Starting /dee2/code/volunteer_pipeline.sh ERR1864433 current disk space = 3052920025088 free memory = 1431050204 ERR1864433 SRAfilesize daad8fc823fbeecd976eae43dece0d85 ERR1864433.sra ERR1864433.sra file validated ERR1864433 is paired end ERR1864433 is conventional basespace ERR1864433 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05425 34.0 31.0 34.0 30.0 34.0 2 32.0775 34.0 31.0 34.0 30.0 34.0 3 32.3515 34.0 31.0 34.0 30.0 34.0 4 35.77625 37.0 35.0 37.0 35.0 37.0 5 35.5285 37.0 35.0 37.0 33.0 37.0 6 35.472 37.0 35.0 37.0 35.0 37.0 7 35.49325 37.0 35.0 37.0 35.0 37.0 8 35.4935 37.0 35.0 37.0 33.0 37.0 9 37.1455 39.0 38.0 39.0 34.0 39.0 10-11 37.02525 39.0 38.0 39.0 34.0 39.0 12-13 37.0045 39.0 37.0 39.0 34.0 39.0 14-15 38.38475 41.0 38.0 41.0 34.0 41.0 16-17 38.28775 41.0 38.0 41.0 33.0 41.0 18-19 38.215500000000006 40.5 38.0 41.0 33.5 41.0 20-21 38.1305 40.0 38.0 41.0 33.5 41.0 22-23 38.080375000000004 40.0 38.0 41.0 33.0 41.0 24-25 38.086124999999996 40.0 38.0 41.0 33.5 41.0 26-27 37.950375 40.0 38.0 41.0 33.0 41.0 28-29 37.85025 40.0 38.0 41.0 33.0 41.0 30-31 37.758875 40.0 38.0 41.0 32.5 41.0 32-33 37.6595 40.0 38.0 41.0 32.0 41.0 34-35 37.602125 40.0 38.0 41.0 32.0 41.0 36-37 37.3685 40.0 38.0 41.0 31.0 41.0 38-39 37.109375 40.0 37.5 41.0 30.5 41.0 40-41 37.073375 40.0 37.0 41.0 30.5 41.0 42-43 37.014125 40.0 37.0 41.0 31.0 41.0 44-45 36.976749999999996 40.0 37.0 41.0 31.0 41.0 46-47 37.055875 40.0 37.0 41.0 31.0 41.0 48-49 36.9805 40.0 37.0 41.0 30.5 41.0 50-51 36.826125000000005 40.0 37.0 41.0 31.0 41.0 52-53 36.41475 40.0 36.0 41.0 29.5 41.0 54-55 36.417125 39.0 36.0 41.0 30.0 41.0 56-57 36.0215 39.0 35.0 41.0 28.5 41.0 58-59 35.86625 39.0 35.0 40.5 28.0 41.0 60-61 35.649375000000006 39.0 35.0 40.0 28.0 41.0 62-63 35.347 38.0 34.5 40.0 28.0 41.0 64-65 34.91375 37.5 34.0 40.0 27.5 41.0 66-67 34.462374999999994 37.0 34.0 39.5 26.5 41.0 68-69 34.015 36.5 34.0 39.0 26.0 40.5 70-71 33.716125000000005 36.0 34.0 39.0 26.0 40.0 72-73 33.384625 35.5 33.0 38.5 26.0 40.0 74-75 32.923874999999995 35.0 33.0 37.0 26.0 39.0 76-77 32.001999999999995 34.5 31.5 36.0 25.0 39.0 78-79 32.148375 35.0 32.0 36.0 25.0 38.5 80-81 31.927124999999997 35.0 32.0 36.0 25.0 37.0 82-83 31.6675 35.0 32.0 35.5 25.0 37.0 84-85 31.433 35.0 32.0 35.0 24.5 36.5 86-87 31.029375 34.0 31.5 35.0 23.0 36.0 88-89 30.769125000000003 34.0 31.0 35.0 22.0 36.0 90-91 30.463375 34.0 31.0 35.0 20.0 35.0 92-93 30.17775 34.0 31.0 35.0 18.5 35.0 94-95 30.0245 34.0 31.0 35.0 18.0 35.0 96-97 29.7725 34.0 31.0 35.0 9.5 35.0 98-99 29.511499999999998 34.0 31.0 35.0 2.0 35.0 100-101 28.79025 33.5 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 23.0 4 8.0 5 6.0 6 4.0 7 6.0 8 1.0 9 9.0 10 8.0 11 3.0 12 13.0 13 12.0 14 8.0 15 10.0 16 8.0 17 14.0 18 17.0 19 14.0 20 12.0 21 10.0 22 12.0 23 21.0 24 19.0 25 27.0 26 19.0 27 38.0 28 39.0 29 43.0 30 68.0 31 99.0 32 116.0 33 135.0 34 173.0 35 263.0 36 491.0 37 1004.0 38 1103.0 39 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.52896725440806 5.894206549118388 7.65743073047859 45.91939546599496 2 26.424999999999997 8.225 32.6 32.75 3 23.861930965482742 11.305652826413207 22.761380690345174 42.07103551775888 4 28.525 18.125 20.525 32.824999999999996 5 29.099999999999998 24.099999999999998 24.15 22.650000000000002 6 22.900000000000002 28.475 25.624999999999996 23.0 7 16.475 23.849999999999998 41.949999999999996 17.724999999999998 8 18.7 23.674999999999997 35.35 22.275 9 17.974999999999998 22.45 37.925 21.65 10-11 20.075000000000003 32.15 27.8625 19.9125 12-13 21.8875 25.887500000000003 29.099999999999998 23.125 14-15 21.675 27.6375 28.65 22.037499999999998 16-17 21.15 26.487500000000004 29.25 23.1125 18-19 20.6875 27.0 28.4 23.9125 20-21 20.75 27.950000000000003 28.1625 23.1375 22-23 21.7 27.712500000000002 27.4125 23.175 24-25 21.4875 27.212500000000002 27.075 24.224999999999998 26-27 20.9875 27.5625 27.987499999999997 23.4625 28-29 21.15 27.987499999999997 27.35 23.5125 30-31 20.825 27.8125 27.250000000000004 24.1125 32-33 20.6375 27.375 28.349999999999998 23.6375 34-35 20.7625 27.1375 28.1 24.0 36-37 21.2625 26.900000000000002 27.8875 23.95 38-39 21.8125 27.075 27.474999999999998 23.6375 40-41 21.1375 28.4 27.525 22.9375 42-43 21.912499999999998 27.250000000000004 27.9125 22.925 44-45 21.45 27.800000000000004 27.35 23.400000000000002 46-47 21.912499999999998 28.0625 26.55 23.474999999999998 48-49 20.6875 27.2625 28.0625 23.9875 50-51 21.475 27.3625 26.900000000000002 24.2625 52-53 21.57769721215152 26.978372296537067 28.003500437554695 23.44043005375672 54-55 21.45 27.3125 27.6875 23.549999999999997 56-57 21.2 27.55 28.212500000000002 23.0375 58-59 20.962500000000002 27.55 27.425 24.0625 60-61 21.5625 26.650000000000002 28.799999999999997 22.9875 62-63 22.25 26.674999999999997 28.1125 22.9625 64-65 21.817954488622153 28.244561140285075 26.981745436359088 22.95573893473368 66-67 21.827728466058257 26.62832854106763 28.391048881110137 23.15289411176397 68-69 20.155038759689923 27.769442360590148 28.257064266066518 23.818454613653415 70-71 21.780445111277817 27.44436109027257 27.38184546136534 23.393348337084273 72-73 22.080520130032507 27.38184546136534 27.769442360590148 22.768192048012004 74-75 21.077634704338042 27.028378547318415 28.753594199274907 23.140392549068633 76-77 21.790223777972244 27.340917614701837 27.3284160520065 23.540442555319416 78-79 21.4125 27.325 28.287499999999998 22.975 80-81 21.675 27.0625 28.425 22.8375 82-83 22.15 26.625 27.6625 23.5625 84-85 22.0125 27.762500000000003 27.224999999999998 23.0 86-87 21.990248781097637 27.55344418052256 28.403550443805475 22.052756594574323 88-89 21.325 28.3375 27.875 22.4625 90-91 21.775 26.6125 27.6875 23.925 92-93 21.3125 26.8625 29.025000000000002 22.8 94-95 21.912499999999998 27.0 28.425 22.662499999999998 96-97 22.275 27.35 26.7125 23.6625 98-99 22.025 27.450000000000003 27.9125 22.6125 100-101 22.190273784223027 27.65345668208526 26.92836604575572 23.22790348793599 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 1.0 26 0.5 27 3.0 28 5.5 29 7.5 30 10.0 31 15.5 32 20.5 33 28.5 34 42.5 35 53.0 36 60.5 37 80.5 38 106.5 39 132.5 40 163.0 41 183.0 42 204.5 43 226.5 44 260.5 45 274.5 46 275.5 47 280.5 48 263.5 49 236.0 50 203.5 51 174.0 52 135.0 53 106.5 54 88.5 55 70.0 56 59.0 57 51.5 58 38.5 59 27.0 60 25.5 61 22.5 62 18.5 63 14.0 64 6.0 65 3.0 66 3.5 67 4.0 68 4.0 69 1.5 70 1.5 71 1.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0125 68-69 0.025 70-71 0.025 72-73 0.025 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06565656565657 98.075 2 0.8838383838383838 1.7500000000000002 3 0.025252525252525252 0.075 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.38749999999999996 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.9624999999999999 0.0 0.0 0.0 0.0 86-87 1.2625 0.0 0.0 0.0 0.0 88-89 1.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864433 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.105 34.0 31.0 34.0 30.0 34.0 2 32.2035 34.0 31.0 34.0 30.0 34.0 3 32.28725 34.0 31.0 34.0 30.0 34.0 4 35.55225 37.0 37.0 37.0 33.0 37.0 5 35.54225 37.0 35.0 37.0 33.0 37.0 6 35.5585 37.0 36.0 37.0 33.0 37.0 7 35.47225 37.0 35.0 37.0 33.0 37.0 8 35.45225 37.0 35.0 37.0 33.0 37.0 9 37.072 39.0 37.0 39.0 33.0 39.0 10-11 37.114625000000004 39.0 37.0 39.0 33.0 39.0 12-13 37.019125 39.0 37.0 39.0 33.5 39.0 14-15 38.430125000000004 41.0 38.0 41.0 34.0 41.0 16-17 38.280249999999995 40.5 38.0 41.0 33.0 41.0 18-19 38.293125 40.0 38.0 41.0 33.5 41.0 20-21 38.262625 40.0 38.0 41.0 33.5 41.0 22-23 38.10625 40.0 38.0 41.0 33.0 41.0 24-25 38.061499999999995 40.0 38.0 41.0 33.0 41.0 26-27 37.842 40.0 38.0 41.0 32.5 41.0 28-29 37.798625 40.0 38.0 41.0 32.5 41.0 30-31 37.678625 40.0 38.0 41.0 32.0 41.0 32-33 37.495625000000004 40.0 38.0 41.0 31.5 41.0 34-35 37.528499999999994 40.0 38.0 41.0 31.5 41.0 36-37 37.428 40.0 38.0 41.0 31.5 41.0 38-39 37.277125 40.0 38.0 41.0 31.0 41.0 40-41 37.128 40.0 37.0 41.0 30.5 41.0 42-43 37.092375 40.0 37.0 41.0 31.0 41.0 44-45 36.846625 40.0 37.0 41.0 30.0 41.0 46-47 36.663250000000005 40.0 36.5 41.0 30.0 41.0 48-49 36.465 39.0 36.0 41.0 30.0 41.0 50-51 36.25 39.5 36.5 40.5 30.0 41.0 52-53 36.440749999999994 39.0 36.5 40.5 30.0 41.0 54-55 36.689750000000004 40.0 37.0 41.0 30.0 41.0 56-57 36.577875 39.5 36.0 41.0 30.0 41.0 58-59 36.08825 39.0 35.0 41.0 29.0 41.0 60-61 35.795125 39.0 35.0 41.0 28.0 41.0 62-63 35.603 38.5 35.0 40.5 28.0 41.0 64-65 35.27525 38.0 35.0 40.0 28.0 41.0 66-67 34.8795 37.0 34.0 40.0 27.5 41.0 68-69 34.404625 36.5 34.0 39.0 27.0 41.0 70-71 33.907875000000004 36.0 34.0 39.0 26.0 40.5 72-73 33.458625 36.0 33.0 38.5 26.0 40.0 74-75 33.033874999999995 35.0 33.0 37.0 25.5 39.0 76-77 32.583749999999995 35.0 33.0 37.0 26.0 39.0 78-79 32.197 35.0 33.0 36.0 25.0 38.5 80-81 31.717 35.0 32.0 36.0 23.5 37.0 82-83 31.367874999999998 35.0 32.0 35.5 22.5 37.0 84-85 30.84675 35.0 31.5 35.0 19.5 36.5 86-87 30.5265 34.0 31.0 35.0 18.5 36.0 88-89 30.28125 34.0 31.0 35.0 18.0 36.0 90-91 29.926125 34.0 30.5 35.0 13.0 35.0 92-93 29.794125 34.0 30.5 35.0 8.5 35.0 94-95 29.531374999999997 34.0 30.5 35.0 4.5 35.0 96-97 29.069375 34.0 30.0 35.0 2.0 35.0 98-99 28.575375 34.0 29.0 35.0 2.0 35.0 100-101 27.606625 33.5 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 4.0 4 8.0 5 6.0 6 7.0 7 10.0 8 8.0 9 8.0 10 3.0 11 11.0 12 10.0 13 10.0 14 10.0 15 7.0 16 12.0 17 21.0 18 15.0 19 17.0 20 13.0 21 15.0 22 23.0 23 23.0 24 22.0 25 27.0 26 43.0 27 33.0 28 53.0 29 47.0 30 71.0 31 76.0 32 108.0 33 137.0 34 192.0 35 298.0 36 510.0 37 916.0 38 1074.0 39 129.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.0 19.725 14.7 38.574999999999996 2 25.8 23.95 32.775 17.474999999999998 3 19.05 28.599999999999998 29.625 22.725 4 21.45 32.275 24.349999999999998 21.925 5 25.05 34.125 22.5 18.325 6 19.75 37.95 23.875 18.425 7 20.125 19.650000000000002 37.6 22.625 8 20.775 25.650000000000002 28.599999999999998 24.975 9 21.175 25.1 29.625 24.099999999999998 10-11 22.55 31.4625 24.087500000000002 21.9 12-13 23.6875 25.2125 26.724999999999998 24.375 14-15 22.0125 28.599999999999998 27.037499999999998 22.35 16-17 23.474999999999998 27.6875 26.900000000000002 21.9375 18-19 23.075000000000003 28.975 26.125 21.825 20-21 22.7125 29.2375 26.9625 21.087500000000002 22-23 21.5375 28.0875 27.6875 22.6875 24-25 22.175 27.625 28.499999999999996 21.7 26-27 22.6 28.675 27.1125 21.6125 28-29 22.7 28.375 27.037499999999998 21.8875 30-31 22.5625 27.700000000000003 27.900000000000002 21.837500000000002 32-33 22.75 28.762500000000003 26.474999999999998 22.0125 34-35 23.6125 27.950000000000003 25.9625 22.475 36-37 22.400000000000002 28.275 27.3 22.025 38-39 22.7125 27.925 26.8625 22.5 40-41 23.1375 28.1 26.825 21.9375 42-43 22.6 28.875 26.625 21.9 44-45 22.975 28.3125 27.037499999999998 21.675 46-47 23.0 27.85 27.800000000000004 21.349999999999998 48-49 22.725 27.9375 27.5625 21.775 50-51 23.125 28.000000000000004 26.9125 21.9625 52-53 22.75 27.825 26.8125 22.6125 54-55 22.912499999999998 27.737499999999997 27.212500000000002 22.1375 56-57 23.799999999999997 27.325 27.1375 21.7375 58-59 22.8 27.775 26.974999999999998 22.45 60-61 23.0 27.487499999999997 27.250000000000004 22.2625 62-63 22.7375 27.0625 27.537499999999998 22.662499999999998 64-65 23.375 28.625 26.700000000000003 21.3 66-67 21.95 27.9375 27.5625 22.55 68-69 22.95 28.7375 26.8625 21.45 70-71 24.349999999999998 26.8 27.1625 21.6875 72-73 23.025000000000002 27.1375 27.750000000000004 22.0875 74-75 23.275000000000002 27.5125 27.5625 21.65 76-77 22.7 27.1625 27.625 22.5125 78-79 22.975 27.800000000000004 26.5125 22.7125 80-81 22.9625 27.925 26.737499999999997 22.375 82-83 23.65 28.037499999999998 27.175 21.1375 84-85 23.0875 27.6625 27.650000000000002 21.6 86-87 23.5875 27.6375 27.150000000000002 21.625 88-89 24.212500000000002 27.55 26.825 21.4125 90-91 23.6875 28.225 27.1375 20.95 92-93 23.9375 27.875 26.474999999999998 21.712500000000002 94-95 23.65 28.1 26.724999999999998 21.525 96-97 24.349999999999998 27.962500000000002 26.237500000000004 21.45 98-99 24.5 28.512500000000003 26.525 20.4625 100-101 24.875 27.700000000000003 25.75 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 2.5 27 2.5 28 3.5 29 8.5 30 9.5 31 11.0 32 19.0 33 30.5 34 46.0 35 55.5 36 72.0 37 97.5 38 111.5 39 142.5 40 169.0 41 191.0 42 236.0 43 264.0 44 271.5 45 272.0 46 266.0 47 268.0 48 266.5 49 228.0 50 182.5 51 156.0 52 131.0 53 99.0 54 79.5 55 70.0 56 51.0 57 38.5 58 36.5 59 28.0 60 19.0 61 14.0 62 10.5 63 10.5 64 6.0 65 3.5 66 4.5 67 3.0 68 1.5 69 1.0 70 1.0 71 1.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.38749999999999996 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.9624999999999999 0.0 0.0 0.0 0.0 86-87 1.2125 0.0 0.0 0.0 0.0 88-89 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605664 spots for ERR1864433.sra Written 605664 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra Read 605647 spots for ERR1864433.sra Written 605647 spots for ERR1864433.sra SRR ids: ['ERR1864433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xgfvh33n ERR1864433.sra spots: 12112957 blocks: [[1, 605647], [605648, 1211294], [1211295, 1816941], [1816942, 2422588], [2422589, 3028235], [3028236, 3633882], [3633883, 4239529], [4239530, 4845176], [4845177, 5450823], [5450824, 6056470], [6056471, 6662117], [6662118, 7267764], [7267765, 7873411], [7873412, 8479058], [8479059, 9084705], [9084706, 9690352], [9690353, 10295999], [10296000, 10901646], [10901647, 11507293], [11507294, 12112957]] ERR1864433 file size 2900077 ERR1864433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864433 ERR1864433_1.fastq ERR1864433_2.fastq Input file: ERR1864433_1.fastq Paired file: ERR1864433_2.fastq trimmed: ERR1864433-trimmed-pair1.fastq, ERR1864433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:49:53 2025 >> started Thu Feb 13 06:50:10 2025 >> done (16.495s) 12112957 read pairs processed; of these: 174198 ( 1.44%) short read pairs filtered out after trimming by size control 190851 ( 1.58%) empty read pairs filtered out after trimming by size control 11747908 (96.99%) read pairs available; of these: 2888366 (24.59%) trimmed read pairs available after processing 8859542 (75.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 70 0.00% 19 192 0.00% 20 297 0.00% 21 403 0.00% 22 492 0.00% 23 662 0.01% 24 751 0.01% 25 946 0.01% 26 1068 0.01% 27 1194 0.01% 28 1469 0.01% 29 1574 0.01% 30 1893 0.02% 31 2149 0.02% 32 2453 0.02% 33 2742 0.02% 34 3023 0.03% 35 3262 0.03% 36 3475 0.03% 37 3820 0.03% 38 4100 0.03% 39 4297 0.04% 40 4713 0.04% 41 5019 0.04% 42 5241 0.04% 43 5609 0.05% 44 5870 0.05% 45 6268 0.05% 46 6600 0.06% 47 6882 0.06% 48 7075 0.06% 49 7573 0.06% 50 7723 0.07% 51 8458 0.07% 52 8643 0.07% 53 8931 0.08% 54 9534 0.08% 55 10042 0.09% 56 10478 0.09% 57 11024 0.09% 58 11664 0.10% 59 14613 0.12% 60 17047 0.15% 61 17633 0.15% 62 18226 0.16% 63 19116 0.16% 64 19523 0.17% 65 20410 0.17% 66 21192 0.18% 67 21993 0.19% 68 22538 0.19% 69 23701 0.20% 70 24692 0.21% 71 25778 0.22% 72 27192 0.23% 73 28095 0.24% 74 29082 0.25% 75 29973 0.26% 76 30599 0.26% 77 32363 0.28% 78 34004 0.29% 79 36277 0.31% 80 38272 0.33% 81 39936 0.34% 82 43090 0.37% 83 43732 0.37% 84 46099 0.39% 85 48787 0.42% 86 52080 0.44% 87 54547 0.46% 88 56482 0.48% 89 59703 0.51% 90 65562 0.56% 91 72003 0.61% 92 79672 0.68% 93 88628 0.75% 94 100453 0.86% 95 116414 0.99% 96 137124 1.17% 97 167148 1.42% 98 215149 1.83% 99 287598 2.45% 100 374161 3.18% 101 8859542 75.41% 11747908 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=28 prefix-density=0.21 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=7 fanout-score=309.71 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=31.6 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.20 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=40.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.4 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC ERR1864433 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:50:45 Started mapping on | Feb 13 06:50:45 Finished on | Feb 13 06:51:18 Mapping speed, Million of reads per hour | 1281.59 Number of input reads | 11747908 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 11347673 Uniquely mapped reads % | 96.59% Average mapped length | 195.05 Number of splices: Total | 7007901 Number of splices: Annotated (sjdb) | 6903440 Number of splices: GT/AG | 6888207 Number of splices: GC/AG | 103138 Number of splices: AT/AC | 6713 Number of splices: Non-canonical | 9843 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299251 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 41529 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 116682 116682 116682 N_multimapping 299251 299251 299251 N_noFeature 244065 11224076 293643 N_ambiguous 118083 781 43557 UnstrandedReadsAssigned:10985525 PositiveStrandReadsAssigned:122816 NegativeStrandReadsAssigned:11010473 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864433-trimmed-pair1.fastq ERR1864433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,747,908 reads, 11,182,077 reads pseudoaligned [quant] estimated average fragment length: 157.614 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 ERR1864433.ke.tsv 34699 ERR1864433.se.tsv 87100 total ==> ERR1864433.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1861.39 1144 51.6162 Potri.005G024800.1.v4.1 1035 878.386 340.035 32.5113 Potri.004G059700.1.v4.1 961 804.386 29 3.02782 Potri.007G009000.2.v4.1 1416 1259.39 0 0 Potri.003G141000.2.v4.1 2943 2786.39 465 14.0155 Potri.016G087400.1.v4.1 270 119.52 1324 930.345 Potri.015G069301.1.v4.1 564 407.456 0 0 Potri.010G195200.1.v4.1 1773 1616.39 23 1.19503 Potri.012G127500.1.v4.1 977 820.386 94 9.62291 ==> ERR1864433.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 ERR1864433 completed mapping pipeline successfully