Starting /dee2/code/volunteer_pipeline.sh ERR1864434 current disk space = 3053010403328 free memory = 1475207336 ERR1864434 SRAfilesize 8ff3a0d67b0aed0db8609a6c1972f9f1 ERR1864434.sra ERR1864434.sra file validated ERR1864434 is paired end ERR1864434 is conventional basespace ERR1864434 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.767 34.0 31.0 34.0 30.0 34.0 2 32.0055 34.0 31.0 34.0 30.0 34.0 3 32.30325 34.0 31.0 34.0 30.0 34.0 4 35.72275 37.0 35.0 37.0 35.0 37.0 5 35.48575 37.0 35.0 37.0 33.0 37.0 6 35.48 37.0 35.0 37.0 33.0 37.0 7 35.46725 37.0 35.0 37.0 33.0 37.0 8 35.43025 37.0 35.0 37.0 33.0 37.0 9 37.1905 39.0 38.0 39.0 34.0 39.0 10-11 37.073750000000004 39.0 37.0 39.0 33.5 39.0 12-13 37.02275 39.0 37.5 39.0 33.5 39.0 14-15 38.364625000000004 41.0 38.0 41.0 33.0 41.0 16-17 38.314750000000004 41.0 38.0 41.0 34.0 41.0 18-19 38.18875 41.0 38.0 41.0 33.5 41.0 20-21 38.07475 40.0 38.0 41.0 33.0 41.0 22-23 38.008250000000004 40.0 38.0 41.0 32.5 41.0 24-25 38.00425 40.0 38.0 41.0 33.0 41.0 26-27 37.886125 40.0 38.0 41.0 33.0 41.0 28-29 37.89425 40.0 38.0 41.0 33.0 41.0 30-31 37.7085 40.0 38.0 41.0 32.5 41.0 32-33 37.56162500000001 40.0 38.0 41.0 32.0 41.0 34-35 37.53425 40.0 38.0 41.0 32.0 41.0 36-37 37.350625 40.0 37.5 41.0 31.5 41.0 38-39 37.063874999999996 40.0 37.0 41.0 30.5 41.0 40-41 36.96 40.0 37.0 41.0 31.0 41.0 42-43 36.8815 40.0 37.0 41.0 30.5 41.0 44-45 36.891999999999996 40.0 37.0 41.0 30.5 41.0 46-47 37.029375 40.0 37.0 41.0 31.0 41.0 48-49 36.884375 40.0 37.0 41.0 31.0 41.0 50-51 36.723 40.0 37.0 41.0 30.5 41.0 52-53 36.424499999999995 40.0 36.0 41.0 30.0 41.0 54-55 36.39225 39.0 36.0 41.0 30.0 41.0 56-57 35.9945 39.0 35.0 41.0 28.5 41.0 58-59 35.741625 39.0 35.0 40.5 28.0 41.0 60-61 35.572125 39.0 35.0 40.0 28.0 41.0 62-63 35.168375 38.0 34.5 40.0 28.0 41.0 64-65 34.730125 37.5 34.0 40.0 26.5 41.0 66-67 34.312 37.0 34.0 39.5 26.0 41.0 68-69 34.01625 36.5 34.0 39.0 26.0 40.5 70-71 33.705375000000004 36.0 33.5 39.0 26.0 40.0 72-73 33.225375 35.5 33.0 38.0 25.5 40.0 74-75 32.80975 35.0 33.0 37.0 25.5 39.0 76-77 31.83575 34.5 31.5 36.0 25.0 39.0 78-79 31.97 35.0 32.0 36.0 24.5 37.5 80-81 31.6685 35.0 32.0 36.0 24.0 37.0 82-83 31.43425 35.0 32.0 35.5 23.5 37.0 84-85 31.00225 34.0 31.5 35.0 21.5 36.0 86-87 30.726875 34.0 31.0 35.0 20.5 36.0 88-89 30.44375 34.0 31.0 35.0 19.5 35.5 90-91 30.259875 34.0 31.0 35.0 18.5 35.0 92-93 29.972125 34.0 31.0 35.0 16.5 35.0 94-95 29.763125000000002 34.0 30.0 35.0 9.0 35.0 96-97 29.491625 34.0 30.0 35.0 2.0 35.0 98-99 29.247625 34.0 30.0 35.0 2.0 35.0 100-101 28.48925 33.5 29.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 20.0 4 7.0 5 6.0 6 5.0 7 9.0 8 6.0 9 7.0 10 9.0 11 7.0 12 10.0 13 14.0 14 14.0 15 5.0 16 15.0 17 17.0 18 9.0 19 8.0 20 13.0 21 21.0 22 20.0 23 16.0 24 20.0 25 18.0 26 30.0 27 35.0 28 31.0 29 65.0 30 66.0 31 86.0 32 102.0 33 124.0 34 217.0 35 282.0 36 512.0 37 963.0 38 1083.0 39 99.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.863152559553974 6.969082615306639 8.9204257475925 44.24733907754688 2 27.675 8.225 31.924999999999997 32.175 3 24.681170292573142 10.677669417354338 22.83070767691923 41.81045261315329 4 28.65 17.549999999999997 20.424999999999997 33.375 5 28.15 23.1 24.349999999999998 24.4 6 20.75 29.15 26.174999999999997 23.925 7 17.775 22.95 40.949999999999996 18.325 8 19.05 24.525 33.975 22.45 9 18.15 22.875 37.25 21.725 10-11 20.7875 32.2125 27.8625 19.1375 12-13 21.675 26.437500000000004 29.349999999999998 22.537499999999998 14-15 20.375 27.875 29.575000000000003 22.175 16-17 21.912499999999998 26.3 28.249999999999996 23.5375 18-19 21.825 27.5125 26.737499999999997 23.925 20-21 21.637500000000003 28.1 26.937499999999996 23.325000000000003 22-23 22.112499999999997 27.3875 27.3625 23.1375 24-25 21.8 27.025 26.950000000000003 24.224999999999998 26-27 20.9 27.375 27.224999999999998 24.5 28-29 21.8625 27.55 28.0875 22.5 30-31 21.1875 27.1 27.737499999999997 23.974999999999998 32-33 21.4875 27.275 27.037499999999998 24.2 34-35 22.625 27.4125 26.7625 23.200000000000003 36-37 22.3625 27.625 26.7625 23.25 38-39 21.2375 27.3125 27.55 23.9 40-41 21.762500000000003 27.5875 27.200000000000003 23.45 42-43 21.95 28.0625 27.5625 22.425 44-45 21.7875 26.950000000000003 27.975 23.2875 46-47 21.55 27.6 27.375 23.474999999999998 48-49 21.6875 27.55 28.125 22.6375 50-51 20.7125 27.025 28.0625 24.2 52-53 22.125 27.8125 26.8625 23.200000000000003 54-55 21.1375 27.325 27.150000000000002 24.3875 56-57 21.3875 27.3625 27.762500000000003 23.4875 58-59 21.5625 27.4125 27.85 23.175 60-61 22.55 27.537499999999998 26.887499999999996 23.025000000000002 62-63 21.375 27.712500000000002 27.5625 23.35 64-65 21.517879469867466 27.506876719179797 27.79444861215304 23.1807951987997 66-67 22.1875 27.200000000000003 27.700000000000003 22.912499999999998 68-69 21.905476369092273 26.65666416604151 28.032008002000502 23.40585146286572 70-71 21.25265658207276 27.240905113139142 28.416052006500813 23.090386298287285 72-73 21.565195649456182 27.390923865483185 27.803475434429302 23.24040505063133 74-75 21.965245655706962 27.29091136392049 27.778472309038634 22.96537067133392 76-77 21.665208151018877 27.3284160520065 28.103512939117394 22.90286285785723 78-79 22.0875 27.325 27.925 22.662499999999998 80-81 22.2125 26.775 27.35 23.6625 82-83 21.825 28.050000000000004 27.025 23.1 84-85 22.575 27.962500000000002 26.85 22.6125 86-87 22.4875 25.924999999999997 27.825 23.7625 88-89 22.75 27.5875 26.887499999999996 22.775000000000002 90-91 22.112499999999997 27.537499999999998 25.974999999999998 24.375 92-93 22.125 27.3625 26.687499999999996 23.825 94-95 22.025 28.225 27.0125 22.7375 96-97 21.525 27.35 27.575 23.549999999999997 98-99 22.6 27.1125 27.3625 22.925 100-101 22.412499999999998 27.750000000000004 26.6625 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 1.5 26 2.0 27 3.5 28 6.0 29 8.5 30 11.0 31 11.5 32 15.5 33 24.5 34 33.0 35 40.5 36 59.5 37 77.5 38 94.5 39 119.0 40 149.5 41 197.0 42 210.5 43 221.0 44 250.0 45 262.5 46 275.5 47 281.5 48 257.0 49 232.0 50 213.0 51 181.5 52 158.0 53 120.5 54 94.0 55 81.0 56 62.0 57 51.0 58 44.5 59 33.0 60 25.0 61 22.5 62 17.5 63 14.0 64 10.5 65 8.5 66 4.0 67 2.0 68 1.5 69 0.5 70 2.0 71 2.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.025 70-71 0.0125 72-73 0.0125 74-75 0.0125 76-77 0.0125 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73257287705957 97.375 2 1.1406844106463878 2.25 3 0.12674271229404308 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1625 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.025 0.0 82-83 0.625 0.0 0.0 0.025 0.0 84-85 0.9125 0.0 0.0 0.025 0.0 86-87 1.2 0.0 0.0 0.025 0.0 88-89 1.525 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864434 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09125 34.0 31.0 34.0 30.0 34.0 2 32.1675 34.0 31.0 34.0 30.0 34.0 3 32.2455 34.0 31.0 34.0 30.0 34.0 4 35.53 37.0 35.0 37.0 33.0 37.0 5 35.50925 37.0 35.0 37.0 33.0 37.0 6 35.42925 37.0 35.0 37.0 33.0 37.0 7 35.44525 37.0 35.0 37.0 33.0 37.0 8 35.4265 37.0 35.0 37.0 33.0 37.0 9 37.146 39.0 37.0 39.0 34.0 39.0 10-11 37.100625 39.0 37.5 39.0 33.5 39.0 12-13 37.067875 39.0 37.0 39.0 33.5 39.0 14-15 38.4345 41.0 38.0 41.0 33.5 41.0 16-17 38.358374999999995 41.0 38.0 41.0 33.5 41.0 18-19 38.260999999999996 40.0 38.0 41.0 33.5 41.0 20-21 38.206500000000005 40.0 38.0 41.0 33.5 41.0 22-23 38.24525 40.0 38.0 41.0 34.0 41.0 24-25 38.1025 40.0 38.0 41.0 33.0 41.0 26-27 37.879125 40.0 38.0 41.0 32.5 41.0 28-29 37.837 40.0 38.0 41.0 32.0 41.0 30-31 37.63225 40.0 38.0 41.0 32.0 41.0 32-33 37.598 40.0 38.0 41.0 31.5 41.0 34-35 37.527 40.0 38.0 41.0 31.0 41.0 36-37 37.39775 40.0 38.0 41.0 31.0 41.0 38-39 37.382000000000005 40.0 38.0 41.0 31.0 41.0 40-41 37.27825 40.0 38.0 41.0 31.0 41.0 42-43 37.155 40.0 37.0 41.0 31.0 41.0 44-45 36.94325 40.0 37.0 41.0 30.5 41.0 46-47 36.7125 40.0 36.0 41.0 30.0 41.0 48-49 36.4905 39.5 36.5 41.0 30.0 41.0 50-51 36.368875 39.0 36.0 40.5 30.0 41.0 52-53 36.56525 39.0 37.0 40.5 30.0 41.0 54-55 36.744749999999996 40.0 37.0 41.0 31.0 41.0 56-57 36.70675 40.0 36.0 41.0 30.5 41.0 58-59 36.183125000000004 39.0 36.0 41.0 28.5 41.0 60-61 35.830875 39.0 35.0 41.0 28.0 41.0 62-63 35.749 39.0 35.0 41.0 28.0 41.0 64-65 35.405249999999995 38.0 35.0 40.0 28.0 41.0 66-67 34.986125 37.5 34.5 40.0 28.0 41.0 68-69 34.39325 37.0 34.0 39.0 26.0 41.0 70-71 33.956625 36.0 34.0 39.0 26.0 40.5 72-73 33.475375 36.0 34.0 38.5 26.0 40.0 74-75 33.18925 35.0 33.5 37.0 26.0 39.0 76-77 32.73425 35.0 33.0 37.0 26.0 39.0 78-79 32.344375 35.0 33.0 36.0 25.5 38.0 80-81 31.8535 35.0 32.0 36.0 24.5 37.0 82-83 31.521749999999997 35.0 32.0 35.0 24.0 37.0 84-85 31.08025 35.0 31.5 35.0 21.0 36.0 86-87 30.785874999999997 34.5 31.0 35.0 20.0 36.0 88-89 30.63875 34.0 31.0 35.0 20.0 36.0 90-91 30.343375 34.0 31.0 35.0 18.0 35.0 92-93 30.14125 34.0 31.0 35.0 17.0 35.0 94-95 29.836875 34.0 31.0 35.0 8.5 35.0 96-97 29.383625000000002 34.0 30.0 35.0 2.0 35.0 98-99 29.004375 34.0 30.0 35.0 2.0 35.0 100-101 28.1025 33.5 28.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 4.0 4 5.0 5 6.0 6 4.0 7 6.0 8 13.0 9 3.0 10 7.0 11 16.0 12 9.0 13 18.0 14 8.0 15 8.0 16 13.0 17 26.0 18 7.0 19 13.0 20 19.0 21 19.0 22 24.0 23 19.0 24 25.0 25 20.0 26 31.0 27 34.0 28 44.0 29 64.0 30 59.0 31 88.0 32 105.0 33 123.0 34 180.0 35 264.0 36 473.0 37 973.0 38 1130.0 39 121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.999999999999996 19.475 15.075 36.449999999999996 2 27.224999999999998 24.15 31.65 16.975 3 20.4 27.175 30.775000000000002 21.65 4 22.325 32.425 23.799999999999997 21.45 5 25.35 35.025 23.075000000000003 16.55 6 21.025 37.425000000000004 22.025 19.525000000000002 7 20.8 21.45 36.199999999999996 21.55 8 21.224999999999998 26.625 27.55 24.6 9 21.975 24.025 30.475 23.525 10-11 23.549999999999997 32.2875 22.55 21.6125 12-13 24.45 25.5625 26.187500000000004 23.799999999999997 14-15 22.1 27.975 27.800000000000004 22.125 16-17 23.1 28.725 25.837500000000002 22.3375 18-19 23.6625 28.549999999999997 25.25 22.537499999999998 20-21 22.25 29.65 25.924999999999997 22.175 22-23 22.45 28.599999999999998 26.737499999999997 22.2125 24-25 23.400000000000002 28.0625 26.1 22.4375 26-27 22.6 29.462500000000002 26.6 21.337500000000002 28-29 23.45 28.825 26.6125 21.1125 30-31 22.85 27.9375 27.025 22.1875 32-33 23.7875 28.375 26.174999999999997 21.6625 34-35 23.7125 27.975 26.1 22.2125 36-37 21.95 28.237499999999997 27.375 22.4375 38-39 23.25 27.5875 26.7625 22.400000000000002 40-41 23.5625 27.962500000000002 26.974999999999998 21.5 42-43 23.2125 28.237499999999997 27.037499999999998 21.512500000000003 44-45 23.9875 27.9125 26.35 21.75 46-47 23.474999999999998 28.0625 26.325 22.1375 48-49 22.675 28.0625 28.012500000000003 21.25 50-51 22.7 28.225 26.2125 22.8625 52-53 23.4625 27.4125 27.125 22.0 54-55 23.35 27.55 27.125 21.975 56-57 22.900000000000002 28.299999999999997 27.275 21.525 58-59 23.525 27.6125 27.250000000000004 21.6125 60-61 22.537499999999998 27.825 28.000000000000004 21.637500000000003 62-63 22.75 28.3875 26.700000000000003 22.162499999999998 64-65 23.5375 26.4625 27.287499999999998 22.7125 66-67 22.5 27.800000000000004 27.8125 21.8875 68-69 24.45 26.9625 25.5625 23.025000000000002 70-71 24.6125 26.75 27.287499999999998 21.349999999999998 72-73 23.05 28.4 26.775 21.775 74-75 23.6625 27.375 27.250000000000004 21.712500000000002 76-77 23.1 27.55 26.700000000000003 22.650000000000002 78-79 22.075 27.825 27.175 22.925 80-81 23.4875 27.875 26.7625 21.875 82-83 24.2 26.450000000000003 27.400000000000002 21.95 84-85 22.675 27.800000000000004 28.125 21.4 86-87 23.0625 27.9375 26.7625 22.237499999999997 88-89 24.825 27.150000000000002 26.224999999999998 21.8 90-91 23.849999999999998 27.450000000000003 26.9625 21.7375 92-93 25.2 27.6875 25.474999999999998 21.637500000000003 94-95 24.8 28.8875 25.4625 20.849999999999998 96-97 23.150000000000002 28.6375 26.6 21.6125 98-99 24.825 27.775 26.125 21.275 100-101 24.2 28.1 25.8125 21.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.5 28 3.5 29 4.0 30 7.0 31 12.5 32 23.0 33 31.0 34 35.5 35 45.0 36 63.0 37 89.0 38 117.5 39 144.5 40 164.0 41 197.5 42 220.0 43 230.5 44 268.0 45 279.0 46 280.0 47 279.5 48 260.0 49 235.0 50 193.0 51 148.5 52 121.0 53 98.5 54 89.5 55 86.0 56 62.5 57 48.5 58 39.0 59 28.5 60 24.0 61 17.5 62 11.0 63 8.0 64 6.5 65 5.5 66 4.0 67 2.5 68 1.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 1.5 78 1.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.95 0.0 0.0 0.0 0.0 86-87 1.2625 0.0 0.0 0.0 0.0 88-89 1.6124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662387 spots for ERR1864434.sra Written 662387 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra Read 662369 spots for ERR1864434.sra Written 662369 spots for ERR1864434.sra SRR ids: ['ERR1864434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n8xxve9c ERR1864434.sra spots: 13247398 blocks: [[1, 662369], [662370, 1324738], [1324739, 1987107], [1987108, 2649476], [2649477, 3311845], [3311846, 3974214], [3974215, 4636583], [4636584, 5298952], [5298953, 5961321], [5961322, 6623690], [6623691, 7286059], [7286060, 7948428], [7948429, 8610797], [8610798, 9273166], [9273167, 9935535], [9935536, 10597904], [10597905, 11260273], [11260274, 11922642], [11922643, 12585011], [12585012, 13247398]] ERR1864434 file size 3173716 ERR1864434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864434 ERR1864434_1.fastq ERR1864434_2.fastq Input file: ERR1864434_1.fastq Paired file: ERR1864434_2.fastq trimmed: ERR1864434-trimmed-pair1.fastq, ERR1864434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:44:59 2025 >> started Thu Feb 13 06:45:11 2025 >> done (12.004s) 13247398 read pairs processed; of these: 183459 ( 1.38%) short read pairs filtered out after trimming by size control 193037 ( 1.46%) empty read pairs filtered out after trimming by size control 12870902 (97.16%) read pairs available; of these: 3072945 (23.88%) trimmed read pairs available after processing 9797957 (76.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 79 0.00% 19 197 0.00% 20 303 0.00% 21 403 0.00% 22 527 0.00% 23 632 0.00% 24 779 0.01% 25 896 0.01% 26 1088 0.01% 27 1242 0.01% 28 1420 0.01% 29 1725 0.01% 30 1966 0.02% 31 2213 0.02% 32 2488 0.02% 33 2798 0.02% 34 3044 0.02% 35 3313 0.03% 36 3518 0.03% 37 3874 0.03% 38 4253 0.03% 39 4495 0.03% 40 4805 0.04% 41 5150 0.04% 42 5501 0.04% 43 5911 0.05% 44 6138 0.05% 45 6485 0.05% 46 6846 0.05% 47 6987 0.05% 48 7355 0.06% 49 7701 0.06% 50 8140 0.06% 51 8419 0.07% 52 8857 0.07% 53 9187 0.07% 54 9626 0.07% 55 10170 0.08% 56 10748 0.08% 57 11308 0.09% 58 11978 0.09% 59 15282 0.12% 60 18110 0.14% 61 18367 0.14% 62 18989 0.15% 63 19926 0.15% 64 20625 0.16% 65 21278 0.17% 66 22180 0.17% 67 23050 0.18% 68 23729 0.18% 69 24897 0.19% 70 25700 0.20% 71 27061 0.21% 72 28438 0.22% 73 29190 0.23% 74 30906 0.24% 75 31829 0.25% 76 32137 0.25% 77 33604 0.26% 78 35793 0.28% 79 38079 0.30% 80 40577 0.32% 81 41992 0.33% 82 45255 0.35% 83 46806 0.36% 84 49250 0.38% 85 52492 0.41% 86 55603 0.43% 87 58491 0.45% 88 60258 0.47% 89 63881 0.50% 90 70363 0.55% 91 77841 0.60% 92 86027 0.67% 93 95259 0.74% 94 107555 0.84% 95 124866 0.97% 96 146752 1.14% 97 178812 1.39% 98 229443 1.78% 99 305738 2.38% 100 403949 3.14% 101 9797957 76.12% 12870902 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=295.19 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.8 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=32.96 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.2 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC ERR1864434 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:45:42 Started mapping on | Feb 13 06:45:42 Finished on | Feb 13 06:46:15 Mapping speed, Million of reads per hour | 1404.10 Number of input reads | 12870902 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 12432948 Uniquely mapped reads % | 96.60% Average mapped length | 195.31 Number of splices: Total | 7540204 Number of splices: Annotated (sjdb) | 7432436 Number of splices: GT/AG | 7406466 Number of splices: GC/AG | 115906 Number of splices: AT/AC | 6958 Number of splices: Non-canonical | 10874 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.54 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328151 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 44187 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 126389 126389 126389 N_multimapping 328151 328151 328151 N_noFeature 270193 12278509 348480 N_ambiguous 127101 958 50223 UnstrandedReadsAssigned:12035654 PositiveStrandReadsAssigned:153481 NegativeStrandReadsAssigned:12034245 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864434-trimmed-pair1.fastq ERR1864434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,870,902 reads, 12,223,581 reads pseudoaligned [quant] estimated average fragment length: 153.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 ERR1864434.ke.tsv 34699 ERR1864434.se.tsv 87100 total ==> ERR1864434.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1865.08 1209 50.4349 Potri.005G024800.1.v4.1 1035 882.08 291 25.6677 Potri.004G059700.1.v4.1 961 808.08 18 1.73309 Potri.007G009000.2.v4.1 1416 1263.08 0 0 Potri.003G141000.2.v4.1 2943 2790.08 485.462 13.5376 Potri.016G087400.1.v4.1 270 122.219 1259.61 801.864 Potri.015G069301.1.v4.1 564 411.154 0 0 Potri.010G195200.1.v4.1 1773 1620.08 7 0.336174 Potri.012G127500.1.v4.1 977 824.08 100 9.44133 ==> ERR1864434.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 26 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 ERR1864434 completed mapping pipeline successfully