Starting /dee2/code/volunteer_pipeline.sh ERR1864428 current disk space = 3053150216192 free memory = 1579727340 ERR1864428 SRAfilesize 65e64b4c7d6779acf2cb673594f774e5 ERR1864428.sra ERR1864428.sra file validated ERR1864428 is paired end ERR1864428 is conventional basespace ERR1864428 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864428_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0775 33.0 31.0 34.0 29.0 34.0 2 31.658 34.0 31.0 34.0 28.0 34.0 3 32.074 34.0 31.0 34.0 30.0 34.0 4 35.4685 37.0 35.0 37.0 33.0 37.0 5 35.3225 37.0 35.0 37.0 33.0 37.0 6 35.20075 37.0 35.0 37.0 32.0 37.0 7 35.166 37.0 35.0 37.0 32.0 37.0 8 35.22775 37.0 35.0 37.0 33.0 37.0 9 36.8765 39.0 37.0 39.0 33.0 39.0 10-11 36.854124999999996 39.0 37.0 39.0 33.0 39.0 12-13 36.76075 39.0 37.0 39.0 33.0 39.0 14-15 38.13475 41.0 38.0 41.0 33.0 41.0 16-17 37.986625000000004 40.5 38.0 41.0 33.0 41.0 18-19 38.023624999999996 40.0 38.0 41.0 33.0 41.0 20-21 37.899375 40.0 38.0 41.0 33.0 41.0 22-23 37.782125 40.0 38.0 41.0 32.5 41.0 24-25 37.717875 40.0 38.0 41.0 32.5 41.0 26-27 37.66575 40.0 38.0 41.0 32.0 41.0 28-29 37.554500000000004 40.0 38.0 41.0 32.0 41.0 30-31 37.427875 40.0 38.0 41.0 31.5 41.0 32-33 37.26575 40.0 38.0 41.0 31.5 41.0 34-35 37.202625 40.0 37.5 41.0 31.5 41.0 36-37 37.0355 40.0 37.5 41.0 30.5 41.0 38-39 36.88125 40.0 37.0 41.0 30.0 41.0 40-41 36.666375 40.0 37.0 41.0 30.0 41.0 42-43 36.5105 40.0 36.0 41.0 30.0 41.0 44-45 36.52575 40.0 36.5 41.0 30.0 41.0 46-47 36.681875 40.0 37.0 41.0 30.0 41.0 48-49 36.563874999999996 40.0 36.5 41.0 30.0 41.0 50-51 36.36875 40.0 36.0 41.0 29.5 41.0 52-53 36.1635 40.0 36.0 41.0 28.5 41.0 54-55 35.959125 39.5 35.5 41.0 28.0 41.0 56-57 35.805625000000006 39.0 35.0 41.0 28.0 41.0 58-59 35.63975 39.0 35.0 41.0 28.0 41.0 60-61 35.268 38.5 34.5 40.5 27.5 41.0 62-63 34.941375 38.0 34.0 40.0 27.0 41.0 64-65 34.565749999999994 37.5 34.0 40.0 26.0 41.0 66-67 34.11825 37.0 34.0 40.0 26.0 41.0 68-69 33.7475 36.5 34.0 39.0 24.5 41.0 70-71 33.328625 36.0 33.0 39.0 25.0 40.0 72-73 32.8625 35.5 33.0 38.5 23.5 40.0 74-75 32.31375 35.0 32.0 37.0 22.0 39.0 76-77 31.249499999999998 34.0 30.5 36.0 20.0 39.0 78-79 31.56725 35.0 32.0 36.0 21.5 38.5 80-81 31.37575 35.0 32.0 36.0 20.5 37.0 82-83 31.0585 35.0 31.0 35.5 20.0 37.0 84-85 30.69975 34.0 31.5 35.0 18.0 36.5 86-87 30.162374999999997 34.0 31.0 35.0 16.5 36.0 88-89 30.015625 34.0 31.0 35.0 15.0 36.0 90-91 29.829500000000003 34.0 31.0 35.0 6.0 35.0 92-93 29.484375 34.0 30.0 35.0 2.0 35.0 94-95 29.338625 34.0 30.0 35.0 2.0 35.0 96-97 29.030250000000002 34.0 30.0 35.0 2.0 35.0 98-99 28.567 34.0 30.0 35.0 2.0 35.0 100-101 27.3285 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 15.0 4 13.0 5 6.0 6 9.0 7 6.0 8 6.0 9 8.0 10 8.0 11 7.0 12 10.0 13 15.0 14 9.0 15 15.0 16 9.0 17 14.0 18 13.0 19 14.0 20 17.0 21 13.0 22 20.0 23 34.0 24 24.0 25 20.0 26 25.0 27 40.0 28 55.0 29 51.0 30 70.0 31 90.0 32 104.0 33 139.0 34 211.0 35 312.0 36 472.0 37 907.0 38 1034.0 39 136.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.70336156017449 4.6445984090325885 6.748781113677188 40.90325891711573 2 28.025 6.325 31.525 34.125 3 26.974999999999998 9.925 23.075000000000003 40.025 4 31.175000000000004 14.674999999999999 20.875 33.275 5 30.005005005005003 20.02002002002002 26.3013013013013 23.673673673673672 6 24.7 24.9 27.1 23.3 7 17.325 21.475 44.55 16.650000000000002 8 19.325 23.1 35.4 22.175 9 19.0 21.275 37.6 22.125 10-11 20.890111263907986 31.641455181897737 28.87860982622828 18.589823727965996 12-13 22.215276909613703 25.440680085010626 31.603950493811727 20.740092511563944 14-15 21.12764095511939 27.00337542192774 30.16627078384798 21.702712839104887 16-17 21.585792896448226 27.163581790895446 29.202101050525265 22.048524262131068 18-19 21.477684710588825 27.103387923490434 29.666208276034506 21.752719089886234 20-21 21.45536384096024 27.85696424106027 28.49462365591398 22.193048262065513 22-23 22.066549912434326 27.983487615711784 27.88341255941956 22.066549912434326 24-25 21.848424212106053 26.750875437718857 28.376688344172084 23.024012006003 26-27 21.245467050143805 28.048018006752535 27.91046642490934 22.796048518194322 28-29 21.182943603851445 27.447792922345883 28.210578967112664 23.158684506690008 30-31 21.513445903689806 26.82926829268293 28.567854909318324 23.089430894308943 32-33 22.301438398999373 27.967479674796746 26.929330831769853 22.80175109443402 34-35 21.727715964495562 27.728466058257283 28.678584823102888 21.865233154144267 36-37 22.38339377266475 26.597474052769787 27.79792422158309 23.22120795298237 38-39 22.786393196598297 26.538269134567283 28.376688344172084 22.298649324662332 40-41 22.193048262065513 27.35683920980245 28.969742435608904 21.48037009252313 42-43 21.613508442776734 27.779862414008754 28.030018761726076 22.57661038148843 44-45 21.436616193217368 25.8540858465774 28.45701414090852 24.252283819296707 46-47 22.047047047047048 28.22822822822823 27.84034034034034 21.884384384384383 48-49 21.405351337834457 26.744186046511626 29.844961240310074 22.005501375343837 50-51 22.461230615307652 26.863431715857928 28.451725862931465 22.22361180590295 52-53 21.917293233082706 27.706766917293237 27.518796992481203 22.857142857142858 54-55 22.71419637273296 26.691682301438398 28.480300187617264 22.11382113821138 56-57 21.0 25.6125 30.65 22.7375 58-59 21.752719089886234 27.203400425053132 28.103512939117394 22.940367545943243 60-61 20.577572196524567 28.166020752594072 28.491061382672832 22.765345668208525 62-63 21.587500000000002 28.1 27.712500000000002 22.6 64-65 22.375 27.4125 27.750000000000004 22.4625 66-67 22.0125 27.55 27.625 22.8125 68-69 22.225 27.787499999999998 27.962500000000002 22.025 70-71 22.35 27.6375 27.9375 22.075 72-73 22.95 27.962500000000002 26.974999999999998 22.112499999999997 74-75 21.625 27.9375 27.725 22.7125 76-77 23.3125 27.187499999999996 27.875 21.625 78-79 20.936053059692153 26.680015016894004 29.145288449505696 23.238643473908148 80-81 22.36118059029515 27.426213106553277 27.613806903451728 22.59879939969985 82-83 22.14857428714357 28.73936968484242 27.00100050025013 22.11105552776388 84-85 23.3125 27.8625 26.4625 22.3625 86-87 22.9375 27.500000000000004 26.5625 23.0 88-89 22.225 28.537499999999998 26.6625 22.575 90-91 22.8125 28.3875 25.887500000000003 22.912499999999998 92-93 23.3625 28.525 25.3 22.8125 94-95 22.6 28.4 26.450000000000003 22.55 96-97 23.575 27.962500000000002 26.1625 22.3 98-99 22.3375 28.287499999999998 26.3 23.075000000000003 100-101 22.6125 28.212500000000002 26.0375 23.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 0.5 25 2.5 26 4.0 27 5.0 28 6.5 29 10.5 30 12.5 31 14.5 32 20.0 33 23.5 34 36.5 35 49.0 36 68.5 37 94.0 38 110.0 39 124.0 40 146.5 41 186.0 42 220.5 43 238.5 44 242.5 45 263.5 46 281.5 47 284.0 48 271.5 49 228.0 50 196.5 51 172.0 52 133.5 53 114.0 54 102.0 55 76.0 56 59.5 57 48.0 58 39.0 59 31.5 60 22.5 61 15.0 62 10.0 63 6.0 64 5.5 65 5.5 66 4.5 67 3.5 68 1.5 69 2.5 70 2.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0125 14-15 0.0125 16-17 0.05 18-19 0.0125 20-21 0.025 22-23 0.075 24-25 0.05 26-27 0.0375 28-29 0.0375 30-31 0.0625 32-33 0.0625 34-35 0.0125 36-37 0.0375 38-39 0.05 40-41 0.025 42-43 0.0625 44-45 0.11249999999999999 46-47 0.1 48-49 0.025 50-51 0.05 52-53 0.25 54-55 0.0625 56-57 0.0 58-59 0.0125 60-61 0.0125 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.11249999999999999 80-81 0.05 82-83 0.05 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.94502954020035 95.325 2 1.7467248908296942 3.4000000000000004 3 0.10274852298998202 0.3 4 0.12843565373747753 0.5 5 0.0 0.0 6 0.05137426149499101 0.3 7 0.025687130747495505 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTTTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 27 (97% over 44bp) GTGGGGTGATCTGCAGCCTCTCAAGAAGGCTCTCATAAGTCAAACGACTA 6 0.15 No Hit CTGGAACTTAAAGGACTGAAGATCATATGAAGGTTGTGTCAAGGACATGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.23750000000000002 0.0 0.0 0.0 0.0 56-57 0.38749999999999996 0.0 0.0 0.0 0.0 58-59 0.5 0.0 0.0 0.0 0.0 60-61 0.7 0.0 0.0 0.0 0.0 62-63 0.8999999999999999 0.0 0.0 0.0 0.0 64-65 1.15 0.0 0.0 0.0 0.0 66-67 1.3624999999999998 0.0 0.0 0.0 0.0 68-69 1.5125000000000002 0.0 0.0 0.0 0.0 70-71 1.8125 0.0 0.0 0.0 0.0 72-73 2.2125 0.0 0.0 0.0 0.0 74-75 2.6624999999999996 0.0 0.0 0.0 0.0 76-77 3.375 0.0 0.0 0.0 0.0 78-79 4.125 0.0 0.0 0.0 0.0 80-81 4.875 0.0 0.0 0.0 0.0 82-83 5.8375 0.0 0.0 0.0 0.0 84-85 6.875 0.0 0.0 0.0 0.0 86-87 8.075 0.0 0.0 0.0 0.0 88-89 9.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864428 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864428_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.04025 34.0 31.0 34.0 30.0 34.0 2 32.129 34.0 31.0 34.0 30.0 34.0 3 32.162 34.0 31.0 34.0 30.0 34.0 4 35.43925 37.0 35.0 37.0 33.0 37.0 5 35.3815 37.0 35.0 37.0 33.0 37.0 6 35.50825 37.0 36.0 37.0 33.0 37.0 7 35.5205 37.0 37.0 37.0 35.0 37.0 8 35.47925 37.0 36.0 37.0 33.0 37.0 9 37.10675 39.0 38.0 39.0 34.0 39.0 10-11 37.04225 39.0 38.0 39.0 34.0 39.0 12-13 37.00475 39.0 38.0 39.0 33.5 39.0 14-15 38.360749999999996 41.0 38.5 41.0 34.0 41.0 16-17 38.253875 41.0 38.0 41.0 33.5 41.0 18-19 38.304249999999996 41.0 38.5 41.0 33.5 41.0 20-21 38.275875 41.0 38.0 41.0 34.0 41.0 22-23 38.02875 40.0 38.0 41.0 33.5 41.0 24-25 38.045375 40.0 38.0 41.0 33.5 41.0 26-27 37.974000000000004 40.0 38.0 41.0 33.0 41.0 28-29 37.8005 40.0 38.0 41.0 33.0 41.0 30-31 37.745374999999996 40.0 38.0 41.0 33.0 41.0 32-33 37.598375000000004 40.0 38.0 41.0 32.5 41.0 34-35 37.5165 40.0 38.0 41.0 31.5 41.0 36-37 37.279250000000005 40.0 38.0 41.0 30.5 41.0 38-39 37.122625 40.0 37.5 41.0 30.5 41.0 40-41 37.070750000000004 40.0 37.0 41.0 30.5 41.0 42-43 37.013999999999996 40.0 37.5 41.0 30.5 41.0 44-45 36.835 40.0 37.0 41.0 30.0 41.0 46-47 36.670249999999996 40.0 37.0 41.0 30.0 41.0 48-49 36.486125 40.0 36.5 41.0 30.0 41.0 50-51 36.04675 39.0 36.0 40.5 29.0 41.0 52-53 36.29625 39.0 36.5 40.5 30.0 41.0 54-55 36.57525 40.0 37.0 41.0 30.5 41.0 56-57 36.362375 40.0 36.0 41.0 29.0 41.0 58-59 36.158375 39.0 36.0 41.0 28.5 41.0 60-61 35.939125000000004 39.0 35.5 41.0 28.0 41.0 62-63 35.62375 39.0 35.0 41.0 28.0 41.0 64-65 35.196749999999994 38.0 35.0 40.0 28.0 41.0 66-67 34.785375 37.5 34.5 40.0 27.0 41.0 68-69 34.323625 37.0 34.0 39.5 26.0 41.0 70-71 33.821625 36.0 34.0 39.0 26.0 40.5 72-73 33.34887500000001 36.0 33.5 39.0 26.0 40.0 74-75 32.897375 35.0 33.0 37.0 25.0 39.0 76-77 32.007125 35.0 32.0 37.0 22.5 39.0 78-79 31.686625 35.0 32.0 36.0 21.5 38.5 80-81 31.240125 35.0 32.0 36.0 19.5 37.0 82-83 30.91 35.0 31.0 35.5 19.0 37.0 84-85 30.550625 35.0 31.0 35.0 17.5 36.0 86-87 30.056 34.0 30.5 35.0 9.0 36.0 88-89 29.414375 34.0 29.5 35.0 4.5 36.0 90-91 29.384625 34.0 30.0 35.0 2.0 35.0 92-93 28.968875 34.0 29.0 35.0 2.0 35.0 94-95 28.72025 34.0 29.5 35.0 2.0 35.0 96-97 27.769875 33.5 28.0 35.0 2.0 35.0 98-99 27.319 34.0 27.0 35.0 2.0 35.0 100-101 25.884124999999997 32.0 22.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 2.0 4 7.0 5 7.0 6 5.0 7 10.0 8 8.0 9 8.0 10 13.0 11 7.0 12 10.0 13 10.0 14 14.0 15 15.0 16 11.0 17 12.0 18 15.0 19 23.0 20 14.0 21 21.0 22 28.0 23 23.0 24 28.0 25 19.0 26 38.0 27 40.0 28 63.0 29 54.0 30 58.0 31 97.0 32 123.0 33 144.0 34 187.0 35 289.0 36 454.0 37 917.0 38 1039.0 39 154.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.35735735735736 19.46946946946947 13.363363363363364 34.80980980980981 2 24.474474474474476 25.375375375375377 33.033033033033036 17.117117117117118 3 20.445445445445447 29.154154154154156 29.37937937937938 21.02102102102102 4 22.62262262262262 33.633633633633636 22.22222222222222 21.52152152152152 5 23.64864864864865 37.787787787787785 21.446446446446448 17.117117117117118 6 18.925 40.0 22.175 18.9 7 20.4 20.925 37.625 21.05 8 19.71971971971972 26.776776776776778 28.403403403403406 25.100100100100097 9 21.2 25.924999999999997 30.0 22.875 10-11 22.861430715357677 33.379189594797396 22.661330665332667 21.098049024512257 12-13 23.832770058830892 26.436349981224183 25.973213168106145 23.757666791838776 14-15 21.399949912346607 29.964938642624595 26.296018031555224 22.33909341347358 16-17 22.525341008634715 28.920035039419346 26.479789763483918 22.07483418846202 18-19 23.111555777888945 28.289144572286144 26.675837918959477 21.92346173086543 20-21 23.461730865432717 28.88944472236118 26.313156578289142 21.335667833916958 22-23 23.0 29.7 26.7625 20.5375 24-25 22.125 29.425 26.950000000000003 21.5 26-27 22.540317539692463 29.178647330916363 25.928241030128767 22.352794099262407 28-29 22.56128064032016 28.226613306653327 27.201100550275136 22.011005502751377 30-31 23.1 28.525 26.55 21.825 32-33 22.325 29.25 27.037499999999998 21.3875 34-35 22.1875 28.5875 26.900000000000002 22.325 36-37 22.237499999999997 29.012500000000003 27.0125 21.7375 38-39 22.875 28.325 26.8125 21.987499999999997 40-41 22.348674337168582 29.71485742871436 26.425712856428213 21.510755377688845 42-43 21.81522690336292 28.703587948493563 27.415926990873857 22.06525815726966 44-45 22.125 29.225 27.237499999999997 21.4125 46-47 22.037499999999998 29.012500000000003 26.1125 22.8375 48-49 23.025000000000002 27.224999999999998 26.974999999999998 22.775000000000002 50-51 23.075000000000003 28.4125 26.8375 21.675 52-53 22.48062015503876 28.307076769192296 27.26931732933233 21.94298574643661 54-55 23.111555777888945 28.226613306653327 27.176088044022013 21.48574287143572 56-57 22.30980980980981 28.716216216216218 26.539039039039036 22.434934934934937 58-59 22.486243121560783 28.226613306653327 27.276138069034516 22.011005502751377 60-61 23.025000000000002 28.0625 27.212500000000002 21.7 62-63 23.0125 29.5 25.587500000000002 21.9 64-65 23.1375 27.8375 26.674999999999997 22.35 66-67 22.537499999999998 28.499999999999996 27.237499999999997 21.725 68-69 23.1875 28.4 26.474999999999998 21.9375 70-71 23.4625 28.8875 25.85 21.8 72-73 22.85 28.8625 26.325 21.9625 74-75 23.400000000000002 28.8625 26.337500000000002 21.4 76-77 23.674999999999997 27.9375 26.337500000000002 22.05 78-79 23.962500000000002 28.7 25.9625 21.375 80-81 24.234087782918596 29.048393147430286 25.1219207202701 21.595598349381017 82-83 23.974999999999998 29.375 25.5125 21.1375 84-85 24.5125 28.762500000000003 25.2625 21.462500000000002 86-87 23.724999999999998 29.4375 24.762500000000003 22.075 88-89 24.887500000000003 29.312500000000004 25.0625 20.7375 90-91 24.75 29.125 24.5625 21.5625 92-93 25.1875 28.9125 24.775 21.125 94-95 25.974999999999998 28.349999999999998 24.125 21.55 96-97 25.5375 29.9375 23.724999999999998 20.8 98-99 25.6 29.8875 23.275000000000002 21.2375 100-101 27.9125 29.175 23.35 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 1.5 24 2.5 25 1.5 26 2.0 27 2.5 28 5.5 29 6.5 30 6.5 31 15.0 32 24.0 33 31.0 34 44.5 35 52.0 36 73.5 37 95.5 38 116.5 39 155.5 40 184.5 41 217.0 42 222.0 43 243.5 44 276.5 45 265.5 46 259.5 47 253.0 48 236.0 49 215.5 50 191.0 51 164.0 52 127.0 53 100.0 54 89.0 55 72.5 56 55.0 57 44.5 58 35.5 59 24.5 60 17.5 61 13.5 62 12.5 63 8.5 64 4.5 65 5.5 66 4.5 67 5.0 68 3.5 69 1.5 70 1.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.1 9 0.0 10-11 0.05 12-13 0.13749999999999998 14-15 0.17500000000000002 16-17 0.11249999999999999 18-19 0.05 20-21 0.05 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.05 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.05 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.05 56-57 0.1 58-59 0.05 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0375 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.2125 0.0 0.0 0.0 0.0 56-57 0.36250000000000004 0.0 0.0 0.0 0.0 58-59 0.475 0.0 0.0 0.0 0.0 60-61 0.675 0.0 0.0 0.0 0.0 62-63 0.875 0.0 0.0 0.0 0.0 64-65 1.125 0.0 0.0 0.0 0.0 66-67 1.3624999999999998 0.0 0.0 0.0 0.0 68-69 1.5375 0.0 0.0 0.0 0.0 70-71 1.85 0.0 0.0 0.0 0.0 72-73 2.275 0.0 0.0 0.0 0.0 74-75 2.7375 0.0 0.0 0.0 0.0 76-77 3.5 0.0 0.0 0.0 0.0 78-79 4.2 0.0 0.0 0.0 0.0 80-81 5.0125 0.0 0.0 0.0 0.0 82-83 6.0 0.0 0.0 0.0 0.0 84-85 7.075 0.0 0.0 0.0 0.0 86-87 8.287500000000001 0.0 0.0 0.0 0.0 88-89 9.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra Read 445137 spots for ERR1864428.sra Written 445137 spots for ERR1864428.sra SRR ids: ['ERR1864428.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3m9v6lia ERR1864428.sra spots: 8902740 blocks: [[1, 445137], [445138, 890274], [890275, 1335411], [1335412, 1780548], [1780549, 2225685], [2225686, 2670822], [2670823, 3115959], [3115960, 3561096], [3561097, 4006233], [4006234, 4451370], [4451371, 4896507], [4896508, 5341644], [5341645, 5786781], [5786782, 6231918], [6231919, 6677055], [6677056, 7122192], [7122193, 7567329], [7567330, 8012466], [8012467, 8457603], [8457604, 8902740]] ERR1864428 file size 2127880 ERR1864428 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864428 ERR1864428_1.fastq ERR1864428_2.fastq Input file: ERR1864428_1.fastq Paired file: ERR1864428_2.fastq trimmed: ERR1864428-trimmed-pair1.fastq, ERR1864428-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:34:51 2025 >> started Thu Feb 13 06:34:59 2025 >> done (8.108s) 8902740 read pairs processed; of these: 111846 ( 1.26%) short read pairs filtered out after trimming by size control 149680 ( 1.68%) empty read pairs filtered out after trimming by size control 8641214 (97.06%) read pairs available; of these: 3130885 (36.23%) trimmed read pairs available after processing 5510329 (63.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 99 0.00% 20 138 0.00% 21 185 0.00% 22 215 0.00% 23 276 0.00% 24 359 0.00% 25 449 0.01% 26 494 0.01% 27 543 0.01% 28 680 0.01% 29 810 0.01% 30 902 0.01% 31 1108 0.01% 32 1162 0.01% 33 1356 0.02% 34 1410 0.02% 35 1626 0.02% 36 1771 0.02% 37 1947 0.02% 38 2015 0.02% 39 2254 0.03% 40 2534 0.03% 41 2667 0.03% 42 2878 0.03% 43 3225 0.04% 44 3348 0.04% 45 3659 0.04% 46 3937 0.05% 47 4241 0.05% 48 4700 0.05% 49 5046 0.06% 50 5624 0.07% 51 6091 0.07% 52 6687 0.08% 53 6956 0.08% 54 7435 0.09% 55 8139 0.09% 56 8740 0.10% 57 9877 0.11% 58 10634 0.12% 59 13540 0.16% 60 16487 0.19% 61 17027 0.20% 62 18152 0.21% 63 19501 0.23% 64 20796 0.24% 65 21725 0.25% 66 23193 0.27% 67 24720 0.29% 68 26461 0.31% 69 28616 0.33% 70 30606 0.35% 71 33108 0.38% 72 36052 0.42% 73 38302 0.44% 74 40598 0.47% 75 43135 0.50% 76 45522 0.53% 77 47900 0.55% 78 51174 0.59% 79 54219 0.63% 80 58258 0.67% 81 61166 0.71% 82 65697 0.76% 83 69268 0.80% 84 73593 0.85% 85 78473 0.91% 86 81409 0.94% 87 85009 0.98% 88 85610 0.99% 89 88818 1.03% 90 92760 1.07% 91 97036 1.12% 92 102040 1.18% 93 108609 1.26% 94 115773 1.34% 95 125643 1.45% 96 136351 1.58% 97 151670 1.76% 98 175229 2.03% 99 208424 2.41% 100 292968 3.39% 101 5510329 63.77% 8641214 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=98.97 fanout-score-rank=4 prefix-density=1.08 prefix-fanout=15.3 sequence=TCTTCTTCTTCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=9 fanout-score=239.47 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=22.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=243.57 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=25.2 sequence=AAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGA ERR1864428 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:35:30 Started mapping on | Feb 13 06:35:30 Finished on | Feb 13 06:35:51 Mapping speed, Million of reads per hour | 1481.35 Number of input reads | 8641214 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 8369318 Uniquely mapped reads % | 96.85% Average mapped length | 191.29 Number of splices: Total | 4503581 Number of splices: Annotated (sjdb) | 4426075 Number of splices: GT/AG | 4425937 Number of splices: GC/AG | 66973 Number of splices: AT/AC | 3680 Number of splices: Non-canonical | 6991 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.45 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186445 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 26798 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 99757 99757 99757 N_multimapping 186445 186445 186445 N_noFeature 194867 8255282 255927 N_ambiguous 90478 367 37227 UnstrandedReadsAssigned:8083973 PositiveStrandReadsAssigned:113669 NegativeStrandReadsAssigned:8076164 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=93 echo kmer=89 ERR1864428 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864428-trimmed-pair1.fastq ERR1864428-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,641,214 reads, 8,187,192 reads pseudoaligned [quant] estimated average fragment length: 131.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 982 rounds 52401 ERR1864428.ke.tsv 34699 ERR1864428.se.tsv 87100 total ==> ERR1864428.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1887.17 484 33.0359 Potri.005G024800.1.v4.1 1035 904.171 95 13.534 Potri.004G059700.1.v4.1 961 830.171 7 1.08613 Potri.007G009000.2.v4.1 1416 1285.17 0 0 Potri.003G141000.2.v4.1 2943 2812.17 556 25.4674 Potri.016G087400.1.v4.1 270 142.823 349 314.76 Potri.015G069301.1.v4.1 564 433.21 0 0 Potri.010G195200.1.v4.1 1773 1642.17 22 1.72566 Potri.012G127500.1.v4.1 977 846.171 194 29.5322 ==> ERR1864428.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 225 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 143 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 ERR1864428 completed mapping pipeline successfully