Starting /dee2/code/volunteer_pipeline.sh ERR1864432 current disk space = 3053020741632 free memory = 1441193608 ERR1864432 SRAfilesize 8a975b434e1d63f79fd9637816f9da5e ERR1864432.sra ERR1864432.sra file validated ERR1864432 is paired end ERR1864432 is conventional basespace ERR1864432 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94 34.0 31.0 34.0 30.0 34.0 2 32.0515 34.0 31.0 34.0 30.0 34.0 3 32.3815 34.0 31.0 34.0 30.0 34.0 4 35.77675 37.0 35.0 37.0 35.0 37.0 5 35.5235 37.0 35.0 37.0 33.0 37.0 6 35.5175 37.0 35.0 37.0 33.0 37.0 7 35.503 37.0 35.0 37.0 33.0 37.0 8 35.433 37.0 35.0 37.0 33.0 37.0 9 37.10425 39.0 37.0 39.0 34.0 39.0 10-11 37.125125 39.0 37.0 39.0 34.0 39.0 12-13 37.037375 39.0 37.0 39.0 33.0 39.0 14-15 38.4025 41.0 38.0 41.0 33.5 41.0 16-17 38.3335 40.5 38.0 41.0 33.0 41.0 18-19 38.21725 40.5 38.0 41.0 33.5 41.0 20-21 38.1335 40.0 38.0 41.0 33.5 41.0 22-23 38.005250000000004 40.0 38.0 41.0 33.0 41.0 24-25 37.937875 40.0 38.0 41.0 33.0 41.0 26-27 37.898624999999996 40.0 38.0 41.0 33.0 41.0 28-29 37.753625 40.0 38.0 41.0 33.0 41.0 30-31 37.696125 40.0 38.0 41.0 32.0 41.0 32-33 37.609624999999994 40.0 38.0 41.0 32.5 41.0 34-35 37.431 40.0 38.0 41.0 31.5 41.0 36-37 37.275125 40.0 37.0 41.0 31.5 41.0 38-39 37.044250000000005 40.0 37.0 41.0 30.5 41.0 40-41 36.965875 40.0 37.0 41.0 31.0 41.0 42-43 36.853625 40.0 37.0 41.0 30.5 41.0 44-45 36.842875 39.5 36.5 41.0 30.5 41.0 46-47 36.875375 40.0 37.0 41.0 30.5 41.0 48-49 36.818124999999995 40.0 37.0 41.0 30.5 41.0 50-51 36.57925 40.0 36.0 41.0 30.0 41.0 52-53 36.193875000000006 39.0 36.0 41.0 29.0 41.0 54-55 36.189499999999995 39.0 35.5 41.0 29.0 41.0 56-57 35.94475 39.0 35.0 41.0 28.5 41.0 58-59 35.718125 39.0 35.0 40.0 28.0 41.0 60-61 35.5815 38.5 35.0 40.0 28.0 41.0 62-63 35.118125 38.0 34.0 40.0 28.0 41.0 64-65 34.678625 37.5 34.0 40.0 26.0 41.0 66-67 34.264125 37.0 34.0 39.5 26.0 41.0 68-69 33.8625 36.0 33.0 39.0 26.0 41.0 70-71 33.395375 36.0 33.0 39.0 25.5 40.0 72-73 33.067125000000004 35.0 33.0 38.0 25.5 40.0 74-75 32.603 35.0 32.0 37.0 24.5 39.0 76-77 31.642125 34.0 31.0 36.0 23.5 39.0 78-79 31.828000000000003 35.0 32.0 36.0 24.0 37.5 80-81 31.606875000000002 35.0 32.0 36.0 23.5 37.0 82-83 31.375 35.0 32.0 35.0 23.0 37.0 84-85 31.072125 34.0 31.0 35.0 23.0 36.0 86-87 30.79175 34.0 31.0 35.0 20.5 36.0 88-89 30.43875 34.0 31.0 35.0 19.5 35.5 90-91 30.19925 34.0 31.0 35.0 18.0 35.0 92-93 29.837375 34.0 30.5 35.0 15.0 35.0 94-95 29.649875 34.0 30.0 35.0 11.0 35.0 96-97 29.504125000000002 34.0 30.0 35.0 4.5 35.0 98-99 29.144750000000002 34.0 30.0 35.0 2.0 35.0 100-101 28.346375000000002 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 16.0 4 12.0 5 8.0 6 6.0 7 4.0 8 7.0 9 7.0 10 5.0 11 6.0 12 14.0 13 8.0 14 13.0 15 9.0 16 7.0 17 7.0 18 17.0 19 15.0 20 15.0 21 20.0 22 14.0 23 26.0 24 22.0 25 30.0 26 27.0 27 41.0 28 38.0 29 55.0 30 66.0 31 89.0 32 115.0 33 143.0 34 225.0 35 306.0 36 493.0 37 982.0 38 1014.0 39 92.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.06962663975782 6.584258324924319 8.249243188698284 44.09687184661958 2 26.924999999999997 7.775 31.900000000000002 33.4 3 24.33108277069267 11.577894473618406 22.330582645661416 41.76044011002751 4 29.299999999999997 17.25 21.125 32.324999999999996 5 29.775000000000002 22.425 22.95 24.85 6 23.1 28.15 26.0 22.75 7 18.3 24.425 39.85 17.424999999999997 8 19.925 24.2 34.275 21.6 9 18.725 23.400000000000002 36.0 21.875 10-11 19.7 31.974999999999998 27.9125 20.4125 12-13 21.099999999999998 26.35 30.225 22.325 14-15 20.625 27.537499999999998 29.0875 22.75 16-17 21.637500000000003 26.8375 28.487499999999997 23.0375 18-19 21.875 27.037499999999998 27.1375 23.95 20-21 21.825 27.900000000000002 27.375 22.900000000000002 22-23 21.55 27.8375 28.225 22.3875 24-25 21.6125 26.85 27.474999999999998 24.0625 26-27 21.675 27.525 27.2625 23.5375 28-29 22.037499999999998 27.3375 27.6625 22.9625 30-31 21.224999999999998 27.5875 26.875 24.3125 32-33 21.525 27.8125 27.750000000000004 22.912499999999998 34-35 22.15 26.737499999999997 27.400000000000002 23.7125 36-37 21.925 27.712500000000002 27.125 23.2375 38-39 22.2625 26.875 27.962500000000002 22.900000000000002 40-41 22.325 28.249999999999996 26.3125 23.1125 42-43 21.5625 28.1125 27.762500000000003 22.5625 44-45 22.8375 27.462500000000002 27.325 22.375 46-47 23.2625 27.6875 26.1 22.95 48-49 21.175 28.4125 27.275 23.1375 50-51 21.7 27.675 27.650000000000002 22.975 52-53 21.725 27.3125 28.1125 22.85 54-55 22.037499999999998 27.875 27.037499999999998 23.05 56-57 22.075 27.0625 28.749999999999996 22.112499999999997 58-59 22.037499999999998 26.75 28.1125 23.1 60-61 22.275 26.4125 27.425 23.8875 62-63 21.575 27.025 27.8875 23.5125 64-65 22.325 27.474999999999998 27.1375 23.0625 66-67 21.349999999999998 27.3625 27.4125 23.875 68-69 21.349999999999998 27.625 28.787499999999998 22.237499999999997 70-71 21.75 27.1125 27.750000000000004 23.3875 72-73 22.7375 26.987499999999997 27.650000000000002 22.625 74-75 22.1375 27.200000000000003 27.1375 23.525 76-77 21.912499999999998 27.712500000000002 28.1625 22.2125 78-79 22.7125 26.8375 27.5875 22.8625 80-81 22.075 27.0625 27.700000000000003 23.1625 82-83 22.7 26.825 27.200000000000003 23.275000000000002 84-85 22.45 27.250000000000004 26.924999999999997 23.375 86-87 21.8125 27.525 27.875 22.787499999999998 88-89 21.7375 27.375 27.425 23.4625 90-91 22.2625 27.400000000000002 27.8625 22.475 92-93 21.925 27.537499999999998 27.675 22.8625 94-95 22.625 27.5625 27.175 22.6375 96-97 22.375 27.037499999999998 27.55 23.0375 98-99 21.925 26.737499999999997 28.3375 23.0 100-101 21.987499999999997 27.987499999999997 27.737499999999997 22.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 1.0 26 3.0 27 5.5 28 7.0 29 7.5 30 12.5 31 13.0 32 13.5 33 23.5 34 35.0 35 50.0 36 68.5 37 80.5 38 92.5 39 118.5 40 144.5 41 175.0 42 207.0 43 229.5 44 249.5 45 286.0 46 288.0 47 265.5 48 248.0 49 231.5 50 222.0 51 190.5 52 143.0 53 104.5 54 98.5 55 92.5 56 73.0 57 52.0 58 37.0 59 29.5 60 26.5 61 20.0 62 8.0 63 5.5 64 8.5 65 7.0 66 5.5 67 4.0 68 2.0 69 1.5 70 2.5 71 3.5 72 2.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93724696356276 97.75 2 0.9362348178137652 1.8499999999999999 3 0.10121457489878542 0.3 4 0.025303643724696356 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.8875 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGGGT 15 0.009962372 47.493755 40-41 >>END_MODULE ERR1864432 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11775 34.0 31.0 34.0 30.0 34.0 2 32.1865 34.0 31.0 34.0 30.0 34.0 3 32.2535 34.0 31.0 34.0 30.0 34.0 4 35.61325 37.0 35.0 37.0 33.0 37.0 5 35.50325 37.0 35.0 37.0 33.0 37.0 6 35.4935 37.0 36.0 37.0 33.0 37.0 7 35.46175 37.0 35.0 37.0 33.0 37.0 8 35.35975 37.0 35.0 37.0 33.0 37.0 9 37.01225 39.0 37.0 39.0 33.0 39.0 10-11 37.089749999999995 39.0 37.0 39.0 33.5 39.0 12-13 37.120999999999995 39.0 37.0 39.0 33.5 39.0 14-15 38.445375 41.0 38.0 41.0 34.0 41.0 16-17 38.281375 40.5 38.0 41.0 33.0 41.0 18-19 38.300749999999994 40.0 38.0 41.0 33.5 41.0 20-21 38.329125 40.0 38.0 41.0 34.0 41.0 22-23 38.134 40.0 38.0 41.0 33.0 41.0 24-25 38.161874999999995 40.0 38.0 41.0 33.0 41.0 26-27 37.99575 40.0 38.0 41.0 33.0 41.0 28-29 37.82575 40.0 38.0 41.0 33.0 41.0 30-31 37.7455 40.0 38.0 41.0 32.5 41.0 32-33 37.58625 40.0 38.0 41.0 31.5 41.0 34-35 37.494625 40.0 38.0 41.0 31.0 41.0 36-37 37.349000000000004 40.0 38.0 41.0 31.0 41.0 38-39 37.287125 40.0 37.5 41.0 31.0 41.0 40-41 37.098875 40.0 37.0 41.0 30.0 41.0 42-43 37.020250000000004 40.0 37.0 41.0 30.5 41.0 44-45 36.834875 40.0 37.0 41.0 30.0 41.0 46-47 36.60975 40.0 36.5 41.0 30.0 41.0 48-49 36.395875000000004 39.5 36.0 41.0 29.5 41.0 50-51 36.16675 38.5 35.5 40.5 29.5 41.0 52-53 36.37875 39.0 36.0 40.0 30.0 41.0 54-55 36.629125 40.0 36.5 41.0 30.0 41.0 56-57 36.470124999999996 39.5 36.0 41.0 29.5 41.0 58-59 36.089875 39.0 35.0 41.0 28.5 41.0 60-61 35.840375 39.0 35.0 41.0 28.0 41.0 62-63 35.579625 39.0 35.0 40.5 28.0 41.0 64-65 35.237375 38.0 35.0 40.0 28.0 41.0 66-67 34.8925 37.0 34.5 40.0 28.0 41.0 68-69 34.475625 37.0 34.0 39.0 27.0 41.0 70-71 33.97575 36.0 34.0 39.0 26.0 40.5 72-73 33.46875 36.0 33.5 38.5 26.0 40.0 74-75 32.933125000000004 35.0 33.0 37.0 25.5 39.0 76-77 32.53175 35.0 33.0 37.0 25.5 39.0 78-79 32.105875 35.0 32.5 36.0 24.0 38.0 80-81 31.725875 35.0 32.0 36.0 23.5 37.0 82-83 31.361 35.0 32.0 35.5 21.0 37.0 84-85 30.899625 34.5 31.0 35.0 20.5 36.0 86-87 30.542625 34.0 31.0 35.0 18.0 36.0 88-89 30.2765 34.0 31.0 35.0 18.0 35.5 90-91 30.061625 34.0 31.0 35.0 15.5 35.0 92-93 29.799125 34.0 31.0 35.0 7.0 35.0 94-95 29.55875 34.0 30.0 35.0 3.5 35.0 96-97 29.17575 34.0 30.0 35.0 2.0 35.0 98-99 28.791249999999998 34.0 30.0 35.0 2.0 35.0 100-101 27.79175 33.5 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 7.0 4 3.0 5 5.0 6 6.0 7 6.0 8 7.0 9 9.0 10 10.0 11 10.0 12 5.0 13 11.0 14 19.0 15 10.0 16 13.0 17 15.0 18 11.0 19 13.0 20 19.0 21 24.0 22 17.0 23 24.0 24 26.0 25 32.0 26 37.0 27 44.0 28 53.0 29 51.0 30 59.0 31 91.0 32 102.0 33 145.0 34 181.0 35 272.0 36 493.0 37 953.0 38 1068.0 39 130.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.7 18.175 13.875000000000002 38.25 2 24.3 24.525 32.65 18.525 3 18.925 27.975 30.075000000000003 23.025000000000002 4 23.3 32.525 23.3 20.875 5 25.474999999999998 34.150000000000006 22.525000000000002 17.849999999999998 6 20.724999999999998 37.15 23.3 18.825 7 20.65 20.599999999999998 37.8 20.95 8 20.8 25.25 28.549999999999997 25.4 9 22.175 23.025000000000002 31.7 23.1 10-11 22.875 30.775000000000002 24.6125 21.7375 12-13 23.75 25.6125 26.875 23.7625 14-15 22.3125 27.700000000000003 27.474999999999998 22.5125 16-17 23.425 28.1375 26.0375 22.400000000000002 18-19 22.912499999999998 27.437499999999996 27.1375 22.5125 20-21 22.5875 29.849999999999998 25.825 21.7375 22-23 22.375 27.55 27.325 22.75 24-25 22.3625 28.15 26.637499999999996 22.85 26-27 22.6 28.5625 26.075 22.7625 28-29 23.2875 28.175 26.7625 21.775 30-31 23.05 27.6125 26.6125 22.725 32-33 23.4125 28.3375 25.8125 22.4375 34-35 23.3375 27.3625 27.0125 22.287499999999998 36-37 22.675 27.762500000000003 26.937499999999996 22.625 38-39 22.237499999999997 28.050000000000004 26.974999999999998 22.7375 40-41 23.275000000000002 27.537499999999998 26.950000000000003 22.237499999999997 42-43 22.3 26.437500000000004 28.625 22.6375 44-45 22.0875 28.775000000000002 26.787499999999998 22.35 46-47 23.25 28.787499999999998 26.400000000000002 21.5625 48-49 23.4375 27.375 27.462500000000002 21.725 50-51 22.9625 28.125 26.875 22.037499999999998 52-53 22.7 27.8125 27.0625 22.425 54-55 23.0 27.425 27.737499999999997 21.837500000000002 56-57 22.3 27.525 27.8125 22.3625 58-59 22.675 27.187499999999996 28.375 21.762500000000003 60-61 22.8 27.962500000000002 26.987499999999997 22.25 62-63 23.0875 25.887500000000003 28.875 22.15 64-65 22.6125 27.762500000000003 26.825 22.8 66-67 23.3875 28.499999999999996 26.137500000000003 21.975 68-69 23.5875 27.700000000000003 26.900000000000002 21.8125 70-71 23.45 27.0125 27.0125 22.525000000000002 72-73 23.2625 27.900000000000002 26.424999999999997 22.412499999999998 74-75 22.875 28.375 26.687499999999996 22.0625 76-77 23.175 27.537499999999998 26.075 23.2125 78-79 23.1625 28.012500000000003 27.1 21.725 80-81 23.200000000000003 28.487499999999997 26.3625 21.95 82-83 23.425 28.249999999999996 26.1125 22.2125 84-85 23.400000000000002 27.35 26.987499999999997 22.2625 86-87 22.900000000000002 27.875 26.7125 22.5125 88-89 23.175 27.925 26.7125 22.1875 90-91 23.0 27.9125 27.5625 21.525 92-93 23.825 27.6125 26.5625 22.0 94-95 24.0375 27.474999999999998 26.0125 22.475 96-97 23.4125 28.299999999999997 27.187499999999996 21.099999999999998 98-99 23.9 27.737499999999997 26.5875 21.775 100-101 24.425 28.8625 25.2 21.512500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.5 26 2.0 27 3.0 28 6.0 29 6.5 30 9.0 31 14.0 32 17.0 33 28.0 34 36.5 35 46.5 36 68.0 37 88.5 38 118.0 39 158.5 40 176.0 41 187.0 42 216.0 43 247.5 44 263.5 45 271.0 46 257.5 47 251.0 48 259.5 49 224.0 50 195.5 51 168.0 52 125.0 53 117.5 54 104.0 55 77.0 56 63.5 57 47.0 58 36.5 59 25.0 60 15.5 61 13.5 62 12.5 63 10.0 64 6.5 65 5.0 66 3.0 67 3.0 68 2.5 69 1.0 70 1.5 71 2.0 72 2.0 73 1.0 74 0.5 75 0.5 76 1.0 77 1.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.11249999999999999 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.7250000000000001 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529688 spots for ERR1864432.sra Written 529688 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra Read 529670 spots for ERR1864432.sra Written 529670 spots for ERR1864432.sra SRR ids: ['ERR1864432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y29vnyjh ERR1864432.sra spots: 10593418 blocks: [[1, 529670], [529671, 1059340], [1059341, 1589010], [1589011, 2118680], [2118681, 2648350], [2648351, 3178020], [3178021, 3707690], [3707691, 4237360], [4237361, 4767030], [4767031, 5296700], [5296701, 5826370], [5826371, 6356040], [6356041, 6885710], [6885711, 7415380], [7415381, 7945050], [7945051, 8474720], [8474721, 9004390], [9004391, 9534060], [9534061, 10063730], [10063731, 10593418]] ERR1864432 file size 2533547 ERR1864432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864432 ERR1864432_1.fastq ERR1864432_2.fastq Input file: ERR1864432_1.fastq Paired file: ERR1864432_2.fastq trimmed: ERR1864432-trimmed-pair1.fastq, ERR1864432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:47:39 2025 >> started Thu Feb 13 06:47:48 2025 >> done (9.707s) 10593418 read pairs processed; of these: 148369 ( 1.40%) short read pairs filtered out after trimming by size control 152597 ( 1.44%) empty read pairs filtered out after trimming by size control 10292452 (97.16%) read pairs available; of these: 2535291 (24.63%) trimmed read pairs available after processing 7757161 (75.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 68 0.00% 19 164 0.00% 20 238 0.00% 21 315 0.00% 22 438 0.00% 23 521 0.01% 24 663 0.01% 25 800 0.01% 26 909 0.01% 27 1074 0.01% 28 1183 0.01% 29 1463 0.01% 30 1615 0.02% 31 1802 0.02% 32 2110 0.02% 33 2308 0.02% 34 2617 0.03% 35 2769 0.03% 36 3078 0.03% 37 3385 0.03% 38 3520 0.03% 39 3840 0.04% 40 4028 0.04% 41 4347 0.04% 42 4544 0.04% 43 4920 0.05% 44 5061 0.05% 45 5389 0.05% 46 5503 0.05% 47 5838 0.06% 48 6123 0.06% 49 6540 0.06% 50 6819 0.07% 51 6987 0.07% 52 7432 0.07% 53 7740 0.08% 54 8159 0.08% 55 8574 0.08% 56 8949 0.09% 57 9473 0.09% 58 10150 0.10% 59 12715 0.12% 60 14822 0.14% 61 15092 0.15% 62 15740 0.15% 63 16442 0.16% 64 16913 0.16% 65 17326 0.17% 66 18163 0.18% 67 18811 0.18% 68 19689 0.19% 69 20407 0.20% 70 21333 0.21% 71 22399 0.22% 72 23869 0.23% 73 24242 0.24% 74 25067 0.24% 75 25860 0.25% 76 26309 0.26% 77 27709 0.27% 78 29586 0.29% 79 31247 0.30% 80 33148 0.32% 81 34617 0.34% 82 37249 0.36% 83 38743 0.38% 84 40704 0.40% 85 43101 0.42% 86 45613 0.44% 87 47715 0.46% 88 49262 0.48% 89 52432 0.51% 90 57813 0.56% 91 63598 0.62% 92 70279 0.68% 93 77516 0.75% 94 88467 0.86% 95 103526 1.01% 96 121158 1.18% 97 148395 1.44% 98 191265 1.86% 99 255051 2.48% 100 330442 3.21% 101 7757161 75.37% 10292452 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.3 sequence=AGCTCCCTGGTGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=78.55 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=37.19 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.0 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC ERR1864432 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:48:23 Started mapping on | Feb 13 06:48:23 Finished on | Feb 13 06:48:52 Mapping speed, Million of reads per hour | 1277.68 Number of input reads | 10292452 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 9909546 Uniquely mapped reads % | 96.28% Average mapped length | 195.11 Number of splices: Total | 5980596 Number of splices: Annotated (sjdb) | 5895199 Number of splices: GT/AG | 5874334 Number of splices: GC/AG | 92084 Number of splices: AT/AC | 5607 Number of splices: Non-canonical | 8571 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262500 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 65682 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 133552 133552 133552 N_multimapping 262500 262500 262500 N_noFeature 237860 9802376 281246 N_ambiguous 105577 655 41321 UnstrandedReadsAssigned:9566109 PositiveStrandReadsAssigned:106515 NegativeStrandReadsAssigned:9586979 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864432-trimmed-pair1.fastq ERR1864432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,292,452 reads, 9,757,133 reads pseudoaligned [quant] estimated average fragment length: 154.521 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 ERR1864432.ke.tsv 34699 ERR1864432.se.tsv 87100 total ==> ERR1864432.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1864.48 890 45.0238 Potri.005G024800.1.v4.1 1035 881.479 244 26.1088 Potri.004G059700.1.v4.1 961 807.479 14 1.63533 Potri.007G009000.2.v4.1 1416 1262.48 0 0 Potri.003G141000.2.v4.1 2943 2789.48 339 11.4627 Potri.016G087400.1.v4.1 270 121.267 982 763.801 Potri.015G069301.1.v4.1 564 410.535 0 0 Potri.010G195200.1.v4.1 1773 1619.48 8 0.465934 Potri.012G127500.1.v4.1 977 823.479 90 10.3086 ==> ERR1864432.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 ERR1864432 completed mapping pipeline successfully