Starting /dee2/code/volunteer_pipeline.sh ERR1864436 current disk space = 3052630261760 free memory = 1580058704 ERR1864436 SRAfilesize f25a005c9bb1b59dda91790daff95e5e ERR1864436.sra ERR1864436.sra file validated ERR1864436 is paired end ERR1864436 is conventional basespace ERR1864436 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.294 33.0 31.0 34.0 30.0 34.0 2 31.822 34.0 31.0 34.0 30.0 34.0 3 31.9485 34.0 31.0 34.0 28.0 34.0 4 35.534 37.0 35.0 37.0 33.0 37.0 5 35.28775 37.0 35.0 37.0 33.0 37.0 6 35.20675 37.0 35.0 37.0 32.0 37.0 7 35.17625 37.0 35.0 37.0 32.0 37.0 8 35.16575 37.0 35.0 37.0 32.0 37.0 9 36.841 39.0 37.0 39.0 33.0 39.0 10-11 36.76625 39.0 37.0 39.0 33.0 39.0 12-13 36.48975 39.0 37.0 39.0 32.0 39.0 14-15 37.9445 40.0 38.0 41.0 33.0 41.0 16-17 37.84275 40.0 38.0 41.0 32.5 41.0 18-19 37.819125 40.0 38.0 41.0 32.5 41.0 20-21 37.66375 40.0 38.0 41.0 32.0 41.0 22-23 37.49625 40.0 38.0 41.0 32.0 41.0 24-25 37.534499999999994 40.0 38.0 41.0 32.0 41.0 26-27 37.22725 40.0 37.0 41.0 31.0 41.0 28-29 37.208625 40.0 37.0 41.0 31.0 41.0 30-31 36.881875 40.0 36.5 41.0 30.5 41.0 32-33 36.7475 40.0 36.5 41.0 30.0 41.0 34-35 36.67 40.0 37.0 41.0 30.0 41.0 36-37 36.637 40.0 37.0 41.0 30.0 41.0 38-39 36.33825 40.0 36.0 41.0 29.0 41.0 40-41 36.29025 40.0 36.0 41.0 29.5 41.0 42-43 36.258625 39.5 36.0 41.0 29.5 41.0 44-45 36.1965 39.5 35.5 41.0 29.5 41.0 46-47 35.920249999999996 39.0 35.5 41.0 27.5 41.0 48-49 36.177 39.5 36.0 41.0 29.0 41.0 50-51 36.23 40.0 36.0 41.0 29.0 41.0 52-53 36.06925 40.0 35.5 41.0 28.5 41.0 54-55 35.749625 39.0 35.0 41.0 27.5 41.0 56-57 35.579625 39.0 35.0 41.0 27.5 41.0 58-59 35.350375 39.0 35.0 41.0 26.5 41.0 60-61 35.012625 38.0 34.5 40.0 26.0 41.0 62-63 34.64475 38.0 34.0 40.0 26.0 41.0 64-65 34.228375 37.5 34.0 40.0 26.0 41.0 66-67 33.875249999999994 37.0 33.5 40.0 24.5 41.0 68-69 33.4595 36.0 33.0 39.0 23.0 41.0 70-71 33.013999999999996 36.0 32.5 39.0 22.5 40.0 72-73 32.547875 35.0 32.0 38.0 22.0 40.0 74-75 32.146375 35.0 32.0 37.0 20.5 39.0 76-77 31.02975 34.0 30.5 36.0 20.0 39.0 78-79 31.448625 35.0 31.5 36.0 20.5 38.5 80-81 31.387625 35.0 32.0 36.0 20.0 37.0 82-83 30.932875000000003 35.0 31.5 35.5 18.0 37.0 84-85 30.599625 35.0 31.5 35.0 14.5 36.5 86-87 30.23075 34.5 31.0 35.0 9.0 36.0 88-89 30.073124999999997 34.0 31.0 35.0 9.5 36.0 90-91 29.79175 34.0 31.0 35.0 4.5 35.0 92-93 29.50025 34.0 30.5 35.0 2.0 35.0 94-95 29.174 34.0 30.0 35.0 2.0 35.0 96-97 28.86975 34.0 29.5 35.0 2.0 35.0 98-99 28.600125 34.0 29.5 35.0 2.0 35.0 100-101 27.508499999999998 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 17.0 4 11.0 5 5.0 6 10.0 7 12.0 8 7.0 9 12.0 10 12.0 11 12.0 12 7.0 13 19.0 14 17.0 15 12.0 16 19.0 17 11.0 18 10.0 19 17.0 20 16.0 21 21.0 22 21.0 23 22.0 24 20.0 25 34.0 26 38.0 27 45.0 28 43.0 29 61.0 30 74.0 31 98.0 32 105.0 33 141.0 34 193.0 35 296.0 36 515.0 37 929.0 38 953.0 39 127.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.82802547770701 6.547770700636943 4.942675159235669 41.681528662420384 2 26.174999999999997 5.7 30.599999999999998 37.525 3 24.25 7.925 21.975 45.85 4 29.299999999999997 12.275 21.55 36.875 5 29.575000000000003 19.2 24.2 27.025 6 25.95 25.474999999999998 23.025000000000002 25.55 7 18.575 23.150000000000002 39.875 18.4 8 17.325 23.75 36.15 22.775000000000002 9 18.099999999999998 22.375 38.574999999999996 20.95 10-11 19.412499999999998 31.75 29.5375 19.3 12-13 20.7875 27.05 30.9625 21.2 14-15 19.9875 27.650000000000002 30.2375 22.125 16-17 21.575 27.6875 28.7375 22.0 18-19 21.837500000000002 27.487499999999997 27.85 22.825 20-21 21.512500000000003 27.2625 28.075 23.150000000000002 22-23 21.837500000000002 26.637499999999996 27.8375 23.6875 24-25 21.6625 27.287499999999998 27.55 23.5 26-27 21.212500000000002 27.55 27.700000000000003 23.5375 28-29 22.3375 27.0625 27.575 23.025000000000002 30-31 21.6875 26.4125 28.0625 23.8375 32-33 22.4375 26.6125 27.487499999999997 23.4625 34-35 22.1875 26.950000000000003 27.6375 23.225 36-37 21.837500000000002 26.825 27.4125 23.925 38-39 21.5375 26.474999999999998 28.65 23.3375 40-41 20.674999999999997 27.85 27.3875 24.087500000000002 42-43 20.625 27.0625 29.575000000000003 22.7375 44-45 21.762500000000003 26.974999999999998 27.725 23.5375 46-47 21.875 27.075 27.762500000000003 23.2875 48-49 21.912499999999998 27.175 27.474999999999998 23.4375 50-51 21.675 26.875 28.012500000000003 23.4375 52-53 21.2375 26.687499999999996 28.375 23.7 54-55 20.625 27.1625 28.5625 23.65 56-57 21.875 26.8625 28.1875 23.075000000000003 58-59 21.975 27.125 27.287499999999998 23.6125 60-61 21.5625 26.775 27.750000000000004 23.9125 62-63 21.837500000000002 26.887499999999996 28.199999999999996 23.075000000000003 64-65 21.3875 28.1875 27.1625 23.2625 66-67 22.0875 26.687499999999996 28.249999999999996 22.975 68-69 22.3625 26.775 28.212500000000002 22.650000000000002 70-71 21.3 28.4 27.5625 22.7375 72-73 22.037499999999998 26.787499999999998 27.375 23.799999999999997 74-75 22.4625 26.8375 27.487499999999997 23.2125 76-77 21.875 27.1 27.762500000000003 23.2625 78-79 21.349999999999998 26.125 28.812500000000004 23.7125 80-81 21.675 28.549999999999997 27.1625 22.6125 82-83 21.349999999999998 27.450000000000003 27.675 23.525 84-85 21.8625 26.700000000000003 28.237499999999997 23.200000000000003 86-87 21.875 26.937499999999996 27.287499999999998 23.9 88-89 21.9375 27.35 27.237499999999997 23.474999999999998 90-91 20.837500000000002 27.0125 27.6625 24.4875 92-93 21.5625 27.5625 27.8375 23.0375 94-95 21.637500000000003 28.299999999999997 27.250000000000004 22.8125 96-97 22.075 26.950000000000003 27.6 23.375 98-99 22.3875 27.212500000000002 27.537499999999998 22.8625 100-101 21.8 27.3375 27.8125 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 2.5 27 1.5 28 4.5 29 9.0 30 7.5 31 10.5 32 21.0 33 26.5 34 37.5 35 46.0 36 48.5 37 68.5 38 97.5 39 119.5 40 146.5 41 176.5 42 202.0 43 227.0 44 245.0 45 266.5 46 276.5 47 281.5 48 268.0 49 249.5 50 219.0 51 176.5 52 145.5 53 128.0 54 112.5 55 82.0 56 74.5 57 59.5 58 37.0 59 29.5 60 25.5 61 19.5 62 11.0 63 8.5 64 7.0 65 3.5 66 2.0 67 2.5 68 2.0 69 0.5 70 1.0 71 0.5 72 1.0 73 1.5 74 1.0 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5975200206665 94.45 2 1.9116507362438646 3.6999999999999997 3 0.3099974166881943 0.8999999999999999 4 0.051666236114699046 0.2 5 0.051666236114699046 0.25 6 0.051666236114699046 0.3 7 0.0 0.0 8 0.025833118057349523 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCG 8 0.2 No Hit CCCCGGCCTCAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTC 6 0.15 No Hit GGCGGCAATAAAGCTGATGCACTGCACTTGACGCGTGTTGTCGAATCCGA 6 0.15 No Hit GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.7375 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 0.9875 0.0 0.0 0.0 0.0 88-89 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864436 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56575 33.0 31.0 34.0 30.0 34.0 2 31.59725 34.0 31.0 34.0 28.0 34.0 3 31.62275 34.0 31.0 34.0 28.0 34.0 4 35.08325 37.0 35.0 37.0 32.0 37.0 5 35.12875 37.0 35.0 37.0 32.0 37.0 6 35.11175 37.0 35.0 37.0 32.0 37.0 7 35.2985 37.0 35.0 37.0 33.0 37.0 8 35.024 37.0 35.0 37.0 32.0 37.0 9 36.7475 39.0 37.0 39.0 32.0 39.0 10-11 36.73525 39.0 37.0 39.0 32.0 39.0 12-13 36.554 39.0 37.0 39.0 32.0 39.0 14-15 37.981375 40.0 38.0 41.0 33.0 41.0 16-17 37.830625 40.0 38.0 41.0 32.0 41.0 18-19 37.809375 40.0 38.0 41.0 32.0 41.0 20-21 37.7525 40.0 38.0 41.0 32.0 41.0 22-23 37.65875 40.0 38.0 41.0 32.0 41.0 24-25 37.504999999999995 40.0 38.0 41.0 31.5 41.0 26-27 37.326750000000004 40.0 38.0 41.0 31.0 41.0 28-29 37.28825 40.0 38.0 41.0 31.0 41.0 30-31 37.189499999999995 40.0 37.5 41.0 30.5 41.0 32-33 36.95075 40.0 37.0 41.0 30.0 41.0 34-35 36.974000000000004 40.0 37.0 41.0 30.0 41.0 36-37 36.70025 40.0 37.0 41.0 30.0 41.0 38-39 36.518125 40.0 36.5 41.0 30.0 41.0 40-41 36.343625 39.0 36.0 41.0 30.0 41.0 42-43 36.08725 39.0 36.0 40.5 28.0 41.0 44-45 35.8305 39.0 35.0 40.5 27.5 41.0 46-47 35.965875 39.0 36.0 41.0 28.0 41.0 48-49 35.656125 39.0 35.0 40.0 26.5 41.0 50-51 34.954625 38.0 34.0 39.5 26.0 40.5 52-53 34.903625000000005 38.0 34.5 39.5 26.5 40.5 54-55 35.704 39.0 35.5 40.5 27.0 41.0 56-57 35.605999999999995 39.0 35.0 41.0 27.0 41.0 58-59 35.576499999999996 39.0 35.0 41.0 27.5 41.0 60-61 35.22275 39.0 35.0 41.0 26.0 41.0 62-63 34.964 38.0 34.5 40.0 26.0 41.0 64-65 34.535 38.0 34.0 40.0 26.0 41.0 66-67 34.057625 37.0 34.0 39.5 25.0 41.0 68-69 33.722 37.0 34.0 39.0 24.0 41.0 70-71 33.165375 36.0 33.0 39.0 23.0 40.5 72-73 32.729749999999996 35.5 32.5 38.5 22.0 39.5 74-75 32.190625 35.0 32.0 37.0 21.0 39.0 76-77 31.802125 35.0 32.0 37.0 20.0 39.0 78-79 31.282625 35.0 31.0 36.0 19.5 37.5 80-81 31.083375 35.0 31.0 36.0 20.0 37.0 82-83 30.65925 35.0 31.0 35.0 18.0 37.0 84-85 30.352375000000002 34.0 31.0 35.0 15.0 36.0 86-87 30.0945 34.0 31.0 35.0 9.5 36.0 88-89 29.6905 34.0 30.0 35.0 6.5 35.5 90-91 29.4995 34.0 30.0 35.0 2.0 35.0 92-93 29.288625000000003 34.0 30.0 35.0 2.0 35.0 94-95 28.991374999999998 34.0 30.0 35.0 2.0 35.0 96-97 28.490875000000003 34.0 29.0 35.0 2.0 35.0 98-99 28.07525 34.0 29.0 35.0 2.0 35.0 100-101 27.029125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 9.0 4 10.0 5 4.0 6 12.0 7 10.0 8 7.0 9 11.0 10 15.0 11 21.0 12 11.0 13 18.0 14 17.0 15 12.0 16 17.0 17 10.0 18 21.0 19 11.0 20 24.0 21 23.0 22 27.0 23 21.0 24 27.0 25 35.0 26 42.0 27 36.0 28 45.0 29 73.0 30 73.0 31 80.0 32 121.0 33 165.0 34 223.0 35 260.0 36 514.0 37 968.0 38 904.0 39 96.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.825 23.575 10.549999999999999 34.050000000000004 2 25.525 25.374999999999996 30.975 18.125 3 19.25 27.3 31.574999999999996 21.875 4 22.625 32.7 24.025 20.65 5 24.375 35.75 22.15 17.724999999999998 6 19.7 39.95 21.75 18.6 7 22.25 22.725 35.175 19.85 8 22.125 24.575 28.925 24.375 9 20.575 25.575 31.1 22.75 10-11 22.6125 31.55 24.4375 21.4 12-13 24.325 25.5625 26.35 23.7625 14-15 23.0375 28.9375 26.35 21.675 16-17 22.7375 28.5625 26.700000000000003 22.0 18-19 22.825 29.8875 26.450000000000003 20.837500000000002 20-21 22.8625 28.95 27.075 21.1125 22-23 22.8875 28.5875 26.9125 21.6125 24-25 23.1375 29.462500000000002 26.025 21.375 26-27 23.150000000000002 27.925 27.1625 21.762500000000003 28-29 23.05 28.225 27.3375 21.3875 30-31 23.799999999999997 28.575 25.674999999999997 21.95 32-33 23.625 28.8875 26.474999999999998 21.0125 34-35 22.975 28.9875 26.737499999999997 21.3 36-37 23.1 28.425 26.025 22.45 38-39 23.0375 28.262500000000003 26.687499999999996 22.0125 40-41 22.875 27.987499999999997 26.8 22.3375 42-43 23.3 28.012500000000003 27.05 21.637500000000003 44-45 22.575 28.625 27.275 21.525 46-47 24.15 28.375 25.900000000000002 21.575 48-49 23.075000000000003 28.1875 27.1 21.637500000000003 50-51 23.7375 27.1375 26.5375 22.5875 52-53 22.4875 27.712500000000002 27.200000000000003 22.6 54-55 22.5875 27.750000000000004 27.575 22.0875 56-57 23.525 28.299999999999997 26.5375 21.637500000000003 58-59 23.7375 27.1 27.750000000000004 21.4125 60-61 22.5 28.212500000000002 26.9625 22.325 62-63 23.6875 27.962500000000002 26.825 21.525 64-65 24.275 27.1 26.625 22.0 66-67 22.1 28.3875 27.725 21.7875 68-69 23.0375 27.8375 27.3375 21.7875 70-71 22.8625 28.762500000000003 27.200000000000003 21.175 72-73 23.724999999999998 27.375 26.9125 21.987499999999997 74-75 23.5 28.1 26.5625 21.837500000000002 76-77 23.3 27.6625 27.1125 21.925 78-79 22.8875 28.7 26.7625 21.65 80-81 23.474999999999998 27.987499999999997 26.637499999999996 21.9 82-83 23.375 28.625 26.224999999999998 21.775 84-85 23.225 27.987499999999997 27.150000000000002 21.637500000000003 86-87 24.224999999999998 27.650000000000002 26.674999999999997 21.45 88-89 23.0875 27.987499999999997 26.05 22.875 90-91 23.2375 28.1 26.2125 22.45 92-93 24.3 28.025 26.6 21.075 94-95 24.05 28.375 25.7875 21.7875 96-97 23.8125 28.3125 26.025 21.85 98-99 23.674999999999997 28.537499999999998 25.912499999999998 21.875 100-101 25.412499999999998 28.499999999999996 25.0125 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 1.5 26 3.0 27 4.5 28 6.0 29 6.5 30 8.0 31 12.0 32 17.0 33 26.5 34 42.5 35 52.5 36 66.5 37 90.0 38 107.0 39 137.0 40 187.0 41 223.0 42 235.0 43 256.0 44 271.0 45 267.5 46 259.5 47 249.5 48 242.0 49 226.5 50 193.5 51 158.0 52 135.0 53 117.0 54 98.0 55 79.5 56 58.5 57 40.5 58 32.5 59 23.0 60 14.0 61 11.5 62 9.0 63 6.5 64 6.5 65 4.0 66 2.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11571500757958 98.075 2 0.7326932794340576 1.4500000000000002 3 0.12632642748863063 0.375 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5 0.0 0.0 0.0 0.0 80-81 0.6625000000000001 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895841 spots for ERR1864436.sra Written 895841 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra Read 895829 spots for ERR1864436.sra Written 895829 spots for ERR1864436.sra SRR ids: ['ERR1864436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3mno55jp ERR1864436.sra spots: 17916592 blocks: [[1, 895829], [895830, 1791658], [1791659, 2687487], [2687488, 3583316], [3583317, 4479145], [4479146, 5374974], [5374975, 6270803], [6270804, 7166632], [7166633, 8062461], [8062462, 8958290], [8958291, 9854119], [9854120, 10749948], [10749949, 11645777], [11645778, 12541606], [12541607, 13437435], [13437436, 14333264], [14333265, 15229093], [15229094, 16124922], [16124923, 17020751], [17020752, 17916592]] ERR1864436 file size 4299977 ERR1864436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864436 ERR1864436_1.fastq ERR1864436_2.fastq Input file: ERR1864436_1.fastq Paired file: ERR1864436_2.fastq trimmed: ERR1864436-trimmed-pair1.fastq, ERR1864436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:32:17 2025 >> started Thu Feb 13 09:37:12 2025 >> done (294.371s) 17916592 read pairs processed; of these: 320222 ( 1.79%) short read pairs filtered out after trimming by size control 392141 ( 2.19%) empty read pairs filtered out after trimming by size control 17204229 (96.02%) read pairs available; of these: 4241043 (24.65%) trimmed read pairs available after processing 12963186 (75.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 134 0.00% 19 329 0.00% 20 556 0.00% 21 732 0.00% 22 943 0.01% 23 1132 0.01% 24 1373 0.01% 25 1724 0.01% 26 1877 0.01% 27 2236 0.01% 28 2526 0.01% 29 2913 0.02% 30 3297 0.02% 31 3664 0.02% 32 4236 0.02% 33 4673 0.03% 34 4994 0.03% 35 5395 0.03% 36 5892 0.03% 37 6274 0.04% 38 6626 0.04% 39 7079 0.04% 40 7486 0.04% 41 7865 0.05% 42 8332 0.05% 43 8919 0.05% 44 9240 0.05% 45 9625 0.06% 46 10014 0.06% 47 10783 0.06% 48 10986 0.06% 49 11468 0.07% 50 11942 0.07% 51 12811 0.07% 52 13237 0.08% 53 13801 0.08% 54 14374 0.08% 55 15112 0.09% 56 15954 0.09% 57 16676 0.10% 58 17725 0.10% 59 22192 0.13% 60 25709 0.15% 61 26292 0.15% 62 27064 0.16% 63 27719 0.16% 64 28427 0.17% 65 29979 0.17% 66 30946 0.18% 67 31908 0.19% 68 33529 0.19% 69 35090 0.20% 70 35950 0.21% 71 37845 0.22% 72 39967 0.23% 73 40965 0.24% 74 42454 0.25% 75 44263 0.26% 76 44326 0.26% 77 46216 0.27% 78 48138 0.28% 79 50594 0.29% 80 54139 0.31% 81 56483 0.33% 82 58548 0.34% 83 62080 0.36% 84 65957 0.38% 85 70390 0.41% 86 75110 0.44% 87 79579 0.46% 88 80761 0.47% 89 84479 0.49% 90 93375 0.54% 91 103236 0.60% 92 114230 0.66% 93 129512 0.75% 94 146349 0.85% 95 168199 0.98% 96 199030 1.16% 97 245395 1.43% 98 318289 1.85% 99 422506 2.46% 100 568868 3.31% 101 12963186 75.35% 17204229 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=2.1 sequence=GCGAAGAAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=34.47 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.4 sequence=TCAACAATTCTCGCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAATGATATTCATCTCCAAAAACCCAATAAAAA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.47 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=135.19 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=9.4 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA ERR1864436 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:47:04 Started mapping on | Feb 13 09:47:07 Finished on | Feb 13 10:15:43 Mapping speed, Million of reads per hour | 36.09 Number of input reads | 17204229 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16626747 Uniquely mapped reads % | 96.64% Average mapped length | 194.93 Number of splices: Total | 10290650 Number of splices: Annotated (sjdb) | 10172312 Number of splices: GT/AG | 10102301 Number of splices: GC/AG | 168088 Number of splices: AT/AC | 6654 Number of splices: Non-canonical | 13607 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392767 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 34930 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 218085 218085 218085 N_multimapping 392767 392767 392767 N_noFeature 265252 16448835 326927 N_ambiguous 171393 603 54867 UnstrandedReadsAssigned:16190102 PositiveStrandReadsAssigned:177309 NegativeStrandReadsAssigned:16244953 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864436-trimmed-pair1.fastq ERR1864436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,204,229 reads, 16,447,430 reads pseudoaligned [quant] estimated average fragment length: 157.8 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 ERR1864436.ke.tsv 34699 ERR1864436.se.tsv 87100 total ==> ERR1864436.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1861.2 1742 50.1871 Potri.005G024800.1.v4.1 1035 878.2 445 27.1709 Potri.004G059700.1.v4.1 961 804.2 10 0.666766 Potri.007G009000.2.v4.1 1416 1259.2 0 0 Potri.003G141000.2.v4.1 2943 2786.2 1278.37 24.6026 Potri.016G087400.1.v4.1 270 120.461 860 382.815 Potri.015G069301.1.v4.1 564 407.32 0 0 Potri.010G195200.1.v4.1 1773 1616.2 88 2.91961 Potri.012G127500.1.v4.1 977 820.2 70 4.57631 ==> ERR1864436.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 79 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 ERR1864436 completed mapping pipeline successfully