Starting /dee2/code/volunteer_pipeline.sh ERR1864435 current disk space = 3053076135936 free memory = 1450171224 ERR1864435 SRAfilesize 4b3e141198a3f9e55c87a322e563016b ERR1864435.sra ERR1864435.sra file validated ERR1864435 is paired end ERR1864435 is conventional basespace ERR1864435 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3205 33.0 31.0 34.0 30.0 34.0 2 31.75875 34.0 31.0 34.0 30.0 34.0 3 31.845 34.0 31.0 34.0 28.0 34.0 4 35.4565 37.0 35.0 37.0 33.0 37.0 5 35.1245 37.0 35.0 37.0 33.0 37.0 6 35.0315 37.0 35.0 37.0 32.0 37.0 7 34.976 37.0 35.0 37.0 32.0 37.0 8 35.05825 37.0 35.0 37.0 32.0 37.0 9 36.71575 39.0 37.0 39.0 33.0 39.0 10-11 36.622875 39.0 37.0 39.0 33.0 39.0 12-13 36.384 39.0 37.0 39.0 32.0 39.0 14-15 37.79975 40.0 38.0 41.0 32.5 41.0 16-17 37.703 40.0 38.0 41.0 32.5 41.0 18-19 37.66225 40.0 38.0 41.0 32.0 41.0 20-21 37.566 40.0 38.0 41.0 32.0 41.0 22-23 37.378874999999994 40.0 38.0 41.0 32.0 41.0 24-25 37.39375 40.0 38.0 41.0 32.0 41.0 26-27 37.146625 40.0 37.5 41.0 31.0 41.0 28-29 37.046875 40.0 37.0 41.0 31.0 41.0 30-31 36.831625 40.0 36.5 41.0 30.0 41.0 32-33 36.68425 40.0 37.0 41.0 30.0 41.0 34-35 36.6515 40.0 36.5 41.0 30.0 41.0 36-37 36.647125 40.0 37.0 41.0 30.0 41.0 38-39 36.327375 40.0 36.5 41.0 29.5 41.0 40-41 36.2505 40.0 36.0 41.0 29.5 41.0 42-43 36.2115 40.0 36.0 41.0 29.5 41.0 44-45 36.119125 39.5 36.0 41.0 29.0 41.0 46-47 35.971125 39.0 35.5 41.0 28.5 41.0 48-49 36.148125 39.0 36.0 41.0 29.0 41.0 50-51 36.096875 40.0 36.0 41.0 28.0 41.0 52-53 35.996125 39.5 35.5 41.0 28.0 41.0 54-55 35.84625 39.0 35.0 41.0 28.0 41.0 56-57 35.589125 39.0 35.0 41.0 27.5 41.0 58-59 35.419 39.0 35.0 41.0 27.5 41.0 60-61 35.045249999999996 38.5 34.5 40.0 26.0 41.0 62-63 34.74525 38.0 34.0 40.0 26.0 41.0 64-65 34.3375 37.5 34.0 40.0 26.0 41.0 66-67 33.847750000000005 37.0 33.5 39.5 23.5 41.0 68-69 33.607875 36.0 33.0 39.0 25.0 41.0 70-71 33.048625 36.0 33.0 39.0 22.0 40.5 72-73 32.490125000000006 35.0 32.0 38.5 20.5 40.0 74-75 32.177375 35.0 32.0 37.0 21.0 39.0 76-77 31.14725 34.0 30.5 36.0 21.0 39.0 78-79 31.500625 35.0 31.5 36.0 20.0 39.0 80-81 31.38075 35.0 32.0 36.0 20.0 37.0 82-83 31.122 35.0 32.0 35.5 20.0 37.0 84-85 30.7125 35.0 31.0 35.0 18.0 36.5 86-87 30.340375 34.0 31.0 35.0 15.0 36.0 88-89 30.109625 34.0 31.0 35.0 8.5 36.0 90-91 29.90675 34.0 31.0 35.0 7.0 35.5 92-93 29.69725 34.0 30.5 35.0 2.0 35.0 94-95 29.274 34.0 30.0 35.0 2.0 35.0 96-97 28.999625 34.0 30.0 35.0 2.0 35.0 98-99 28.649625 34.0 30.0 35.0 2.0 35.0 100-101 27.485500000000002 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 51.0 3 23.0 4 12.0 5 6.0 6 5.0 7 6.0 8 7.0 9 11.0 10 7.0 11 16.0 12 12.0 13 10.0 14 7.0 15 13.0 16 13.0 17 17.0 18 13.0 19 14.0 20 18.0 21 10.0 22 20.0 23 32.0 24 29.0 25 30.0 26 25.0 27 52.0 28 48.0 29 70.0 30 69.0 31 76.0 32 114.0 33 141.0 34 212.0 35 306.0 36 522.0 37 855.0 38 976.0 39 152.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.66911951281401 6.089824917533622 5.988327835574727 44.252727734077645 2 25.05 5.875 31.474999999999998 37.6 3 23.200000000000003 7.9750000000000005 22.175 46.650000000000006 4 28.775000000000002 11.25 21.65 38.324999999999996 5 30.425 17.575 23.9 28.1 6 24.075 24.95 24.6 26.375 7 17.75 23.925 40.425 17.9 8 17.675 23.1 36.625 22.6 9 17.7 22.45 39.050000000000004 20.8 10-11 19.55 31.525 29.012500000000003 19.9125 12-13 20.849999999999998 26.5125 30.5 22.1375 14-15 20.1125 27.3125 30.112499999999997 22.4625 16-17 20.7625 27.05 29.037499999999998 23.150000000000002 18-19 21.087500000000002 28.599999999999998 27.3375 22.975 20-21 20.1625 27.5125 28.5625 23.7625 22-23 21.0125 27.8625 28.512500000000003 22.6125 24-25 22.025 26.7125 27.575 23.6875 26-27 21.2625 27.0 28.275 23.4625 28-29 20.9875 27.425 28.449999999999996 23.1375 30-31 21.175 27.025 27.5125 24.2875 32-33 21.875 25.775 28.799999999999997 23.549999999999997 34-35 21.3625 26.950000000000003 28.299999999999997 23.3875 36-37 21.212500000000002 27.1 28.249999999999996 23.4375 38-39 21.4 27.5125 27.3125 23.775 40-41 20.7 27.537499999999998 28.825 22.9375 42-43 21.349999999999998 26.8125 28.425 23.4125 44-45 21.2625 27.1 27.6375 24.0 46-47 21.3875 26.825 28.3625 23.425 48-49 21.325 27.075 28.6875 22.912499999999998 50-51 20.837500000000002 26.85 28.599999999999998 23.7125 52-53 20.925 28.0625 28.3875 22.625 54-55 21.1375 27.0875 28.325 23.45 56-57 21.7 26.474999999999998 29.1125 22.7125 58-59 22.075 27.175 27.212500000000002 23.5375 60-61 19.8375 27.1125 28.512500000000003 24.5375 62-63 20.7125 27.700000000000003 27.987499999999997 23.599999999999998 64-65 21.325 26.9625 28.799999999999997 22.912499999999998 66-67 21.5 27.037499999999998 28.075 23.3875 68-69 20.837500000000002 27.075 28.5875 23.5 70-71 21.375 26.937499999999996 28.0625 23.625 72-73 21.6625 27.1625 27.762500000000003 23.4125 74-75 21.6125 26.9625 28.1375 23.2875 76-77 21.175 27.0125 28.749999999999996 23.0625 78-79 21.2875 27.3875 27.700000000000003 23.625 80-81 21.125 27.35 28.725 22.8 82-83 21.7 29.025000000000002 27.237499999999997 22.037499999999998 84-85 21.912499999999998 27.537499999999998 28.212500000000002 22.3375 86-87 22.0 26.887499999999996 26.650000000000002 24.462500000000002 88-89 21.2 28.3375 27.05 23.4125 90-91 21.3 28.525 26.9125 23.2625 92-93 21.95 27.175 27.375 23.5 94-95 21.4 27.2625 28.199999999999996 23.1375 96-97 21.925 26.674999999999997 27.1125 24.2875 98-99 21.55 27.250000000000004 28.462500000000002 22.7375 100-101 21.587500000000002 27.500000000000004 27.3375 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 2.0 25 1.5 26 3.0 27 2.5 28 2.5 29 3.5 30 9.0 31 16.5 32 22.0 33 25.0 34 34.0 35 43.5 36 55.5 37 83.0 38 111.0 39 121.0 40 145.5 41 185.0 42 209.0 43 242.0 44 274.0 45 290.0 46 282.0 47 261.5 48 241.0 49 235.5 50 222.0 51 173.0 52 138.0 53 127.0 54 99.5 55 66.5 56 64.5 57 55.5 58 34.5 59 30.0 60 24.5 61 15.5 62 9.5 63 7.0 64 6.5 65 5.0 66 3.5 67 3.0 68 2.5 69 1.5 70 1.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36817950025497 96.45 2 1.3768485466598674 2.7 3 0.1529831718510964 0.44999999999999996 4 0.10198878123406425 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 1.075 0.0 0.0 0.0 0.0 88-89 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864435 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5405 33.0 31.0 34.0 30.0 34.0 2 31.591 33.0 31.0 34.0 28.0 34.0 3 31.6355 34.0 31.0 34.0 28.0 34.0 4 35.1605 37.0 35.0 37.0 32.0 37.0 5 35.21625 37.0 35.0 37.0 33.0 37.0 6 35.198 37.0 35.0 37.0 33.0 37.0 7 35.31175 37.0 35.0 37.0 33.0 37.0 8 35.13075 37.0 35.0 37.0 32.0 37.0 9 36.76 39.0 37.0 39.0 32.0 39.0 10-11 36.776875000000004 39.0 37.0 39.0 33.0 39.0 12-13 36.65625 39.0 37.0 39.0 32.0 39.0 14-15 38.02775 40.0 38.0 41.0 33.0 41.0 16-17 37.939750000000004 40.0 38.0 41.0 32.5 41.0 18-19 37.930625 40.0 38.0 41.0 32.5 41.0 20-21 37.9285 40.0 38.0 41.0 32.0 41.0 22-23 37.774874999999994 40.0 38.0 41.0 32.0 41.0 24-25 37.641125 40.0 38.0 41.0 32.0 41.0 26-27 37.436125000000004 40.0 38.0 41.0 32.0 41.0 28-29 37.424499999999995 40.0 38.0 41.0 31.5 41.0 30-31 37.231625 40.0 37.5 41.0 31.0 41.0 32-33 37.19375 40.0 37.5 41.0 31.0 41.0 34-35 37.04025 40.0 37.0 41.0 30.5 41.0 36-37 36.7915 40.0 37.0 41.0 30.0 41.0 38-39 36.679874999999996 40.0 36.5 41.0 30.0 41.0 40-41 36.564125000000004 39.5 36.5 41.0 30.0 41.0 42-43 36.251125 39.0 36.0 41.0 29.5 41.0 44-45 36.088 39.0 36.0 40.0 29.0 41.0 46-47 36.09 39.0 36.0 41.0 28.5 41.0 48-49 35.826875 39.0 35.0 40.0 27.0 41.0 50-51 35.016125 38.0 34.0 39.5 26.5 40.5 52-53 35.060125 38.0 34.5 39.5 27.0 40.5 54-55 35.951625 39.0 36.0 40.5 28.0 41.0 56-57 35.828375 39.0 35.5 41.0 27.5 41.0 58-59 35.794375 39.0 35.0 41.0 28.0 41.0 60-61 35.479124999999996 39.0 35.0 41.0 27.0 41.0 62-63 35.150999999999996 38.5 34.5 40.5 26.5 41.0 64-65 34.707 38.0 34.0 40.0 26.0 41.0 66-67 34.376000000000005 37.0 34.0 40.0 26.0 41.0 68-69 34.090500000000006 37.0 34.0 39.0 26.0 41.0 70-71 33.573875 36.0 33.5 39.0 25.5 40.5 72-73 33.10075 36.0 33.0 38.5 24.5 39.5 74-75 32.585499999999996 35.0 33.0 37.0 23.5 39.0 76-77 32.136250000000004 35.0 32.0 37.0 22.5 39.0 78-79 31.613 35.0 32.0 36.0 20.5 38.0 80-81 31.437125 35.0 32.0 36.0 21.5 37.0 82-83 30.9805 35.0 31.0 35.5 19.5 37.0 84-85 30.552500000000002 34.0 31.0 35.0 18.0 36.0 86-87 30.239624999999997 34.0 31.0 35.0 16.5 36.0 88-89 29.920625 34.0 30.5 35.0 9.5 36.0 90-91 29.74975 34.0 31.0 35.0 7.0 35.0 92-93 29.461750000000002 34.0 30.0 35.0 2.0 35.0 94-95 29.0425 34.0 30.0 35.0 2.0 35.0 96-97 28.63475 34.0 29.0 35.0 2.0 35.0 98-99 28.016375 34.0 29.0 35.0 2.0 35.0 100-101 26.963 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 9.0 4 9.0 5 10.0 6 6.0 7 5.0 8 11.0 9 7.0 10 11.0 11 12.0 12 22.0 13 9.0 14 6.0 15 16.0 16 16.0 17 19.0 18 12.0 19 17.0 20 16.0 21 21.0 22 15.0 23 30.0 24 32.0 25 30.0 26 48.0 27 49.0 28 49.0 29 60.0 30 90.0 31 87.0 32 93.0 33 160.0 34 201.0 35 322.0 36 504.0 37 898.0 38 963.0 39 110.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.425 21.275 12.1 37.2 2 26.424999999999997 24.349999999999998 31.5 17.724999999999998 3 18.8 28.1 31.75 21.349999999999998 4 21.75 32.125 25.0 21.125 5 25.275 34.0 22.650000000000002 18.075 6 19.375 39.75 22.425 18.45 7 20.9 23.75 36.9 18.45 8 20.225 26.85 28.725 24.2 9 21.175 24.375 30.775000000000002 23.674999999999997 10-11 21.6625 31.6 25.55 21.1875 12-13 23.599999999999998 25.525 27.975 22.900000000000002 14-15 22.3 28.8375 27.037499999999998 21.825 16-17 23.11538942367796 28.141017627203404 27.303412926615827 21.440180022502815 18-19 22.8 29.625 25.374999999999996 22.2 20-21 22.8875 29.7375 26.700000000000003 20.674999999999997 22-23 23.65 28.449999999999996 26.450000000000003 21.45 24-25 22.912499999999998 28.575 26.737499999999997 21.775 26-27 22.7 28.9375 26.637499999999996 21.725 28-29 23.45 28.199999999999996 26.7625 21.587500000000002 30-31 22.3625 27.775 27.9375 21.925 32-33 23.724999999999998 27.925 26.950000000000003 21.4 34-35 23.425 28.4 26.437500000000004 21.7375 36-37 22.675 28.1375 26.937499999999996 22.25 38-39 22.5625 27.8875 27.2625 22.287499999999998 40-41 23.150000000000002 28.725 26.174999999999997 21.95 42-43 22.787499999999998 28.537499999999998 27.712500000000002 20.962500000000002 44-45 22.7375 28.625 27.187499999999996 21.45 46-47 24.15 27.2625 26.375 22.2125 48-49 23.5375 27.437499999999996 27.5125 21.512500000000003 50-51 22.375 28.962500000000002 26.650000000000002 22.0125 52-53 22.912499999999998 28.549999999999997 26.625 21.912499999999998 54-55 23.0875 27.400000000000002 26.950000000000003 22.5625 56-57 23.2875 28.212500000000002 26.7625 21.7375 58-59 23.35 27.3 27.275 22.075 60-61 22.9375 27.462500000000002 27.437499999999996 22.162499999999998 62-63 22.175 28.425 26.9125 22.4875 64-65 23.974999999999998 28.1375 26.2875 21.6 66-67 22.3375 28.525 27.650000000000002 21.4875 68-69 23.5 28.449999999999996 27.6125 20.4375 70-71 24.7375 27.875 26.575 20.8125 72-73 22.912499999999998 28.8375 26.224999999999998 22.025 74-75 23.5375 29.1875 26.2625 21.0125 76-77 23.9 28.175 26.924999999999997 21.0 78-79 23.8625 27.750000000000004 27.0875 21.3 80-81 23.599999999999998 27.650000000000002 27.175 21.575 82-83 22.725 29.312500000000004 26.75 21.212500000000002 84-85 23.9125 27.8375 26.724999999999998 21.525 86-87 23.1875 28.487499999999997 27.150000000000002 21.175 88-89 23.674999999999997 28.262500000000003 26.7125 21.349999999999998 90-91 23.2625 28.237499999999997 26.7625 21.7375 92-93 23.7 28.075 25.887500000000003 22.3375 94-95 23.5875 28.5625 26.487500000000004 21.3625 96-97 23.5375 28.812500000000004 26.1125 21.5375 98-99 23.200000000000003 30.112499999999997 25.7125 20.974999999999998 100-101 24.625 28.499999999999996 24.85 22.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.0 26 3.5 27 3.0 28 2.0 29 5.5 30 7.0 31 8.5 32 22.0 33 35.5 34 45.5 35 56.0 36 74.0 37 109.0 38 131.5 39 147.0 40 181.5 41 217.0 42 242.5 43 253.5 44 261.0 45 265.5 46 274.5 47 272.5 48 237.0 49 222.0 50 186.5 51 138.5 52 114.5 53 90.5 54 82.0 55 68.5 56 53.5 57 41.0 58 29.0 59 25.5 60 24.0 61 16.0 62 8.5 63 7.0 64 5.5 65 3.5 66 3.0 67 3.5 68 2.0 69 1.5 70 2.5 71 2.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1679273827534 98.32499999999999 2 0.8068582955118508 1.6 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.8125 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88-89 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800796 spots for ERR1864435.sra Written 800796 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra Read 800778 spots for ERR1864435.sra Written 800778 spots for ERR1864435.sra SRR ids: ['ERR1864435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4t1tvcw8 ERR1864435.sra spots: 16015578 blocks: [[1, 800778], [800779, 1601556], [1601557, 2402334], [2402335, 3203112], [3203113, 4003890], [4003891, 4804668], [4804669, 5605446], [5605447, 6406224], [6406225, 7207002], [7207003, 8007780], [8007781, 8808558], [8808559, 9609336], [9609337, 10410114], [10410115, 11210892], [11210893, 12011670], [12011671, 12812448], [12812449, 13613226], [13613227, 14414004], [14414005, 15214782], [15214783, 16015578]] ERR1864435 file size 3841432 ERR1864435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864435 ERR1864435_1.fastq ERR1864435_2.fastq Input file: ERR1864435_1.fastq Paired file: ERR1864435_2.fastq trimmed: ERR1864435-trimmed-pair1.fastq, ERR1864435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 06:49:37 2025 >> started Thu Feb 13 06:49:52 2025 >> done (14.654s) 16015578 read pairs processed; of these: 256526 ( 1.60%) short read pairs filtered out after trimming by size control 304504 ( 1.90%) empty read pairs filtered out after trimming by size control 15454548 (96.50%) read pairs available; of these: 3732943 (24.15%) trimmed read pairs available after processing 11721605 (75.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 123 0.00% 19 292 0.00% 20 434 0.00% 21 611 0.00% 22 783 0.01% 23 974 0.01% 24 1183 0.01% 25 1368 0.01% 26 1663 0.01% 27 1892 0.01% 28 2203 0.01% 29 2494 0.02% 30 2780 0.02% 31 3148 0.02% 32 3535 0.02% 33 3924 0.03% 34 4227 0.03% 35 4574 0.03% 36 4859 0.03% 37 5242 0.03% 38 5689 0.04% 39 6169 0.04% 40 6470 0.04% 41 6720 0.04% 42 7192 0.05% 43 7583 0.05% 44 7834 0.05% 45 8301 0.05% 46 8673 0.06% 47 9113 0.06% 48 9462 0.06% 49 9800 0.06% 50 10276 0.07% 51 10894 0.07% 52 11299 0.07% 53 11620 0.08% 54 12172 0.08% 55 12940 0.08% 56 13537 0.09% 57 14358 0.09% 58 15395 0.10% 59 18592 0.12% 60 21554 0.14% 61 22363 0.14% 62 22896 0.15% 63 23587 0.15% 64 24591 0.16% 65 25672 0.17% 66 26339 0.17% 67 27522 0.18% 68 28937 0.19% 69 30344 0.20% 70 31438 0.20% 71 32785 0.21% 72 34643 0.22% 73 35270 0.23% 74 36914 0.24% 75 38086 0.25% 76 38123 0.25% 77 39993 0.26% 78 41662 0.27% 79 43992 0.28% 80 47064 0.30% 81 48870 0.32% 82 51363 0.33% 83 53989 0.35% 84 57539 0.37% 85 61804 0.40% 86 65397 0.42% 87 69436 0.45% 88 71128 0.46% 89 74125 0.48% 90 82058 0.53% 91 90701 0.59% 92 101030 0.65% 93 114477 0.74% 94 128819 0.83% 95 148975 0.96% 96 176962 1.15% 97 219318 1.42% 98 285107 1.84% 99 378645 2.45% 100 509027 3.29% 101 11721605 75.85% 15454548 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=39 prefix-density=0.33 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=84.46 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.30 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=94.64 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=6.4 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864435 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 06:50:22 Started mapping on | Feb 13 06:50:22 Finished on | Feb 13 06:51:10 Mapping speed, Million of reads per hour | 1159.09 Number of input reads | 15454548 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14915764 Uniquely mapped reads % | 96.51% Average mapped length | 195.21 Number of splices: Total | 9432710 Number of splices: Annotated (sjdb) | 9313423 Number of splices: GT/AG | 9269352 Number of splices: GC/AG | 144468 Number of splices: AT/AC | 6590 Number of splices: Non-canonical | 12300 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391897 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 58545 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 169986 169986 169986 N_multimapping 391897 391897 391897 N_noFeature 268251 14767082 324514 N_ambiguous 144126 531 51414 UnstrandedReadsAssigned:14503387 PositiveStrandReadsAssigned:148151 NegativeStrandReadsAssigned:14539836 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864435-trimmed-pair1.fastq ERR1864435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,454,548 reads, 14,775,417 reads pseudoaligned [quant] estimated average fragment length: 159.115 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 ERR1864435.ke.tsv 34699 ERR1864435.se.tsv 87100 total ==> ERR1864435.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1859.88 2004 70.8205 Potri.005G024800.1.v4.1 1035 876.885 452 33.88 Potri.004G059700.1.v4.1 961 802.885 8 0.654914 Potri.007G009000.2.v4.1 1416 1257.88 0 0 Potri.003G141000.2.v4.1 2943 2784.88 1159 27.3542 Potri.016G087400.1.v4.1 270 119.431 1037.78 571.13 Potri.015G069301.1.v4.1 564 406.05 0 0 Potri.010G195200.1.v4.1 1773 1614.88 204 8.30302 Potri.012G127500.1.v4.1 977 818.885 87 6.98303 ==> ERR1864435.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 ERR1864435 completed mapping pipeline successfully