Starting /dee2/code/volunteer_pipeline.sh ERR1864426 current disk space = 3051988332544 free memory = 1559067488 ERR1864426 SRAfilesize 57356007fdea89965a9c20ee5eca20d1 ERR1864426.sra ERR1864426.sra file validated ERR1864426 is paired end ERR1864426 is conventional basespace ERR1864426 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864426_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.14175 33.0 31.0 34.0 30.0 34.0 2 31.79475 34.0 31.0 34.0 30.0 34.0 3 32.27175 34.0 31.0 34.0 30.0 34.0 4 35.6515 37.0 35.0 37.0 35.0 37.0 5 35.48925 37.0 35.0 37.0 33.0 37.0 6 35.50725 37.0 35.0 37.0 33.0 37.0 7 35.415 37.0 35.0 37.0 33.0 37.0 8 35.4495 37.0 35.0 37.0 33.0 37.0 9 37.1775 39.0 38.0 39.0 34.0 39.0 10-11 37.190625 39.0 37.0 39.0 34.0 39.0 12-13 37.080125 39.0 37.0 39.0 34.0 39.0 14-15 38.478875 41.0 38.0 41.0 34.0 41.0 16-17 38.347625 40.0 38.0 41.0 34.0 41.0 18-19 38.285 40.0 38.0 41.0 34.0 41.0 20-21 38.1915 40.0 38.0 41.0 34.0 41.0 22-23 38.08025000000001 40.0 38.0 41.0 33.0 41.0 24-25 37.910375 40.0 38.0 41.0 33.0 41.0 26-27 37.963499999999996 40.0 38.0 41.0 33.0 41.0 28-29 37.785624999999996 40.0 38.0 41.0 32.5 41.0 30-31 37.646625 40.0 38.0 41.0 32.5 41.0 32-33 37.631375000000006 40.0 38.0 41.0 32.5 41.0 34-35 37.4515 40.0 38.0 41.0 31.5 41.0 36-37 37.313125 40.0 38.0 41.0 31.5 41.0 38-39 37.141875 40.0 37.0 41.0 30.5 41.0 40-41 37.03 40.0 37.0 41.0 31.0 41.0 42-43 36.827375 40.0 37.0 41.0 30.0 41.0 44-45 36.789249999999996 40.0 36.5 41.0 30.5 41.0 46-47 36.941375 40.0 37.0 41.0 30.5 41.0 48-49 36.881375 40.0 37.0 41.0 30.0 41.0 50-51 36.843125 40.0 37.0 41.0 30.5 41.0 52-53 36.51325 40.0 36.0 41.0 30.0 41.0 54-55 36.210375 39.5 36.0 41.0 29.5 41.0 56-57 36.045375 39.0 35.0 41.0 29.0 41.0 58-59 35.774874999999994 39.0 35.0 41.0 28.0 41.0 60-61 35.417249999999996 39.0 35.0 40.5 28.0 41.0 62-63 35.13849999999999 38.0 34.5 40.0 27.0 41.0 64-65 34.64725 37.5 34.0 40.0 26.0 41.0 66-67 34.287 37.0 34.0 40.0 26.0 41.0 68-69 34.061125000000004 37.0 34.0 39.0 26.0 41.0 70-71 33.597 36.0 34.0 39.0 26.0 40.5 72-73 32.99575 35.5 33.0 38.5 24.0 40.0 74-75 32.480125 35.0 32.0 37.0 23.0 39.0 76-77 31.545375 34.0 31.0 36.0 22.5 39.0 78-79 31.770875 35.0 32.0 36.0 23.0 38.5 80-81 31.49925 35.0 32.0 36.0 22.0 37.0 82-83 31.21925 35.0 31.5 35.5 20.5 37.0 84-85 30.944375 35.0 32.0 35.0 19.5 36.5 86-87 30.332124999999998 34.0 31.0 35.0 17.0 36.0 88-89 30.041 34.0 31.0 35.0 12.5 36.0 90-91 29.791874999999997 34.0 30.0 35.0 7.0 35.0 92-93 29.551499999999997 34.0 30.0 35.0 4.5 35.0 94-95 29.315624999999997 34.0 30.0 35.0 2.0 35.0 96-97 28.970374999999997 34.0 30.0 35.0 2.0 35.0 98-99 28.602874999999997 34.0 29.5 35.0 2.0 35.0 100-101 27.552875 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 10.0 4 9.0 5 7.0 6 6.0 7 12.0 8 5.0 9 9.0 10 7.0 11 12.0 12 8.0 13 8.0 14 12.0 15 10.0 16 13.0 17 7.0 18 16.0 19 15.0 20 14.0 21 21.0 22 19.0 23 24.0 24 23.0 25 30.0 26 38.0 27 31.0 28 42.0 29 66.0 30 75.0 31 75.0 32 97.0 33 147.0 34 233.0 35 283.0 36 486.0 37 886.0 38 1074.0 39 137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.552929085303184 5.65262076053443 7.939362795477903 41.85508735868448 2 28.599999999999998 7.3999999999999995 30.349999999999998 33.650000000000006 3 26.625 10.15 22.25 40.975 4 31.7 15.525 21.15 31.624999999999996 5 29.457364341085274 20.880220055013755 25.331332833208304 24.33108277069267 6 23.849999999999998 26.325 25.424999999999997 24.4 7 17.424999999999997 21.45 43.275000000000006 17.849999999999998 8 19.275000000000002 23.95 34.55 22.225 9 19.35 21.5 38.224999999999994 20.925 10-11 21.5375 32.1 28.212500000000002 18.15 12-13 22.3 25.6 30.7 21.4 14-15 21.9 27.35 30.162499999999998 20.5875 16-17 22.925 27.1 28.425 21.55 18-19 21.4875 27.85 29.525000000000002 21.1375 20-21 22.0875 27.8125 28.212500000000002 21.8875 22-23 22.5875 27.425 27.650000000000002 22.3375 24-25 22.0 27.800000000000004 27.525 22.675 26-27 21.349999999999998 28.025 28.199999999999996 22.425 28-29 22.225 27.737499999999997 27.3625 22.675 30-31 21.725 28.000000000000004 27.575 22.7 32-33 22.287499999999998 27.8375 27.625 22.25 34-35 21.6125 26.8375 28.6875 22.8625 36-37 23.1375 26.737499999999997 27.950000000000003 22.175 38-39 22.4875 26.700000000000003 28.4 22.412499999999998 40-41 21.95 27.3875 27.8875 22.775000000000002 42-43 21.95 28.4375 28.15 21.462500000000002 44-45 21.85 27.575 28.249999999999996 22.325 46-47 21.2 27.85 27.925 23.025000000000002 48-49 22.075 26.6125 28.0625 23.25 50-51 22.1 27.525 28.025 22.35 52-53 21.88244140869783 27.835568366963276 28.073693445293895 22.208296779044993 54-55 21.525 26.924999999999997 27.925 23.625 56-57 22.15 27.825 27.6 22.425 58-59 21.912499999999998 28.299999999999997 27.575 22.2125 60-61 22.75 27.125 27.8125 22.3125 62-63 22.725 27.437499999999996 27.6 22.237499999999997 64-65 21.712500000000002 26.8125 28.725 22.75 66-67 21.15 27.725 28.1375 22.9875 68-69 21.8625 27.925 28.287499999999998 21.925 70-71 22.162499999999998 27.6375 27.3 22.900000000000002 72-73 22.175 27.762500000000003 27.825 22.237499999999997 74-75 21.875 27.200000000000003 28.549999999999997 22.375 76-77 22.9875 27.075 27.650000000000002 22.287499999999998 78-79 22.63631815907954 27.351175587793897 27.55127563781891 22.461230615307652 80-81 22.2125 27.737499999999997 27.787499999999998 22.2625 82-83 22.86535816977122 27.965995749468686 27.340917614701837 21.827728466058257 84-85 22.8 27.700000000000003 26.575 22.925 86-87 23.7125 27.474999999999998 25.85 22.9625 88-89 23.1125 28.299999999999997 25.35 23.2375 90-91 23.075000000000003 27.625 26.325 22.975 92-93 23.4625 27.85 26.387500000000003 22.3 94-95 23.875 28.799999999999997 25.4625 21.8625 96-97 23.474999999999998 29.1125 25.0125 22.400000000000002 98-99 23.6875 27.725 25.8625 22.725 100-101 23.474999999999998 28.249999999999996 25.1875 23.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 3.5 26 4.5 27 4.5 28 6.5 29 11.0 30 13.0 31 14.0 32 22.0 33 24.5 34 23.0 35 38.5 36 59.0 37 76.0 38 100.0 39 137.5 40 152.5 41 180.0 42 222.0 43 239.5 44 252.5 45 274.0 46 286.0 47 261.0 48 253.0 49 238.0 50 209.0 51 184.0 52 148.5 53 120.0 54 98.0 55 75.5 56 62.0 57 52.5 58 36.0 59 26.0 60 22.0 61 17.5 62 11.0 63 7.5 64 6.0 65 5.0 66 5.5 67 3.5 68 2.0 69 1.0 70 2.0 71 3.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.2625 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.05 80-81 0.0 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.78407626900284 94.875 2 1.8551919608348364 3.5999999999999996 3 0.2834321051275444 0.8250000000000001 4 0.02576655501159495 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02576655501159495 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02576655501159495 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 7 (97% over 36bp) CTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.2875 0.0 0.0 0.0 0.0 58-59 0.425 0.0 0.0 0.0 0.0 60-61 0.4875 0.0 0.0 0.0 0.0 62-63 0.5625 0.0 0.0 0.0 0.0 64-65 0.6499999999999999 0.0 0.0 0.0 0.0 66-67 0.8500000000000001 0.0 0.0 0.0 0.0 68-69 1.0625 0.0 0.0 0.0 0.0 70-71 1.375 0.0 0.0 0.0 0.0 72-73 1.9 0.0 0.0 0.0 0.0 74-75 2.5375 0.0 0.0 0.0 0.0 76-77 3.3 0.0 0.0 0.0 0.0 78-79 3.85 0.0 0.0 0.0 0.0 80-81 4.575 0.0 0.0 0.0 0.0 82-83 5.525 0.0 0.0 0.0 0.0 84-85 6.45 0.0 0.0 0.0 0.0 86-87 7.825 0.0 0.0 0.0 0.0 88-89 9.212499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864426 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864426_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20825 34.0 31.0 34.0 31.0 34.0 2 32.2855 34.0 31.0 34.0 31.0 34.0 3 32.26925 34.0 31.0 34.0 30.0 34.0 4 35.609 37.0 35.0 37.0 35.0 37.0 5 35.65375 37.0 35.0 37.0 35.0 37.0 6 35.70925 37.0 37.0 37.0 35.0 37.0 7 35.66075 37.0 37.0 37.0 35.0 37.0 8 35.64825 37.0 37.0 37.0 35.0 37.0 9 37.262 39.0 38.0 39.0 35.0 39.0 10-11 37.318375 39.0 38.0 39.0 35.0 39.0 12-13 37.21525 39.0 38.0 39.0 34.5 39.0 14-15 38.57425 41.0 39.0 41.0 34.0 41.0 16-17 38.50075 41.0 38.5 41.0 34.0 41.0 18-19 38.55175 41.0 38.5 41.0 34.5 41.0 20-21 38.3785 41.0 39.0 41.0 34.0 41.0 22-23 38.238375 40.0 38.0 41.0 34.0 41.0 24-25 38.276125 40.0 38.0 41.0 34.0 41.0 26-27 38.108125 40.0 38.0 41.0 33.5 41.0 28-29 37.92100000000001 40.0 38.0 41.0 33.0 41.0 30-31 37.816125 40.0 38.0 41.0 33.0 41.0 32-33 37.757625 40.0 38.0 41.0 33.0 41.0 34-35 37.710750000000004 40.0 38.0 41.0 33.0 41.0 36-37 37.476 40.0 38.0 41.0 31.5 41.0 38-39 37.428749999999994 40.0 38.0 41.0 31.5 41.0 40-41 37.2645 40.0 38.0 41.0 31.0 41.0 42-43 37.204625 40.0 37.0 41.0 31.0 41.0 44-45 37.0235 40.0 37.0 41.0 30.0 41.0 46-47 36.78725 40.0 37.0 41.0 30.0 41.0 48-49 36.602875 40.0 36.0 41.0 30.0 41.0 50-51 36.2735 39.5 36.5 40.5 29.5 41.0 52-53 36.426625 39.5 36.5 40.5 30.0 41.0 54-55 36.850375 40.0 37.0 41.0 31.0 41.0 56-57 36.656000000000006 40.0 36.0 41.0 30.0 41.0 58-59 36.4615 39.5 36.0 41.0 30.0 41.0 60-61 36.144000000000005 39.0 36.0 41.0 29.0 41.0 62-63 35.841499999999996 39.0 35.0 41.0 29.0 41.0 64-65 35.494 38.5 35.0 40.5 28.0 41.0 66-67 34.9725 37.5 34.5 40.0 27.5 41.0 68-69 34.59175 37.0 34.0 39.0 27.5 41.0 70-71 34.07625 36.0 34.0 39.0 26.5 41.0 72-73 33.587999999999994 36.0 34.0 39.0 26.0 40.0 74-75 33.06325 35.0 33.5 37.5 25.0 39.0 76-77 32.326625 35.0 32.5 37.0 23.5 39.0 78-79 31.96575 35.0 32.0 36.0 23.0 38.5 80-81 31.66325 35.0 32.0 36.0 22.5 37.0 82-83 31.299 35.0 32.0 35.5 21.5 37.0 84-85 30.964374999999997 35.0 32.0 35.0 20.0 36.0 86-87 30.471125 34.5 31.0 35.0 17.0 36.0 88-89 30.041 34.0 31.0 35.0 12.5 35.5 90-91 29.94825 34.0 31.0 35.0 9.0 35.0 92-93 29.571624999999997 34.0 30.0 35.0 2.0 35.0 94-95 29.249000000000002 34.0 30.5 35.0 2.0 35.0 96-97 28.333750000000002 34.0 28.5 35.0 2.0 35.0 98-99 27.76725 34.0 28.0 35.0 2.0 35.0 100-101 26.4435 32.5 25.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 6.0 4 8.0 5 6.0 6 4.0 7 9.0 8 6.0 9 7.0 10 10.0 11 8.0 12 10.0 13 6.0 14 8.0 15 8.0 16 18.0 17 13.0 18 14.0 19 15.0 20 15.0 21 19.0 22 18.0 23 27.0 24 31.0 25 30.0 26 28.0 27 37.0 28 51.0 29 57.0 30 72.0 31 79.0 32 105.0 33 132.0 34 194.0 35 263.0 36 476.0 37 936.0 38 1099.0 39 149.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.43285821455364 18.554638659664917 15.003750937734434 35.00875218804701 2 25.737868934467233 25.63781890945473 32.2911455727864 16.333166583291643 3 21.10527631907977 28.857214303575894 27.656914228557138 22.380595148787197 4 21.510755377688845 35.392696348174084 21.96098049024512 21.135567783891947 5 24.63115778944736 35.50887721930482 21.905476369092273 17.95448862215554 6 19.475 38.800000000000004 23.625 18.099999999999998 7 21.125 21.349999999999998 36.85 20.674999999999997 8 20.825 26.35 27.6 25.224999999999998 9 22.85 23.35 29.2 24.6 10-11 23.375 32.1875 22.9375 21.5 12-13 24.22119354435131 26.23545602402102 25.835105717502817 23.70824471412486 14-15 22.414224893563738 28.888054094665666 27.585775106436262 21.111945905334334 16-17 22.761380690345174 29.052026013006504 26.650825412706354 21.53576788394197 18-19 22.018004501125283 29.83245811452863 26.456614153538382 21.6929232308077 20-21 21.590198774846854 29.216152019002372 27.590948868608578 21.602700337542196 22-23 22.85 28.3625 26.4625 22.325 24-25 22.8125 29.125 26.137500000000003 21.925 26-27 22.400000000000002 29.825000000000003 25.6125 22.162499999999998 28-29 23.3375 28.525 26.174999999999997 21.9625 30-31 22.0875 28.449999999999996 27.3 22.162499999999998 32-33 22.9625 28.1625 26.8625 22.0125 34-35 22.9625 28.237499999999997 26.7625 22.037499999999998 36-37 22.025 28.825 26.8625 22.287499999999998 38-39 22.225 27.750000000000004 27.6625 22.3625 40-41 22.940367545943243 27.69096137017127 26.89086135766971 22.477809726215778 42-43 22.037499999999998 28.237499999999997 27.6125 22.112499999999997 44-45 23.3625 27.625 28.0875 20.925 46-47 22.725 28.199999999999996 27.55 21.525 48-49 23.2875 28.000000000000004 26.950000000000003 21.762500000000003 50-51 23.825 27.8375 26.3125 22.025 52-53 22.15 27.8375 27.750000000000004 22.2625 54-55 23.302912864108013 27.628453556694588 26.103262907863485 22.96537067133392 56-57 23.218304576144035 28.319579894973746 26.51912978244561 21.94298574643661 58-59 22.115264408051004 27.94099262407801 27.55344418052256 22.39029878734842 60-61 22.0125 27.800000000000004 27.725 22.4625 62-63 22.1875 27.775 27.1625 22.875 64-65 21.987499999999997 28.8625 27.0125 22.1375 66-67 22.237499999999997 28.425 27.0625 22.275 68-69 22.9375 28.512500000000003 26.950000000000003 21.6 70-71 23.4875 27.950000000000003 27.425 21.1375 72-73 23.599999999999998 27.712500000000002 26.237500000000004 22.45 74-75 22.3375 29.575000000000003 26.2125 21.875 76-77 22.112499999999997 29.0875 26.787499999999998 22.0125 78-79 23.200000000000003 28.15 26.6125 22.037499999999998 80-81 23.849999999999998 28.249999999999996 25.650000000000002 22.25 82-83 23.8125 28.249999999999996 26.3125 21.625 84-85 23.1 28.3125 26.224999999999998 22.3625 86-87 24.175 29.5875 24.375 21.8625 88-89 24.474999999999998 28.8375 25.412499999999998 21.275 90-91 24.349999999999998 28.4125 25.112499999999997 22.125 92-93 25.162499999999998 29.275000000000002 24.075 21.4875 94-95 25.9625 29.362500000000004 23.95 20.724999999999998 96-97 25.75 28.9 24.0125 21.337500000000002 98-99 26.237500000000004 28.849999999999998 23.7375 21.175 100-101 26.737499999999997 28.025 23.7625 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 1.5 26 1.5 27 6.0 28 9.0 29 9.5 30 11.5 31 13.5 32 18.5 33 31.0 34 39.0 35 51.0 36 71.5 37 83.5 38 104.5 39 147.0 40 167.5 41 190.5 42 226.5 43 254.0 44 269.5 45 271.0 46 283.0 47 275.5 48 241.0 49 198.0 50 192.0 51 181.0 52 134.5 53 108.0 54 90.5 55 77.5 56 63.5 57 43.0 58 32.5 59 28.0 60 23.5 61 15.0 62 7.0 63 4.5 64 2.5 65 2.5 66 2.5 67 3.5 68 3.5 69 1.0 70 0.0 71 0.0 72 0.5 73 2.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.025 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.08750000000000001 14-15 0.17500000000000002 16-17 0.05 18-19 0.025 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.025 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6045340050377833 1.2 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.2875 0.0 0.0 0.0 0.0 58-59 0.45 0.0 0.0 0.0 0.0 60-61 0.5125 0.0 0.0 0.0 0.0 62-63 0.5874999999999999 0.0 0.0 0.0 0.0 64-65 0.675 0.0 0.0 0.0 0.0 66-67 0.8875 0.0 0.0 0.0 0.0 68-69 1.1124999999999998 0.0 0.0 0.0 0.0 70-71 1.4249999999999998 0.0 0.0 0.0 0.0 72-73 1.9500000000000002 0.0 0.0 0.0 0.0 74-75 2.5375 0.0 0.0 0.0 0.0 76-77 3.25 0.0 0.0 0.0 0.0 78-79 3.8125 0.0 0.0 0.0 0.0 80-81 4.575 0.0 0.0 0.0 0.0 82-83 5.55 0.0 0.0 0.0 0.0 84-85 6.525 0.0 0.0 0.0 0.0 86-87 7.9750000000000005 0.0 0.0 0.0 0.0 88-89 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401948 spots for ERR1864426.sra Written 401948 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra Read 401946 spots for ERR1864426.sra Written 401946 spots for ERR1864426.sra SRR ids: ['ERR1864426.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jqnoy39g ERR1864426.sra spots: 8038922 blocks: [[1, 401946], [401947, 803892], [803893, 1205838], [1205839, 1607784], [1607785, 2009730], [2009731, 2411676], [2411677, 2813622], [2813623, 3215568], [3215569, 3617514], [3617515, 4019460], [4019461, 4421406], [4421407, 4823352], [4823353, 5225298], [5225299, 5627244], [5627245, 6029190], [6029191, 6431136], [6431137, 6833082], [6833083, 7235028], [7235029, 7636974], [7636975, 8038922]] ERR1864426 file size 1921205 ERR1864426 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864426 ERR1864426_1.fastq ERR1864426_2.fastq Input file: ERR1864426_1.fastq Paired file: ERR1864426_2.fastq trimmed: ERR1864426-trimmed-pair1.fastq, ERR1864426-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:09:28 2025 >> started Thu Feb 13 06:09:57 2025 >> done (28.579s) 8038922 read pairs processed; of these: 71940 ( 0.89%) short read pairs filtered out after trimming by size control 100098 ( 1.25%) empty read pairs filtered out after trimming by size control 7866884 (97.86%) read pairs available; of these: 2743187 (34.87%) trimmed read pairs available after processing 5123697 (65.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 36 0.00% 19 49 0.00% 20 96 0.00% 21 128 0.00% 22 155 0.00% 23 192 0.00% 24 246 0.00% 25 291 0.00% 26 348 0.00% 27 417 0.01% 28 479 0.01% 29 575 0.01% 30 617 0.01% 31 707 0.01% 32 863 0.01% 33 976 0.01% 34 1059 0.01% 35 1118 0.01% 36 1212 0.02% 37 1355 0.02% 38 1492 0.02% 39 1742 0.02% 40 1832 0.02% 41 2036 0.03% 42 2180 0.03% 43 2377 0.03% 44 2516 0.03% 45 2732 0.03% 46 2912 0.04% 47 3186 0.04% 48 3464 0.04% 49 3953 0.05% 50 4180 0.05% 51 4682 0.06% 52 5013 0.06% 53 5375 0.07% 54 5843 0.07% 55 6253 0.08% 56 6942 0.09% 57 7660 0.10% 58 8519 0.11% 59 10730 0.14% 60 12838 0.16% 61 13869 0.18% 62 14752 0.19% 63 15737 0.20% 64 16763 0.21% 65 17617 0.22% 66 19035 0.24% 67 20894 0.27% 68 21890 0.28% 69 23980 0.30% 70 25507 0.32% 71 27359 0.35% 72 29872 0.38% 73 32143 0.41% 74 34199 0.43% 75 36571 0.46% 76 38385 0.49% 77 41482 0.53% 78 44330 0.56% 79 46972 0.60% 80 50865 0.65% 81 53478 0.68% 82 57130 0.73% 83 59883 0.76% 84 64479 0.82% 85 68007 0.86% 86 71851 0.91% 87 73381 0.93% 88 76812 0.98% 89 78515 1.00% 90 82267 1.05% 91 86943 1.11% 92 91186 1.16% 93 97654 1.24% 94 103799 1.32% 95 112273 1.43% 96 121712 1.55% 97 135989 1.73% 98 159037 2.02% 99 188829 2.40% 100 268364 3.41% 101 5123697 65.13% 7866884 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=70.65 fanout-score-rank=6 prefix-density=1.22 prefix-fanout=12.6 sequence=TCTTCTTCTTCTCTGGTTCAAGGGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=160.46 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.2 sequence=CCTTCTCCATGCATTCTACATGAACATATCTTCCCAGCTTGTCCACCTGCCTTGGGTCACCGCTAGTATCTTTCTTACAGACCTTGCACGTTTTGTCGACCCAGCCTTCTTCAACATATTGCCCGTCCACATCAACGTAGGATTTAAAGAAATCCTTGTATGTCCCTCCGATTTTTCTTCTAAGAGCACCATACTGCTCCCTTGTCATTCTGCCACCAGAACTGGTGTTTTCTCTAGCCTCCTCTAGAAGTTCGGCATCCTTGGCAGACCGAACTTGAGAGAAATCTAGAGCTTCAGCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=90.85 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.6 sequence=AAAAGAAGGCAGTCAAATGGCCACTACTGCTTCTCCAATGGCCAGCCAGCTCAAAAGCAGCCTTGCCTCATCTCTAGGAAGGAGGCTTGTCATCCCCAGAGGCATTTCTGGAGCTCCATTTAGAGTTTCGCCCAACAAGAGAAGCTTCACTGTCAAAGCCGTTCAAGCAGACAAGCCAACTTACCAAGTGGTTCAACCAATCAATGGCGATCCCTTCATTGGAAGTCTTGAGACTCCCGTTACATCAAGCCCGCTGATTGCATGGTACCTGTCCAACCTCCCCGCCTACAGGACAGCAGTCAGTCCACTTCTCCGCGGAATCGAGGTGGGGCTGGCCCATGGCTTCC ERR1864426 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:11:10 Started mapping on | Feb 13 06:11:21 Finished on | Feb 13 06:11:42 Mapping speed, Million of reads per hour | 1348.61 Number of input reads | 7866884 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 7643757 Uniquely mapped reads % | 97.16% Average mapped length | 192.05 Number of splices: Total | 4176094 Number of splices: Annotated (sjdb) | 4108593 Number of splices: GT/AG | 4105255 Number of splices: GC/AG | 61236 Number of splices: AT/AC | 3375 Number of splices: Non-canonical | 6228 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161617 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 25478 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 70515 70515 70515 N_multimapping 161617 161617 161617 N_noFeature 164042 7545107 214174 N_ambiguous 82303 284 33602 UnstrandedReadsAssigned:7397412 PositiveStrandReadsAssigned:98366 NegativeStrandReadsAssigned:7395981 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=94 echo kmer=89 ERR1864426 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864426-trimmed-pair1.fastq ERR1864426-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,866,884 reads, 7,491,989 reads pseudoaligned [quant] estimated average fragment length: 132.253 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 ERR1864426.ke.tsv 34699 ERR1864426.se.tsv 87100 total ==> ERR1864426.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1886.75 394 27.695 Potri.005G024800.1.v4.1 1035 903.747 120 17.6098 Potri.004G059700.1.v4.1 961 829.755 2 0.319668 Potri.007G009000.2.v4.1 1416 1284.75 0 0 Potri.003G141000.2.v4.1 2943 2811.75 445 20.9895 Potri.016G087400.1.v4.1 270 142.098 431 402.261 Potri.015G069301.1.v4.1 564 432.776 0 0 Potri.010G195200.1.v4.1 1773 1641.75 17 1.37329 Potri.012G127500.1.v4.1 977 845.755 156 24.4624 ==> ERR1864426.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 57 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 ERR1864426 completed mapping pipeline successfully