Starting /dee2/code/volunteer_pipeline.sh ERR1864429 current disk space = 3053148614656 free memory = 1579730496 ERR1864429 SRAfilesize 948b7430e6301c930d43fa49cea5ea3b ERR1864429.sra ERR1864429.sra file validated ERR1864429 is paired end ERR1864429 is conventional basespace ERR1864429 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864429_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.85025 34.0 31.0 34.0 28.0 34.0 2 31.54125 34.0 31.0 34.0 28.0 34.0 3 32.261 34.0 31.0 34.0 28.0 34.0 4 35.76 37.0 35.0 37.0 35.0 37.0 5 35.63175 37.0 35.0 37.0 35.0 37.0 6 35.53325 37.0 35.0 37.0 33.0 37.0 7 35.58675 37.0 35.0 37.0 33.0 37.0 8 35.65125 37.0 36.0 37.0 35.0 37.0 9 37.39775 39.0 38.0 39.0 35.0 39.0 10-11 37.36375 39.0 38.0 39.0 35.0 39.0 12-13 37.087125 39.0 37.5 39.0 33.5 39.0 14-15 38.733374999999995 41.0 39.0 41.0 35.0 41.0 16-17 38.638999999999996 41.0 38.5 41.0 34.0 41.0 18-19 38.6235 41.0 39.0 41.0 34.0 41.0 20-21 38.430375 41.0 38.5 41.0 34.0 41.0 22-23 38.500125 41.0 39.0 41.0 34.0 41.0 24-25 38.438625 41.0 38.5 41.0 34.0 41.0 26-27 38.322375 40.0 38.0 41.0 34.0 41.0 28-29 38.173625 40.0 38.0 41.0 34.0 41.0 30-31 38.185249999999996 40.0 38.0 41.0 34.0 41.0 32-33 38.064750000000004 40.0 38.0 41.0 33.0 41.0 34-35 37.85850000000001 40.0 38.0 41.0 33.0 41.0 36-37 37.836 40.0 38.0 41.0 33.0 41.0 38-39 37.786500000000004 40.0 38.0 41.0 33.0 41.0 40-41 37.6235 40.0 38.0 41.0 32.5 41.0 42-43 37.417125 40.0 37.5 41.0 32.0 41.0 44-45 37.325 40.0 37.0 41.0 32.0 41.0 46-47 37.480125 40.0 38.0 41.0 32.5 41.0 48-49 37.397625000000005 40.0 37.0 41.0 32.5 41.0 50-51 37.2825 40.0 37.0 41.0 32.0 41.0 52-53 37.172875000000005 40.0 37.0 41.0 32.0 41.0 54-55 36.82525 40.0 36.5 41.0 30.5 41.0 56-57 36.649874999999994 39.5 36.0 41.0 30.5 41.0 58-59 36.39925 39.0 36.0 41.0 30.5 41.0 60-61 36.176249999999996 39.0 35.0 40.5 30.0 41.0 62-63 35.77675 38.5 35.0 40.0 28.5 41.0 64-65 35.37925 38.0 35.0 40.0 28.0 41.0 66-67 35.132 37.5 34.0 40.0 28.0 41.0 68-69 34.7115 37.0 34.0 39.5 28.0 41.0 70-71 34.3665 36.0 34.0 39.0 28.0 40.5 72-73 33.954499999999996 36.0 34.0 38.5 27.5 40.0 74-75 33.403999999999996 35.0 33.5 37.5 26.0 39.0 76-77 32.26975 34.5 31.5 36.0 25.5 39.0 78-79 32.510374999999996 35.0 32.0 36.5 26.0 38.5 80-81 32.356375 35.0 33.0 36.0 26.0 37.0 82-83 32.014375 35.0 32.5 35.5 25.5 37.0 84-85 31.778875 35.0 32.0 35.0 25.0 36.5 86-87 31.532125 35.0 32.0 35.0 25.0 36.0 88-89 31.3455 34.0 32.0 35.0 25.0 36.0 90-91 30.994374999999998 34.0 32.0 35.0 24.0 35.0 92-93 30.644750000000002 34.0 31.0 35.0 21.5 35.0 94-95 30.32575 34.0 31.0 35.0 19.0 35.0 96-97 30.047 34.0 31.0 35.0 13.5 35.0 98-99 29.739125 34.0 31.0 35.0 2.0 35.0 100-101 28.96425 33.5 30.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 9.0 4 6.0 5 4.0 6 8.0 7 3.0 8 3.0 9 7.0 10 5.0 11 12.0 12 12.0 13 10.0 14 11.0 15 7.0 16 11.0 17 6.0 18 8.0 19 7.0 20 7.0 21 12.0 22 19.0 23 16.0 24 21.0 25 19.0 26 29.0 27 40.0 28 37.0 29 46.0 30 65.0 31 70.0 32 86.0 33 133.0 34 164.0 35 277.0 36 474.0 37 1011.0 38 1204.0 39 115.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.68421052631579 6.5 7.421052631578948 48.39473684210526 2 25.275 8.5 34.050000000000004 32.175 3 23.78094523630908 11.352838209552388 22.88072018004501 41.98549637409352 4 27.375 20.075000000000003 20.599999999999998 31.95 5 27.7569392348087 24.381095273818453 24.63115778944736 23.23080770192548 6 20.150000000000002 30.475 27.55 21.825 7 16.925 22.35 42.025 18.7 8 17.224999999999998 24.15 35.4 23.225 9 16.950000000000003 22.175 38.4 22.475 10-11 19.775000000000002 31.7 27.975 20.549999999999997 12-13 21.325 25.55 29.075 24.05 14-15 20.325 27.5125 29.575000000000003 22.5875 16-17 20.5625 27.6875 28.287499999999998 23.4625 18-19 21.875 27.487499999999997 27.5625 23.075000000000003 20-21 20.549999999999997 27.150000000000002 28.3375 23.962500000000002 22-23 21.0125 28.025 27.8625 23.1 24-25 20.9875 27.1 27.6125 24.3 26-27 20.724999999999998 27.2625 27.675 24.337500000000002 28-29 21.4375 26.5875 28.249999999999996 23.724999999999998 30-31 20.4125 27.762500000000003 27.1375 24.6875 32-33 21.512500000000003 26.35 28.225 23.9125 34-35 22.162499999999998 27.325 28.037499999999998 22.475 36-37 21.875 26.325 28.050000000000004 23.75 38-39 21.6 27.675 27.0125 23.7125 40-41 21.8 27.425 27.075 23.7 42-43 21.224999999999998 27.200000000000003 27.750000000000004 23.825 44-45 21.1875 27.700000000000003 27.05 24.0625 46-47 21.725 27.1 27.125 24.05 48-49 20.925 27.325 28.000000000000004 23.75 50-51 22.1 27.025 27.05 23.825 52-53 21.852731591448933 27.94099262407801 27.403425428178522 22.802850356294538 54-55 20.925 27.1625 27.8375 24.075 56-57 21.65 26.7625 28.487499999999997 23.1 58-59 22.9625 26.55 27.55 22.9375 60-61 21.9375 27.5625 26.974999999999998 23.525 62-63 21.075 26.787499999999998 28.3125 23.825 64-65 21.715214401800225 27.028378547318415 27.490936367045883 23.76547068383548 66-67 22.26528316039505 27.240905113139142 27.365920740092513 23.1278909863733 68-69 21.380345086271568 27.00675168792198 28.319579894973746 23.293323330832706 70-71 21.45268158519815 26.978372296537067 27.353419177397175 24.21552694086761 72-73 22.400000000000002 27.3875 26.9625 23.25 74-75 21.61520190023753 26.828353544193025 27.428428553569194 24.128016002000248 76-77 21.5375 25.974999999999998 28.225 24.2625 78-79 22.3875 27.224999999999998 27.187499999999996 23.200000000000003 80-81 21.1125 27.900000000000002 27.0 23.9875 82-83 21.9 27.762500000000003 27.2625 23.075000000000003 84-85 21.675 26.55 27.900000000000002 23.875 86-87 21.587500000000002 26.387500000000003 28.15 23.875 88-89 22.3625 27.775 26.55 23.3125 90-91 22.650000000000002 27.462500000000002 26.200000000000003 23.6875 92-93 21.965245655706962 27.640955119389925 27.128391048881113 23.265408176022003 94-95 23.1125 27.025 26.974999999999998 22.8875 96-97 21.275 27.9375 26.8625 23.925 98-99 21.6125 27.4125 27.0 23.974999999999998 100-101 21.825 27.275 26.775 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 3.0 29 6.0 30 9.5 31 10.5 32 12.5 33 21.5 34 35.0 35 47.0 36 63.5 37 82.0 38 94.5 39 121.0 40 154.5 41 182.5 42 205.0 43 229.5 44 255.0 45 271.0 46 302.0 47 287.5 48 239.0 49 225.0 50 213.5 51 178.0 52 151.0 53 135.5 54 103.0 55 77.5 56 64.0 57 55.0 58 40.0 59 28.0 60 23.5 61 20.5 62 15.0 63 11.0 64 9.0 65 5.0 66 2.5 67 0.0 68 1.5 69 2.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0125 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4979633401222 96.72500000000001 2 1.2729124236252547 2.5 3 0.20366598778004072 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02545824847250509 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.7125 0.0 0.0 0.0 0.0 80-81 0.8625 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.3875 0.0 0.0 0.0 0.0 86-87 1.65 0.0 0.0 0.0 0.0 88-89 1.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGGTG 15 0.00998312 47.46875 70-71 >>END_MODULE ERR1864429 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864429_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23625 34.0 31.0 34.0 31.0 34.0 2 32.45825 34.0 31.0 34.0 31.0 34.0 3 32.4405 34.0 31.0 34.0 31.0 34.0 4 35.7775 37.0 37.0 37.0 35.0 37.0 5 35.82725 37.0 37.0 37.0 35.0 37.0 6 35.8825 37.0 37.0 37.0 35.0 37.0 7 35.816 37.0 37.0 37.0 35.0 37.0 8 35.79575 37.0 37.0 37.0 35.0 37.0 9 37.50225 39.0 38.0 39.0 35.0 39.0 10-11 37.414875 39.0 38.0 39.0 35.0 39.0 12-13 37.362625 39.0 38.0 39.0 34.5 39.0 14-15 38.673874999999995 41.0 39.0 41.0 34.5 41.0 16-17 38.70075 41.0 39.0 41.0 34.0 41.0 18-19 38.680375 41.0 38.5 41.0 34.0 41.0 20-21 38.5615 40.5 38.5 41.0 34.0 41.0 22-23 38.658249999999995 40.5 39.0 41.0 34.5 41.0 24-25 38.32425 40.0 38.0 41.0 33.5 41.0 26-27 38.235125 40.0 38.0 41.0 34.0 41.0 28-29 38.11225 40.0 38.0 41.0 33.5 41.0 30-31 38.05225 40.0 38.0 41.0 33.5 41.0 32-33 37.903999999999996 40.0 38.0 41.0 33.0 41.0 34-35 37.99325 40.0 38.0 41.0 33.5 41.0 36-37 37.946625 40.0 38.0 41.0 33.0 41.0 38-39 37.822 40.0 38.0 41.0 33.0 41.0 40-41 37.689875 40.0 38.0 41.0 32.5 41.0 42-43 37.458125 40.0 38.0 41.0 32.0 41.0 44-45 37.269125 40.0 37.0 41.0 31.5 41.0 46-47 37.014125 40.0 37.0 41.0 31.0 41.0 48-49 36.952749999999995 40.0 37.0 41.0 31.0 41.0 50-51 36.6575 39.5 36.5 40.5 30.5 41.0 52-53 36.799625 39.5 37.0 40.5 31.0 41.0 54-55 36.82825 40.0 37.0 41.0 30.5 41.0 56-57 36.900875 40.0 37.0 41.0 31.0 41.0 58-59 36.709875 39.5 36.0 41.0 31.0 41.0 60-61 36.205625 39.0 35.0 41.0 29.0 41.0 62-63 36.06625 39.0 35.0 41.0 29.0 41.0 64-65 35.753874999999994 38.0 35.0 40.0 29.0 41.0 66-67 35.43225 37.5 35.0 40.0 29.0 41.0 68-69 34.93962500000001 37.0 34.5 39.5 28.5 41.0 70-71 34.505875 36.5 34.0 39.0 28.0 41.0 72-73 34.1075 36.0 34.0 38.5 28.0 40.0 74-75 33.455 35.0 34.0 37.0 27.0 39.0 76-77 33.10725 35.0 34.0 37.0 26.5 39.0 78-79 32.60275 35.0 33.0 36.5 26.0 38.0 80-81 32.250375000000005 35.0 33.0 36.0 26.0 37.0 82-83 31.672125 35.0 32.0 35.5 24.5 37.0 84-85 31.574625 35.0 32.0 35.0 24.5 36.0 86-87 31.4035 35.0 32.0 35.0 24.0 36.0 88-89 31.044125 35.0 32.0 35.0 22.0 36.0 90-91 30.802625 34.0 31.5 35.0 20.0 35.0 92-93 30.672375000000002 34.0 31.5 35.0 20.0 35.0 94-95 30.400750000000002 34.0 31.0 35.0 18.5 35.0 96-97 30.121125 34.0 31.0 35.0 17.5 35.0 98-99 29.695 34.0 31.0 35.0 2.0 35.0 100-101 28.686625 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 6.0 5 5.0 6 4.0 7 10.0 8 4.0 9 7.0 10 12.0 11 13.0 12 9.0 13 12.0 14 10.0 15 8.0 16 7.0 17 15.0 18 7.0 19 15.0 20 9.0 21 12.0 22 15.0 23 22.0 24 22.0 25 24.0 26 36.0 27 44.0 28 35.0 29 44.0 30 53.0 31 67.0 32 85.0 33 128.0 34 191.0 35 250.0 36 496.0 37 997.0 38 1156.0 39 159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.449999999999996 18.35 14.374999999999998 38.824999999999996 2 25.6 24.9 33.45 16.05 3 20.45 28.299999999999997 29.4 21.85 4 22.725 33.6 23.200000000000003 20.474999999999998 5 24.95 33.7 23.625 17.724999999999998 6 19.725 39.2 23.200000000000003 17.875 7 20.825 21.325 37.85 20.0 8 21.2 24.7 28.975 25.124999999999996 9 23.150000000000002 22.575 31.15 23.125 10-11 23.674999999999997 30.7875 24.75 20.7875 12-13 24.6125 25.4875 26.5625 23.3375 14-15 22.8375 28.7375 26.700000000000003 21.725 16-17 23.674999999999997 28.799999999999997 26.724999999999998 20.8 18-19 23.6375 29.099999999999998 26.174999999999997 21.087500000000002 20-21 23.7875 28.3375 26.55 21.325 22-23 24.2 28.050000000000004 26.450000000000003 21.3 24-25 22.900000000000002 27.787499999999998 27.4125 21.9 26-27 23.9 27.525 27.4125 21.1625 28-29 23.400000000000002 28.075 26.9125 21.6125 30-31 23.4625 27.037499999999998 27.275 22.225 32-33 24.575 26.55 27.650000000000002 21.224999999999998 34-35 24.0 28.825 26.5375 20.6375 36-37 23.724999999999998 27.875 26.724999999999998 21.675 38-39 23.799999999999997 27.8125 26.2625 22.125 40-41 23.125 28.0875 27.0625 21.725 42-43 22.4625 28.1875 28.1625 21.1875 44-45 23.7375 27.9125 26.325 22.025 46-47 22.650000000000002 29.099999999999998 26.325 21.925 48-49 23.5375 28.249999999999996 26.237500000000004 21.975 50-51 23.7875 28.7375 25.15 22.325 52-53 23.3875 29.049999999999997 26.2875 21.275 54-55 23.575 27.9375 25.775 22.7125 56-57 23.9875 27.150000000000002 27.250000000000004 21.6125 58-59 23.3625 27.625 28.262500000000003 20.75 60-61 23.724999999999998 28.6375 26.437500000000004 21.2 62-63 24.025 27.35 26.75 21.875 64-65 22.9875 27.85 27.05 22.112499999999997 66-67 22.8875 28.287499999999998 26.8125 22.0125 68-69 23.1375 27.8875 26.9625 22.0125 70-71 24.3 27.6 26.387500000000003 21.712500000000002 72-73 23.2125 28.3125 27.125 21.349999999999998 74-75 24.0375 27.8125 26.650000000000002 21.5 76-77 23.9125 27.1 27.6 21.3875 78-79 24.1875 27.3875 26.737499999999997 21.6875 80-81 23.6125 29.075 25.937500000000004 21.375 82-83 24.6625 28.425 26.137500000000003 20.775 84-85 24.8625 28.4375 25.974999999999998 20.724999999999998 86-87 24.5 27.375 26.6625 21.462500000000002 88-89 24.3625 27.6375 26.637499999999996 21.3625 90-91 23.875 28.95 26.525 20.65 92-93 25.0125 27.5125 26.375 21.099999999999998 94-95 24.224999999999998 28.462500000000002 26.224999999999998 21.087500000000002 96-97 24.9125 29.275000000000002 24.8 21.0125 98-99 24.887500000000003 28.125 26.775 20.2125 100-101 25.112499999999997 27.9125 25.5125 21.462500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.0 27 2.0 28 1.5 29 3.5 30 9.0 31 13.5 32 15.0 33 23.0 34 28.5 35 42.5 36 73.5 37 88.5 38 104.5 39 139.0 40 180.5 41 205.5 42 228.5 43 269.5 44 296.0 45 278.0 46 258.5 47 270.0 48 258.5 49 211.5 50 171.5 51 150.5 52 129.5 53 111.5 54 103.0 55 87.0 56 60.0 57 45.5 58 37.0 59 26.5 60 17.5 61 12.5 62 10.5 63 9.0 64 8.0 65 4.5 66 2.5 67 2.0 68 2.0 69 2.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.6 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.8875 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.4375 0.0 0.0 0.0 0.0 86-87 1.725 0.0 0.0 0.0 0.0 88-89 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096354 spots for ERR1864429.sra Written 1096354 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra Read 1096337 spots for ERR1864429.sra Written 1096337 spots for ERR1864429.sra SRR ids: ['ERR1864429.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hbnadsz3 ERR1864429.sra spots: 21926757 blocks: [[1, 1096337], [1096338, 2192674], [2192675, 3289011], [3289012, 4385348], [4385349, 5481685], [5481686, 6578022], [6578023, 7674359], [7674360, 8770696], [8770697, 9867033], [9867034, 10963370], [10963371, 12059707], [12059708, 13156044], [13156045, 14252381], [14252382, 15348718], [15348719, 16445055], [16445056, 17541392], [17541393, 18637729], [18637730, 19734066], [19734067, 20830403], [20830404, 21926757]] ERR1864429 file size 5267273 ERR1864429 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864429 ERR1864429_1.fastq ERR1864429_2.fastq Input file: ERR1864429_1.fastq Paired file: ERR1864429_2.fastq trimmed: ERR1864429-trimmed-pair1.fastq, ERR1864429-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:38:06 2025 >> started Thu Feb 13 06:38:26 2025 >> done (19.932s) 21926757 read pairs processed; of these: 293192 ( 1.34%) short read pairs filtered out after trimming by size control 327051 ( 1.49%) empty read pairs filtered out after trimming by size control 21306514 (97.17%) read pairs available; of these: 5438609 (25.53%) trimmed read pairs available after processing 15867905 (74.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 130 0.00% 19 303 0.00% 20 495 0.00% 21 657 0.00% 22 835 0.00% 23 1052 0.00% 24 1158 0.01% 25 1491 0.01% 26 1815 0.01% 27 2055 0.01% 28 2380 0.01% 29 2722 0.01% 30 3155 0.01% 31 3571 0.02% 32 3967 0.02% 33 4398 0.02% 34 4865 0.02% 35 5281 0.02% 36 5731 0.03% 37 6299 0.03% 38 6856 0.03% 39 7276 0.03% 40 7886 0.04% 41 8420 0.04% 42 8832 0.04% 43 9414 0.04% 44 9765 0.05% 45 10564 0.05% 46 11203 0.05% 47 11514 0.05% 48 12101 0.06% 49 12737 0.06% 50 13450 0.06% 51 14014 0.07% 52 14897 0.07% 53 15455 0.07% 54 16190 0.08% 55 17500 0.08% 56 18256 0.09% 57 19643 0.09% 58 20660 0.10% 59 25314 0.12% 60 29323 0.14% 61 30384 0.14% 62 31620 0.15% 63 32701 0.15% 64 34333 0.16% 65 35634 0.17% 66 37494 0.18% 67 38564 0.18% 68 41011 0.19% 69 42766 0.20% 70 45026 0.21% 71 47215 0.22% 72 49017 0.23% 73 52115 0.24% 74 53668 0.25% 75 56443 0.26% 76 57598 0.27% 77 60596 0.28% 78 64599 0.30% 79 68695 0.32% 80 72617 0.34% 81 76361 0.36% 82 80728 0.38% 83 84735 0.40% 84 90407 0.42% 85 96443 0.45% 86 102581 0.48% 87 107961 0.51% 88 110997 0.52% 89 117714 0.55% 90 128998 0.61% 91 141722 0.67% 92 155907 0.73% 93 173638 0.81% 94 193491 0.91% 95 223293 1.05% 96 260806 1.22% 97 315955 1.48% 98 400938 1.88% 99 529985 2.49% 100 720223 3.38% 101 15867905 74.47% 21306514 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=2.5 sequence=GCCTCAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=65.16 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.2 sequence=CTCTCCATTCTGATATAGCCGCTCTCTCCCCAGCTCTTGCCCCATGAGTTCCTCACAATCCAGTAATCTTTACCCTTTTCAGTTCCGTAACCCACGGCAGCAACACCATGGTCCAGACTTGTCCCACATTCTCCAGTAAATACACCCGAATTATATAACTGGAAATTTCTGCCACCACCTTCAATTGCAACACTCACTGGCTGATTTGCCACTGCCTTTTTCAATGCCGTCTCATCATTTTCAGGAACATCTTCATAAGAATCGATTGAAACAACTTTGGCATTTTTCCTGTACGTGTCACATCTACCATCACGACCAAGGTAGGGATAGTCATCTTCAGTGTCAATGCCACCATT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.50 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=167.18 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.9 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864429 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:38:57 Started mapping on | Feb 13 06:38:57 Finished on | Feb 13 06:39:43 Mapping speed, Million of reads per hour | 1667.47 Number of input reads | 21306514 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 20690030 Uniquely mapped reads % | 97.11% Average mapped length | 195.00 Number of splices: Total | 12914084 Number of splices: Annotated (sjdb) | 12698357 Number of splices: GT/AG | 12691154 Number of splices: GC/AG | 190069 Number of splices: AT/AC | 9159 Number of splices: Non-canonical | 23702 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.80 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494385 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 41467 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 143463 143463 143463 N_multimapping 494385 494385 494385 N_noFeature 552514 20421788 670247 N_ambiguous 227386 950 76359 UnstrandedReadsAssigned:19910130 PositiveStrandReadsAssigned:267292 NegativeStrandReadsAssigned:19943424 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864429 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864429-trimmed-pair1.fastq ERR1864429-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,306,514 reads, 20,174,650 reads pseudoaligned [quant] estimated average fragment length: 147.18 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 ERR1864429.ke.tsv 34699 ERR1864429.se.tsv 87100 total ==> ERR1864429.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1871.82 1288 31.0072 Potri.005G024800.1.v4.1 1035 888.82 327 16.5785 Potri.004G059700.1.v4.1 961 814.827 31 1.71438 Potri.007G009000.2.v4.1 1416 1269.82 0 0 Potri.003G141000.2.v4.1 2943 2796.82 1233.05 19.8668 Potri.016G087400.1.v4.1 270 126.711 1021 363.098 Potri.015G069301.1.v4.1 564 417.851 0 0 Potri.010G195200.1.v4.1 1773 1626.82 70 1.93896 Potri.012G127500.1.v4.1 977 830.827 156 8.46107 ==> ERR1864429.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 ERR1864429 completed mapping pipeline successfully