 21.375 27.1 27.462500000000002 24.0625 86-87 20.875 27.437499999999996 28.299999999999997 23.3875 88-89 20.974999999999998 29.262500000000003 27.437499999999996 22.325 90-91 21.890236279534943 27.490936367045883 27.928491061382672 22.690336292036505 92-93 21.202650331291412 28.003500437554695 28.141017627203404 22.652831603950492 94-95 21.675 27.224999999999998 27.3 23.799999999999997 96-97 21.465183147893487 27.240905113139142 27.165895736967123 24.128016002000248 98-99 21.099999999999998 28.1 27.55 23.25 100-101 20.8875 27.8125 28.487499999999997 22.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 2.0 25 2.5 26 3.5 27 4.0 28 6.0 29 9.5 30 11.5 31 13.0 32 21.0 33 30.5 34 40.0 35 55.5 36 65.5 37 75.5 38 104.5 39 151.5 40 188.0 41 215.0 42 243.5 43 267.5 44 271.0 45 267.0 46 264.0 47 251.5 48 247.0 49 229.5 50 195.0 51 153.0 52 134.0 53 114.0 54 80.5 55 68.5 56 50.5 57 37.0 58 36.5 59 26.0 60 14.5 61 9.5 62 7.5 63 8.5 64 6.0 65 4.0 66 2.5 67 1.0 68 1.0 69 1.0 70 0.5 71 1.5 72 1.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0125 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91249367728882 97.775 2 1.0116337885685383 2.0 3 0.07587253414264036 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864425 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864425_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.603 33.0 31.0 34.0 30.0 34.0 2 31.7105 34.0 31.0 34.0 30.0 34.0 3 31.74625 34.0 31.0 34.0 30.0 34.0 4 35.3305 37.0 35.0 37.0 33.0 37.0 5 35.19175 37.0 35.0 37.0 33.0 37.0 6 35.25225 37.0 35.0 37.0 33.0 37.0 7 35.21425 37.0 35.0 37.0 33.0 37.0 8 35.24425 37.0 35.0 37.0 33.0 37.0 9 36.7735 39.0 37.0 39.0 33.0 39.0 10-11 36.6525 39.0 37.0 39.0 32.5 39.0 12-13 36.484 39.0 37.0 39.0 32.0 39.0 14-15 37.69725 40.0 38.0 41.0 32.0 41.0 16-17 37.811375 40.0 38.0 41.0 32.0 41.0 18-19 37.785 40.0 38.0 41.0 32.0 41.0 20-21 37.688500000000005 40.0 38.0 41.0 32.0 41.0 22-23 37.73975 40.0 38.0 41.0 32.5 41.0 24-25 37.626999999999995 40.0 38.0 41.0 32.0 41.0 26-27 37.40975 40.0 38.0 41.0 31.0 41.0 28-29 37.213499999999996 40.0 37.5 41.0 31.0 41.0 30-31 37.164375 40.0 37.5 41.0 30.5 41.0 32-33 37.09825 40.0 37.0 41.0 30.0 41.0 34-35 36.8425 40.0 37.0 41.0 30.0 41.0 36-37 36.446124999999995 40.0 36.0 41.0 29.5 41.0 38-39 36.183125000000004 39.0 35.5 41.0 29.0 41.0 40-41 36.17775 39.0 36.0 41.0 29.0 41.0 42-43 36.08425 39.0 36.0 41.0 28.5 41.0 44-45 35.826375 39.0 35.0 40.0 27.0 41.0 46-47 35.978875 39.0 36.0 40.5 28.5 41.0 48-49 35.551875 39.0 34.5 40.0 27.0 41.0 50-51 34.971625 38.0 34.0 39.5 26.5 40.5 52-53 34.858875 38.0 34.0 40.0 26.0 40.5 54-55 35.9105 39.0 35.5 40.5 28.0 41.0 56-57 35.915375 39.0 36.0 41.0 28.0 41.0 58-59 35.381375 39.0 35.0 41.0 26.0 41.0 60-61 35.27675 39.0 35.0 41.0 26.5 41.0 62-63 35.01975 38.5 35.0 40.5 26.0 41.0 64-65 34.62325 37.5 34.5 40.0 25.5 41.0 66-67 34.180875 37.0 34.0 40.0 25.5 41.0 68-69 33.831 36.5 34.0 39.0 25.0 41.0 70-71 33.47575 36.0 33.5 39.0 25.0 41.0 72-73 32.916375 35.5 32.5 38.5 23.0 40.0 74-75 32.312875 35.0 32.0 37.0 22.0 39.0 76-77 31.8035 35.0 31.5 37.0 20.0 39.0 78-79 31.368375 35.0 31.0 36.0 20.0 38.0 80-81 31.0505 35.0 31.0 36.0 19.0 37.0 82-83 30.874000000000002 35.0 31.0 35.5 18.5 37.0 84-85 30.66325 34.5 31.0 35.0 18.5 36.0 86-87 30.321875 34.0 31.0 35.0 16.5 36.0 88-89 30.07275 34.0 31.0 35.0 12.5 36.0 90-91 29.755375 34.0 30.5 35.0 4.5 35.5 92-93 28.933625 34.0 29.0 35.0 2.0 35.0 94-95 28.592 34.0 29.0 35.0 2.0 35.0 96-97 28.456625 34.0 29.0 35.0 2.0 35.0 98-99 28.130625000000002 34.0 29.0 35.0 2.0 35.0 100-101 27.132125000000002 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 9.0 4 13.0 5 6.0 6 4.0 7 8.0 8 11.0 9 10.0 10 13.0 11 14.0 12 16.0 13 11.0 14 14.0 15 14.0 16 11.0 17 22.0 18 18.0 19 15.0 20 19.0 21 31.0 22 27.0 23 15.0 24 33.0 25 35.0 26 41.0 27 50.0 28 60.0 29 56.0 30 79.0 31 92.0 32 119.0 33 128.0 34 223.0 35 338.0 36 486.0 37 898.0 38 926.0 39 111.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.9 19.375 12.5 38.224999999999994 2 25.2 24.05 35.925000000000004 14.825 3 20.125 28.95 30.3 20.625 4 23.375 32.824999999999996 23.075000000000003 20.724999999999998 5 23.3 36.125 23.425 17.150000000000002 6 20.25 37.275000000000006 24.175 18.3 7 20.150000000000002 21.85 36.8 21.2 8 21.325 24.525 29.45 24.7 9 21.475 24.25 30.9 23.375 10-11 22.3625 32.6625 24.4375 20.5375 12-13 23.5125 25.1875 27.9375 23.3625 14-15 22.075 28.537499999999998 28.5875 20.8 16-17 23.71546443305413 28.30353794224278 26.990873859232405 20.990123765470685 18-19 22.675 28.325 27.800000000000004 21.2 20-21 22.400000000000002 28.675 27.712500000000002 21.212500000000002 22-23 23.075000000000003 28.299999999999997 27.6375 20.9875 24-25 22.9625 28.425 27.325 21.2875 26-27 22.725 28.825 27.212500000000002 21.2375 28-29 23.1375 27.462500000000002 27.462500000000002 21.9375 30-31 23.4625 28.575 26.75 21.212500000000002 32-33 22.412499999999998 29.075 27.0875 21.425 34-35 22.912499999999998 27.975 27.85 21.2625 36-37 23.0375 29.075 27.725 20.1625 38-39 22.525000000000002 28.525 27.625 21.325 40-41 23.76547068383548 27.47843480435054 28.253531691461433 20.502562820352544 42-43 22.925 28.4375 27.825 20.8125 44-45 22.290286285785722 28.978622327790976 27.128391048881113 21.602700337542196 46-47 22.7625 28.9 27.175 21.1625 48-49 22.975 28.4375 27.6 20.9875 50-51 22.975 27.975 27.8625 21.1875 52-53 23.125 28.349999999999998 26.525 22.0 54-55 21.637500000000003 29.15 28.375 20.837500000000002 56-57 23.118279569892472 27.7569392348087 27.79444861215304 21.330332583145786 58-59 22.91536442055257 28.141017627203404 27.453431678959873 21.49018627328416 60-61 23.6625 27.925 26.987499999999997 21.425 62-63 23.69046130766346 28.178522315289413 27.19089886235779 20.940117514689334 64-65 22.968242060515127 27.969492373093274 27.631907976994246 21.43035758939735 66-67 22.927865983247905 28.54106763345418 27.403425428178522 21.12764095511939 68-69 23.75 27.8875 27.950000000000003 20.4125 70-71 23.4625 28.537499999999998 26.900000000000002 21.099999999999998 72-73 23.575 27.737499999999997 27.425 21.2625 74-75 23.56544568071009 27.953494186773348 27.440930116264532 21.040130016252032 76-77 23.6029503687961 28.291036379547442 26.940867608451057 21.165145643205403 78-79 22.575 28.487499999999997 28.125 20.8125 80-81 23.15289411176397 27.728466058257283 28.053506688336043 21.065133141642704 82-83 23.375 27.4125 27.0125 22.2 84-85 22.527815976997125 27.97849731216402 28.653581697712216 20.840105013126642 86-87 23.527940992624078 28.60357544693087 27.490936367045883 20.377547193399177 88-89 23.9875 27.425 27.3875 21.2 90-91 23.05 28.9875 27.0 20.962500000000002 92-93 23.65 29.012500000000003 26.337500000000002 21.0 94-95 23.825 28.8375 26.775 20.5625 96-97 23.85298162270284 28.178522315289413 27.628453556694588 20.340042505313164 98-99 22.90286285785723 29.65370671333917 27.11588948618577 20.327540942617826 100-101 23.9375 28.625 27.075 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.5 24 2.5 25 3.0 26 1.5 27 3.0 28 6.0 29 9.5 30 12.5 31 19.0 32 25.0 33 38.5 34 55.5 35 60.0 36 66.5 37 96.5 38 136.5 39 170.5 40 210.0 41 247.0 42 258.5 43 265.0 44 262.5 45 271.5 46 279.5 47 253.0 48 240.0 49 208.0 50 158.0 51 132.5 52 117.5 53 94.0 54 70.0 55 51.0 56 39.5 57 35.0 58 24.5 59 18.0 60 17.0 61 10.5 62 4.0 63 3.5 64 4.5 65 4.0 66 2.0 67 0.5 68 1.5 69 2.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0125 60-61 0.0 62-63 0.0125 64-65 0.025 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820614 spots for ERR1864425.sra Written 820614 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra Read 820603 spots for ERR1864425.sra Written 820603 spots for ERR1864425.sra SRR ids: ['ERR1864425.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jujm1m71 ERR1864425.sra spots: 16412071 blocks: [[1, 820603], [820604, 1641206], [1641207, 2461809], [2461810, 3282412], [3282413, 4103015], [4103016, 4923618], [4923619, 5744221], [5744222, 6564824], [6564825, 7385427], [7385428, 8206030], [8206031, 9026633], [9026634, 9847236], [9847237, 10667839], [10667840, 11488442], [11488443, 12309045], [12309046, 13129648], [13129649, 13950251], [13950252, 14770854], [14770855, 15591457], [15591458, 16412071]] ERR1864425 file size 3937070 ERR1864425 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864425 ERR1864425_1.fastq ERR1864425_2.fastq Input file: ERR1864425_1.fastq Paired file: ERR1864425_2.fastq trimmed: ERR1864425-trimmed-pair1.fastq, ERR1864425-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 05:21:08 2025 >> started Thu Feb 13 05:26:49 2025 >> done (341.647s) 16412071 read pairs processed; of these: 272812 ( 1.66%) short read pairs filtered out after trimming by size control 325518 ( 1.98%) empty read pairs filtered out after trimming by size control 15813741 (96.35%) read pairs available; of these: 3752540 (23.73%) trimmed read pairs available after processing 12061201 (76.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 114 0.00% 19 293 0.00% 20 441 0.00% 21 648 0.00% 22 737 0.00% 23 1014 0.01% 24 1180 0.01% 25 1433 0.01% 26 1728 0.01% 27 1944 0.01% 28 2253 0.01% 29 2526 0.02% 30 2806 0.02% 31 3200 0.02% 32 3672 0.02% 33 3898 0.02% 34 4449 0.03% 35 4714 0.03% 36 5118 0.03% 37 5415 0.03% 38 5899 0.04% 39 6134 0.04% 40 6588 0.04% 41 6998 0.04% 42 7225 0.05% 43 7634 0.05% 44 8053 0.05% 45 8634 0.05% 46 9019 0.06% 47 9355 0.06% 48 9874 0.06% 49 10289 0.07% 50 10582 0.07% 51 10949 0.07% 52 11640 0.07% 53 12019 0.08% 54 12641 0.08% 55 13037 0.08% 56 14071 0.09% 57 14473 0.09% 58 15507 0.10% 59 18693 0.12% 60 22133 0.14% 61 22473 0.14% 62 23137 0.15% 63 23661 0.15% 64 24524 0.16% 65 25783 0.16% 66 26703 0.17% 67 28299 0.18% 68 28678 0.18% 69 30314 0.19% 70 31366 0.20% 71 32872 0.21% 72 34265 0.22% 73 35538 0.22% 74 36508 0.23% 75 37458 0.24% 76 37730 0.24% 77 39500 0.25% 78 41633 0.26% 79 44178 0.28% 80 46043 0.29% 81 48313 0.31% 82 50485 0.32% 83 53249 0.34% 84 55947 0.35% 85 59808 0.38% 86 63557 0.40% 87 66938 0.42% 88 68775 0.43% 89 72011 0.46% 90 80524 0.51% 91 88685 0.56% 92 99536 0.63% 93 111946 0.71% 94 126600 0.80% 95 145485 0.92% 96 174434 1.10% 97 219473 1.39% 98 286826 1.81% 99 383130 2.42% 100 547125 3.46% 101 12061201 76.27% 15813741 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.1 sequence=TGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=208.64 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=22.0 sequence=CTTCTTCTTCTTTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=2.0 sequence=GAGAACGATGGCAAGTGCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=39.78 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.7 sequence=TCATCATCAACAATGGTGGCATTGACACTGAAGATGACTATCCCTACCTTGGTCGTGATGGTAGATGTGACACGTACAGGAAAAATGCCAAAGTTGTTTCAATCGATTCTTATGAAGATGTTCCTGAAAATGATGAGACGGCATTGAAAAAGGCAGTGGCAAATCAGCCAGTGAGTGTTGCAATTGAAGGTGGTGGCAGAAATTTCCAGTTATATAATTCGGGTGTATTTACTGGAGAATGTGGGACAAGTCTGGACCATGGTGTTGCTGCCGTGGGTTACGGAACTGAAAAGGGTAAAGATTACTGGATTGTGAGGAACTCATGGGGCAAGAGCTGGGGAGAGAGCGGCTATATCAGAATGGAGAGAAACATTGCTAGTCCAACAGGAAAATGTGGAATTGCAATAGAACCCTCTTACCCTATCAAGAAAGGCCAAAATCCCCCCAATCCTGGTCCATCGCCTCCATCTCCAGTAAAACCTCCTTCCGTGTGTGATAATTACTTTTCCTG ERR1864425 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:55:15 Started mapping on | Feb 13 05:55:15 Finished on | Feb 13 05:55:54 Mapping speed, Million of reads per hour | 1459.73 Number of input reads | 15813741 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15222327 Uniquely mapped reads % | 96.26% Average mapped length | 195.35 Number of splices: Total | 8945447 Number of splices: Annotated (sjdb) | 8805569 Number of splices: GT/AG | 8806054 Number of splices: GC/AG | 120141 Number of splices: AT/AC | 7826 Number of splices: Non-canonical | 11426 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 482764 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 17685 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 133281 133281 133281 N_multimapping 482764 482764 482764 N_noFeature 289156 15080961 341589 N_ambiguous 146264 628 57030 UnstrandedReadsAssigned:14786907 PositiveStrandReadsAssigned:140738 NegativeStrandReadsAssigned:14823708 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864425 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864425-trimmed-pair1.fastq ERR1864425-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,813,741 reads, 15,105,000 reads pseudoaligned [quant] estimated average fragment length: 163.236 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,009 rounds 52401 ERR1864425.ke.tsv 34699 ERR1864425.se.tsv 87100 total ==> ERR1864425.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1855.76 2395 80.509 Potri.005G024800.1.v4.1 1035 872.764 1055 75.408 Potri.004G059700.1.v4.1 961 798.77 3 0.234294 Potri.007G009000.2.v4.1 1416 1253.76 0 0 Potri.003G141000.2.v4.1 2943 2780.76 927.916 20.8164 Potri.016G087400.1.v4.1 270 115.737 1519 818.745 Potri.015G069301.1.v4.1 564 401.849 0 0 Potri.010G195200.1.v4.1 1773 1610.76 2558.97 99.1049 Potri.012G127500.1.v4.1 977 814.77 21 1.60785 ==> ERR1864425.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 ERR1864425 completed mapping pipeline successfully