Starting /dee2/code/volunteer_pipeline.sh ERR1864427 current disk space = 3052650885120 free memory = 1582231360 ERR1864427 SRAfilesize ccb724f90daa587bd7474a077a9a7dbb ERR1864427.sra ERR1864427.sra file validated ERR1864427 is paired end ERR1864427 is conventional basespace ERR1864427 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864427_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02575 33.0 31.0 34.0 28.0 34.0 2 31.61475 34.0 31.0 34.0 28.0 34.0 3 32.06 34.0 31.0 34.0 28.0 34.0 4 35.4155 37.0 35.0 37.0 33.0 37.0 5 35.2835 37.0 35.0 37.0 33.0 37.0 6 35.163 37.0 35.0 37.0 32.0 37.0 7 35.07125 37.0 35.0 37.0 32.0 37.0 8 35.01625 37.0 35.0 37.0 32.0 37.0 9 36.721 39.0 37.0 39.0 33.0 39.0 10-11 36.747625 39.0 37.0 39.0 33.0 39.0 12-13 36.651875000000004 39.0 37.0 39.0 33.0 39.0 14-15 37.96725 40.5 38.0 41.0 33.0 41.0 16-17 37.82525 40.0 38.0 41.0 32.5 41.0 18-19 37.858375 40.0 38.0 41.0 33.0 41.0 20-21 37.710875 40.0 38.0 41.0 32.0 41.0 22-23 37.518625 40.0 38.0 41.0 31.5 41.0 24-25 37.458375000000004 40.0 38.0 41.0 32.0 41.0 26-27 37.442875 40.0 38.0 41.0 32.0 41.0 28-29 37.251374999999996 40.0 37.5 41.0 31.0 41.0 30-31 37.0615 40.0 37.0 41.0 30.5 41.0 32-33 37.1215 40.0 37.0 41.0 31.0 41.0 34-35 36.916624999999996 40.0 37.0 41.0 30.5 41.0 36-37 36.695875 40.0 37.0 41.0 30.0 41.0 38-39 36.61675 40.0 37.0 41.0 30.0 41.0 40-41 36.461875 40.0 36.0 41.0 29.5 41.0 42-43 36.2585 40.0 36.0 41.0 29.0 41.0 44-45 36.30737499999999 40.0 36.0 41.0 29.5 41.0 46-47 36.413875000000004 40.0 36.5 41.0 30.0 41.0 48-49 36.323625 40.0 36.0 41.0 29.5 41.0 50-51 36.119375000000005 40.0 35.5 41.0 28.5 41.0 52-53 35.878874999999994 39.0 35.0 41.0 28.0 41.0 54-55 35.678625 39.0 35.0 41.0 27.0 41.0 56-57 35.480374999999995 39.0 35.0 41.0 27.5 41.0 58-59 35.149249999999995 38.5 34.5 40.5 26.0 41.0 60-61 34.81162500000001 38.0 34.0 40.0 26.0 41.0 62-63 34.45425 38.0 34.0 40.0 25.5 41.0 64-65 33.995374999999996 37.0 33.0 40.0 23.0 41.0 66-67 33.712500000000006 37.0 33.0 39.5 24.0 41.0 68-69 33.45375 36.0 33.0 39.0 24.0 41.0 70-71 32.997 36.0 33.0 39.0 22.0 40.0 72-73 32.623875 35.0 32.0 38.5 22.5 40.0 74-75 32.075875 35.0 32.0 37.0 20.0 39.0 76-77 30.93675 34.0 30.5 36.0 20.0 39.0 78-79 31.306874999999998 35.0 31.0 36.0 20.0 38.5 80-81 31.0945 35.0 31.5 36.0 18.5 37.0 82-83 30.80375 35.0 31.0 35.5 18.0 37.0 84-85 30.38325 34.0 31.0 35.0 12.0 36.5 86-87 29.718375 34.0 30.0 35.0 6.5 36.0 88-89 29.5005 34.0 30.0 35.0 2.0 36.0 90-91 29.165375 34.0 29.5 35.0 2.0 35.0 92-93 28.935499999999998 34.0 29.5 35.0 2.0 35.0 94-95 28.62325 34.0 29.0 35.0 2.0 35.0 96-97 28.356375 34.0 29.0 35.0 2.0 35.0 98-99 27.9225 34.0 29.0 35.0 2.0 35.0 100-101 26.89375 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 43.0 3 21.0 4 16.0 5 10.0 6 8.0 7 8.0 8 7.0 9 8.0 10 7.0 11 10.0 12 17.0 13 11.0 14 5.0 15 14.0 16 13.0 17 11.0 18 15.0 19 25.0 20 22.0 21 27.0 22 14.0 23 31.0 24 27.0 25 24.0 26 33.0 27 50.0 28 42.0 29 66.0 30 72.0 31 99.0 32 108.0 33 166.0 34 220.0 35 295.0 36 478.0 37 866.0 38 985.0 39 126.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.64973056197075 4.849884526558892 8.031819348216576 42.46856556325378 2 29.549999999999997 7.5249999999999995 30.75 32.175 3 26.75 10.025 23.025000000000002 40.2 4 32.5 14.625 20.9 31.974999999999998 5 30.532633158289574 22.155538884721178 24.15603900975244 23.15578894723681 6 23.355838959739934 27.056764191047762 26.78169542385596 22.80570142535634 7 17.75443860965241 22.50562640660165 42.26056514128532 17.479369842460617 8 18.35458864716179 23.455863965991497 36.209052263065765 21.980495123780948 9 20.005001250312578 21.280320080020005 38.78469617404351 19.929982495623904 10-11 21.8304576144036 31.13278319579895 28.557139284821204 18.479619904976243 12-13 22.268067016754188 24.8062015503876 31.520380095023754 21.405351337834457 14-15 22.1833187445292 27.085156933850197 29.848693259972492 20.88283106164812 16-17 21.52326163081541 27.238619309654826 29.627313656828413 21.61080540270135 18-19 21.45536384096024 26.544136034008503 29.507376844211052 22.493123280820203 20-21 21.895710891584343 27.46029761160435 28.42315868450669 22.220832812304614 22-23 22.123561780890444 26.850925462731368 29.33966983491746 21.68584292146073 24-25 21.808178066775042 26.559959984994375 29.448543203701387 22.1833187445292 26-27 21.583093660122547 28.135550831561833 28.410653995248218 21.8707015130674 28-29 22.545954733024885 26.960110041265473 27.98549456046017 22.50844066524947 30-31 21.398199099549775 27.48874437218609 28.139069534767387 22.973986993496748 32-33 21.683131174190322 26.985119419782418 28.23558834562961 23.096161060397648 34-35 22.468117029257314 26.556639159789945 28.657164291072768 22.31807951987997 36-37 22.37088908340628 26.334875578341876 28.710766537451544 22.5834688008003 38-39 22.433412529698636 26.109791171689384 28.448168063023633 23.008628235588347 40-41 21.767941985496375 27.7569392348087 28.582145536384097 21.892973243310827 42-43 21.973486743371687 27.01350675337669 28.92696348174087 22.086043021510758 44-45 22.048524262131068 26.28814407203602 28.039019509754876 23.62431215607804 46-47 22.24862431215608 27.62631315657829 26.775887943971988 23.349174587293646 48-49 21.858196823808928 26.62248343128673 28.085532074527947 23.43378767037639 50-51 21.87343671835918 27.67633816908454 28.16408204102051 22.28614307153577 52-53 21.409790910229123 27.369475397520972 28.634030299236258 22.586703393013646 54-55 21.558084281605602 28.260597724146553 27.547830436413655 22.633487557834187 56-57 21.59289822455614 27.181795448862218 28.80720180045011 22.418104526131533 58-59 22.405601400350086 28.169542385596397 27.719429857464366 21.705426356589147 60-61 21.73043260815204 27.581895473868467 27.19429857464366 23.493373343335833 62-63 22.0625 27.250000000000004 27.3375 23.35 64-65 21.95 27.6375 28.287499999999998 22.125 66-67 21.525 27.487499999999997 27.900000000000002 23.0875 68-69 22.037499999999998 27.212500000000002 28.537499999999998 22.2125 70-71 22.975 27.125 27.8125 22.0875 72-73 21.75 27.625 27.9125 22.7125 74-75 22.5 26.387500000000003 28.762500000000003 22.35 76-77 22.5 27.125 28.599999999999998 21.775 78-79 22.468117029257314 27.781945486371594 27.719429857464366 22.030507626906726 80-81 22.225 27.8625 28.5625 21.349999999999998 82-83 23.4125 27.6375 26.450000000000003 22.5 84-85 22.912499999999998 28.1625 26.5 22.425 86-87 22.8375 28.375 26.224999999999998 22.5625 88-89 23.925 27.750000000000004 26.337500000000002 21.987499999999997 90-91 23.974999999999998 27.5125 26.187500000000004 22.325 92-93 23.849999999999998 27.962500000000002 26.375 21.8125 94-95 23.7875 28.125 24.962500000000002 23.125 96-97 23.625 28.6875 25.575 22.112499999999997 98-99 23.1 28.6375 25.087500000000002 23.175 100-101 24.125 28.549999999999997 24.55 22.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 3.5 27 5.5 28 6.5 29 8.5 30 9.5 31 14.5 32 21.0 33 24.0 34 31.5 35 47.5 36 63.5 37 78.5 38 104.0 39 128.5 40 157.5 41 186.5 42 213.0 43 247.5 44 266.0 45 281.5 46 271.5 47 257.5 48 240.5 49 215.5 50 214.0 51 189.0 52 146.0 53 117.0 54 91.5 55 69.5 56 63.5 57 54.0 58 38.5 59 30.0 60 25.0 61 20.0 62 14.5 63 11.0 64 9.0 65 5.0 66 3.5 67 3.0 68 3.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.0375 16-17 0.05 18-19 0.025 20-21 0.0375 22-23 0.05 24-25 0.0375 26-27 0.0375 28-29 0.0375 30-31 0.05 32-33 0.0375 34-35 0.025 36-37 0.0375 38-39 0.0375 40-41 0.025 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.0375 50-51 0.05 52-53 0.1625 54-55 0.0375 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10693271936557 95.875 2 1.5349194167306215 3.0 3 0.28140189306728064 0.8250000000000001 4 0.07674597083653108 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2375 0.0 0.0 0.0 0.0 58-59 0.3125 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.48750000000000004 0.0 0.0 0.0 0.0 64-65 0.6125 0.0 0.0 0.0 0.0 66-67 0.8125 0.0 0.0 0.0 0.0 68-69 1.1 0.0 0.0 0.0 0.0 70-71 1.475 0.0 0.0 0.0 0.0 72-73 1.9874999999999998 0.0 0.0 0.0 0.0 74-75 2.475 0.0 0.0 0.0 0.0 76-77 2.925 0.0 0.0 0.0 0.0 78-79 3.65 0.0 0.0 0.0 0.0 80-81 4.725 0.0 0.0 0.0 0.0 82-83 5.9125 0.0 0.0 0.0 0.0 84-85 7.15 0.0 0.0 0.0 0.0 86-87 8.325 0.0 0.0 0.0 0.0 88-89 9.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864427 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864427_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.03675 34.0 31.0 34.0 30.0 34.0 2 32.04725 34.0 31.0 34.0 30.0 34.0 3 32.0955 34.0 31.0 34.0 30.0 34.0 4 35.42525 37.0 35.0 37.0 33.0 37.0 5 35.403 37.0 35.0 37.0 33.0 37.0 6 35.4735 37.0 36.0 37.0 33.0 37.0 7 35.44325 37.0 36.0 37.0 33.0 37.0 8 35.5125 37.0 36.0 37.0 33.0 37.0 9 37.03675 39.0 37.0 39.0 33.0 39.0 10-11 37.01225 39.0 37.0 39.0 33.0 39.0 12-13 36.8955 39.0 37.0 39.0 33.0 39.0 14-15 38.35825 41.0 38.0 41.0 33.5 41.0 16-17 38.197125 41.0 38.0 41.0 33.0 41.0 18-19 38.253125 41.0 38.0 41.0 33.5 41.0 20-21 38.159000000000006 40.5 38.0 41.0 33.0 41.0 22-23 37.868375 40.0 38.0 41.0 32.0 41.0 24-25 37.93925 40.0 38.0 41.0 32.5 41.0 26-27 37.851625 40.0 38.0 41.0 32.5 41.0 28-29 37.737375 40.0 38.0 41.0 32.0 41.0 30-31 37.55925 40.0 38.0 41.0 32.0 41.0 32-33 37.354749999999996 40.0 38.0 41.0 31.0 41.0 34-35 37.253625 40.0 37.5 41.0 30.5 41.0 36-37 37.116125 40.0 37.0 41.0 30.0 41.0 38-39 37.03125 40.0 37.5 41.0 30.0 41.0 40-41 36.973749999999995 40.0 37.0 41.0 30.0 41.0 42-43 36.8035 40.0 37.0 41.0 30.0 41.0 44-45 36.59275 40.0 37.0 41.0 30.0 41.0 46-47 36.335375 40.0 36.0 41.0 28.5 41.0 48-49 36.195750000000004 39.5 36.0 41.0 29.0 41.0 50-51 35.765874999999994 39.0 35.5 40.5 27.5 40.5 52-53 36.067 39.0 36.5 40.5 28.5 41.0 54-55 36.377875 40.0 36.0 41.0 29.0 41.0 56-57 36.19025 40.0 36.0 41.0 28.0 41.0 58-59 35.989625000000004 39.5 35.5 41.0 28.0 41.0 60-61 35.718 39.0 35.0 41.0 28.0 41.0 62-63 35.4045 39.0 35.0 41.0 27.5 41.0 64-65 34.948375 38.0 34.5 40.0 26.0 41.0 66-67 34.56375 37.5 34.0 40.0 26.0 41.0 68-69 34.239625000000004 37.0 34.0 39.0 26.0 41.0 70-71 33.685249999999996 36.0 34.0 39.0 25.5 41.0 72-73 33.163375 36.0 33.0 38.5 24.5 40.0 74-75 32.6345 35.0 33.0 37.0 23.5 39.0 76-77 31.924124999999997 35.0 31.5 37.0 21.5 39.0 78-79 31.407874999999997 35.0 31.0 36.0 20.0 38.0 80-81 31.093249999999998 35.0 31.0 36.0 18.5 37.0 82-83 30.698124999999997 35.0 31.0 35.5 17.5 37.0 84-85 30.24375 34.0 30.5 35.0 9.5 36.0 86-87 29.657875 34.0 30.5 35.0 4.5 36.0 88-89 29.266875 34.0 29.0 35.0 2.0 36.0 90-91 29.189875 34.0 30.0 35.0 2.0 35.0 92-93 28.944499999999998 34.0 29.5 35.0 2.0 35.0 94-95 28.5305 34.0 29.0 35.0 2.0 35.0 96-97 27.6025 33.5 27.5 35.0 2.0 35.0 98-99 26.868125 33.0 25.5 35.0 2.0 35.0 100-101 25.537125000000003 32.0 22.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 11.0 4 2.0 5 4.0 6 6.0 7 2.0 8 2.0 9 17.0 10 8.0 11 19.0 12 15.0 13 9.0 14 10.0 15 18.0 16 16.0 17 12.0 18 18.0 19 19.0 20 15.0 21 22.0 22 28.0 23 27.0 24 34.0 25 38.0 26 39.0 27 52.0 28 63.0 29 74.0 30 63.0 31 100.0 32 112.0 33 134.0 34 200.0 35 261.0 36 425.0 37 861.0 38 1103.0 39 132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.582395598899723 18.629657414353588 13.603400850212552 38.18454613653413 2 24.306076519129782 24.456114028507127 33.53338334583646 17.704426106526633 3 20.830207551887973 27.881970492623154 27.45686421605401 23.830957739434858 4 22.755688922230558 32.53313328332083 22.55563890972743 22.155538884721178 5 23.13078269567392 35.20880220055014 23.655913978494624 18.00450112528132 6 19.025 39.15 22.650000000000002 19.175 7 20.9 21.025 35.6 22.475 8 20.175 25.224999999999998 28.449999999999996 26.150000000000002 9 22.525000000000002 23.5 29.275000000000002 24.7 10-11 22.900000000000002 31.025000000000002 24.6 21.475 12-13 23.23661830915458 25.625312656328163 26.825912956478238 24.312156078039017 14-15 21.81476846057572 28.185231539424283 27.459324155193993 22.540675844806007 16-17 22.411205602801402 28.12656328164082 27.351175587793897 22.11105552776388 18-19 21.177647205900737 29.2911613951744 27.315914489311165 22.215276909613703 20-21 21.890236279534943 28.57857232154019 27.228403550443808 22.30278784848106 22-23 22.112499999999997 28.9375 26.125 22.825 24-25 21.85 29.525000000000002 26.2875 22.3375 26-27 21.775 29.362500000000004 27.0125 21.85 28-29 23.5 28.6625 26.450000000000003 21.3875 30-31 22.3 28.962500000000002 26.775 21.9625 32-33 21.975 28.95 26.35 22.725 34-35 22.3625 28.762500000000003 27.200000000000003 21.675 36-37 21.675 27.537499999999998 27.875 22.912499999999998 38-39 22.3 28.3375 27.700000000000003 21.6625 40-41 22.14026753344168 27.953494186773348 27.403425428178522 22.502812851606453 42-43 22.3375 28.7 26.674999999999997 22.287499999999998 44-45 22.6875 28.349999999999998 27.3875 21.575 46-47 22.45 28.199999999999996 26.6 22.75 48-49 22.8875 28.075 27.3 21.7375 50-51 22.45 27.900000000000002 26.787499999999998 22.8625 52-53 22.1875 27.750000000000004 28.4375 21.625 54-55 22.315289411176398 27.765970746343292 27.54094261782723 22.377797224653083 56-57 21.85546386596649 29.257314328582147 27.344336084021002 21.54288572143036 58-59 22.91536442055257 27.440930116264532 27.54094261782723 22.10276284535567 60-61 22.825 28.537499999999998 26.900000000000002 21.7375 62-63 23.2875 28.449999999999996 26.650000000000002 21.6125 64-65 22.8875 27.9375 26.35 22.825 66-67 22.475 28.125 27.725 21.675 68-69 23.150000000000002 28.4375 26.424999999999997 21.987499999999997 70-71 22.825 28.325 26.650000000000002 22.2 72-73 23.474999999999998 29.049999999999997 25.6 21.875 74-75 22.95 29.3375 25.887500000000003 21.825 76-77 22.8875 29.2375 25.887500000000003 21.987499999999997 78-79 23.1625 28.95 26.0625 21.825 80-81 23.4125 28.425 26.724999999999998 21.4375 82-83 24.4375 28.349999999999998 25.3125 21.9 84-85 23.7125 29.049999999999997 25.2125 22.025 86-87 24.65 28.487499999999997 24.887500000000003 21.975 88-89 25.05 29.775000000000002 24.075 21.099999999999998 90-91 25.0125 29.362500000000004 24.637500000000003 20.9875 92-93 25.6 29.1375 24.1875 21.075 94-95 26.575 27.975 24.025 21.425 96-97 27.175 29.462500000000002 22.6375 20.724999999999998 98-99 26.9125 29.5875 23.1875 20.3125 100-101 28.4 28.6375 22.787499999999998 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 3.0 28 5.0 29 9.0 30 9.0 31 10.0 32 22.0 33 33.0 34 41.5 35 50.0 36 64.5 37 86.0 38 117.0 39 150.0 40 170.0 41 182.0 42 225.0 43 274.5 44 259.0 45 273.0 46 293.0 47 266.0 48 239.5 49 209.5 50 178.0 51 160.5 52 141.0 53 108.0 54 90.0 55 71.0 56 56.5 57 51.5 58 40.5 59 28.0 60 17.5 61 11.5 62 10.5 63 7.5 64 5.5 65 4.0 66 3.5 67 2.5 68 2.0 69 2.5 70 4.0 71 3.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.05 14-15 0.125 16-17 0.05 18-19 0.0125 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.025 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.2 0.0 0.0 0.0 0.0 56-57 0.2375 0.0 0.0 0.0 0.0 58-59 0.3125 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.48750000000000004 0.0 0.0 0.0 0.0 64-65 0.6125 0.0 0.0 0.0 0.0 66-67 0.8125 0.0 0.0 0.0 0.0 68-69 1.075 0.0 0.0 0.0 0.0 70-71 1.4375 0.0 0.0 0.0 0.0 72-73 1.9375 0.0 0.0 0.0 0.0 74-75 2.4124999999999996 0.0 0.0 0.0 0.0 76-77 2.875 0.0 0.0 0.0 0.0 78-79 3.6125 0.0 0.0 0.0 0.0 80-81 4.675 0.0 0.0 0.0 0.0 82-83 5.824999999999999 0.0 0.0 0.0 0.0 84-85 7.1 0.0 0.0 0.0 0.0 86-87 8.325 0.0 0.0 0.0 0.0 88-89 9.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407423 spots for ERR1864427.sra Written 407423 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra Read 407405 spots for ERR1864427.sra Written 407405 spots for ERR1864427.sra SRR ids: ['ERR1864427.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uoby_vj_ ERR1864427.sra spots: 8148118 blocks: [[1, 407405], [407406, 814810], [814811, 1222215], [1222216, 1629620], [1629621, 2037025], [2037026, 2444430], [2444431, 2851835], [2851836, 3259240], [3259241, 3666645], [3666646, 4074050], [4074051, 4481455], [4481456, 4888860], [4888861, 5296265], [5296266, 5703670], [5703671, 6111075], [6111076, 6518480], [6518481, 6925885], [6925886, 7333290], [7333291, 7740695], [7740696, 8148118]] ERR1864427 file size 1947331 ERR1864427 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864427 ERR1864427_1.fastq ERR1864427_2.fastq Input file: ERR1864427_1.fastq Paired file: ERR1864427_2.fastq trimmed: ERR1864427-trimmed-pair1.fastq, ERR1864427-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 08:27:27 2025 >> started Thu Feb 13 08:41:48 2025 >> done (861.205s) 8148118 read pairs processed; of these: 93439 ( 1.15%) short read pairs filtered out after trimming by size control 101341 ( 1.24%) empty read pairs filtered out after trimming by size control 7953338 (97.61%) read pairs available; of these: 2856246 (35.91%) trimmed read pairs available after processing 5097092 (64.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 94 0.00% 20 103 0.00% 21 171 0.00% 22 207 0.00% 23 275 0.00% 24 332 0.00% 25 374 0.00% 26 444 0.01% 27 519 0.01% 28 608 0.01% 29 705 0.01% 30 814 0.01% 31 887 0.01% 32 1002 0.01% 33 1111 0.01% 34 1248 0.02% 35 1297 0.02% 36 1581 0.02% 37 1620 0.02% 38 1760 0.02% 39 1996 0.03% 40 2119 0.03% 41 2249 0.03% 42 2445 0.03% 43 2615 0.03% 44 2773 0.03% 45 3050 0.04% 46 3249 0.04% 47 3497 0.04% 48 3797 0.05% 49 4072 0.05% 50 4494 0.06% 51 5061 0.06% 52 5327 0.07% 53 5993 0.08% 54 6164 0.08% 55 6631 0.08% 56 7409 0.09% 57 8081 0.10% 58 9123 0.11% 59 11636 0.15% 60 13795 0.17% 61 14715 0.19% 62 15718 0.20% 63 16619 0.21% 64 17721 0.22% 65 18754 0.24% 66 20091 0.25% 67 21883 0.28% 68 23158 0.29% 69 24607 0.31% 70 26764 0.34% 71 28528 0.36% 72 31026 0.39% 73 33420 0.42% 74 35855 0.45% 75 38723 0.49% 76 40366 0.51% 77 43458 0.55% 78 46201 0.58% 79 49043 0.62% 80 52589 0.66% 81 55535 0.70% 82 59402 0.75% 83 63025 0.79% 84 67909 0.85% 85 71514 0.90% 86 75118 0.94% 87 77977 0.98% 88 79889 1.00% 89 82613 1.04% 90 87071 1.09% 91 91201 1.15% 92 94747 1.19% 93 101081 1.27% 94 108158 1.36% 95 116219 1.46% 96 126236 1.59% 97 141937 1.78% 98 163017 2.05% 99 192709 2.42% 100 270894 3.41% 101 5097092 64.09% 7953338 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=59.99 fanout-score-rank=4 prefix-density=1.34 prefix-fanout=11.5 sequence=TCTTCTTCTTCTCTGGTTCAAGGGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=157.96 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.0 sequence=CCTTCTCCATGCATTCTACATGAACATATCTTCCCAGCTTGTCCACCTGCCTTGGGTCACCGCTAGTATCTTTCTTACAGACCTTGCACGTTTTGTCGACCCAGCCTTCTTCAACATATTGCCCGTCCACATCAACGTAGGATTTAAAGAAATCCTTGTATGTCCCTCCGATTTTTCTTCTAAGAGCACCATACTGCTCCCTTGTCATTCTGCCACCAGAACTGGTGTTTTCTCTAGCCTCCTCTAGAAGTTCGGCATCCTTGGCAGACCGAACTTGAGAGAAATCTAGAGCTTCAGCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=55.10 fanout-score-rank=2 prefix-density=1.33 prefix-fanout=10.4 sequence=AGAAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=261.63 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.8 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGC ERR1864427 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:50:00 Started mapping on | Feb 13 09:50:50 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 6.38 Number of input reads | 7953338 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 7703045 Uniquely mapped reads % | 96.85% Average mapped length | 191.64 Number of splices: Total | 4174210 Number of splices: Annotated (sjdb) | 4104173 Number of splices: GT/AG | 4105332 Number of splices: GC/AG | 59637 Number of splices: AT/AC | 3336 Number of splices: Non-canonical | 5905 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.37 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166004 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 37545 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.56% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 95300 95300 95300 N_multimapping 166004 166004 166004 N_noFeature 182846 7581752 258748 N_ambiguous 76314 435 30578 UnstrandedReadsAssigned:7443885 PositiveStrandReadsAssigned:120858 NegativeStrandReadsAssigned:7413719 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=93 echo kmer=89 ERR1864427 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864427-trimmed-pair1.fastq ERR1864427-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,953,338 reads, 7,517,227 reads pseudoaligned [quant] estimated average fragment length: 130.014 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 ERR1864427.ke.tsv 34699 ERR1864427.se.tsv 87100 total ==> ERR1864427.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1888.99 412 30.5993 Potri.005G024800.1.v4.1 1035 905.986 134 20.7504 Potri.004G059700.1.v4.1 961 831.986 2 0.337253 Potri.007G009000.2.v4.1 1416 1286.99 0 0 Potri.003G141000.2.v4.1 2943 2813.99 485 24.1803 Potri.016G087400.1.v4.1 270 143.981 397 386.836 Potri.015G069301.1.v4.1 564 434.992 0 0 Potri.010G195200.1.v4.1 1773 1643.99 28 2.38947 Potri.012G127500.1.v4.1 977 847.986 96 15.8827 ==> ERR1864427.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 50 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 ERR1864427 completed mapping pipeline successfully