Starting /dee2/code/volunteer_pipeline.sh ERR1864437 current disk space = 3052786995200 free memory = 1579809752 ERR1864437 SRAfilesize 838e3e35787e32812a75134d813641f4 ERR1864437.sra ERR1864437.sra file validated ERR1864437 is paired end ERR1864437 is conventional basespace ERR1864437 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5395 33.0 31.0 34.0 30.0 34.0 2 31.90075 34.0 31.0 34.0 30.0 34.0 3 31.96875 34.0 31.0 34.0 29.0 34.0 4 35.51975 37.0 35.0 37.0 33.0 37.0 5 35.26525 37.0 35.0 37.0 33.0 37.0 6 35.14425 37.0 35.0 37.0 32.0 37.0 7 35.12125 37.0 35.0 37.0 32.0 37.0 8 35.1225 37.0 35.0 37.0 32.0 37.0 9 36.75975 39.0 37.0 39.0 33.0 39.0 10-11 36.649125 39.0 37.0 39.0 32.5 39.0 12-13 36.368375 39.0 37.0 39.0 32.0 39.0 14-15 37.8035 40.0 38.0 41.0 32.0 41.0 16-17 37.662875 40.0 38.0 41.0 32.0 41.0 18-19 37.583 40.0 38.0 41.0 32.0 41.0 20-21 37.50625 40.0 38.0 41.0 32.0 41.0 22-23 37.364374999999995 40.0 38.0 41.0 31.0 41.0 24-25 37.39 40.0 38.0 41.0 31.0 41.0 26-27 37.209625 40.0 37.5 41.0 31.0 41.0 28-29 37.05175 40.0 37.0 41.0 30.5 41.0 30-31 36.772125 40.0 37.0 41.0 30.0 41.0 32-33 36.744 40.0 37.0 41.0 30.0 41.0 34-35 36.58225 40.0 36.0 41.0 30.0 41.0 36-37 36.628125 40.0 36.5 41.0 30.0 41.0 38-39 36.351124999999996 40.0 36.0 41.0 29.5 41.0 40-41 36.24 40.0 36.0 41.0 29.5 41.0 42-43 36.215125 40.0 36.0 41.0 28.5 41.0 44-45 36.09425 39.5 35.5 41.0 28.5 41.0 46-47 35.857 39.0 35.0 41.0 28.0 41.0 48-49 36.070875 39.5 35.5 41.0 28.0 41.0 50-51 36.109375 40.0 36.0 41.0 28.5 41.0 52-53 36.0055 39.5 35.5 41.0 28.0 41.0 54-55 35.775999999999996 39.0 35.0 41.0 28.0 41.0 56-57 35.483375 39.0 35.0 41.0 26.5 41.0 58-59 35.227000000000004 39.0 35.0 41.0 26.5 41.0 60-61 34.976 38.0 34.5 40.5 26.0 41.0 62-63 34.652375 38.0 34.0 40.0 26.0 41.0 64-65 34.258875 37.5 34.0 40.0 25.0 41.0 66-67 33.83125 37.0 33.5 39.5 23.5 41.0 68-69 33.47875 36.5 33.0 39.0 23.0 41.0 70-71 32.97087500000001 36.0 32.0 39.0 22.0 40.5 72-73 32.54675 35.0 32.0 38.5 22.0 40.0 74-75 32.080625 35.0 32.0 37.0 20.0 39.0 76-77 31.080125000000002 34.0 30.5 36.0 20.0 39.0 78-79 31.432875 35.0 31.5 36.0 19.0 39.0 80-81 31.42775 35.0 32.0 36.0 20.5 37.0 82-83 31.062375 35.0 31.5 36.0 20.0 37.0 84-85 30.649749999999997 35.0 31.5 35.0 16.5 36.5 86-87 30.363625 35.0 31.0 35.0 14.5 36.0 88-89 30.128125 34.0 31.0 35.0 9.0 36.0 90-91 29.77475 34.0 31.0 35.0 4.5 35.5 92-93 29.665 34.0 31.0 35.0 2.0 35.0 94-95 29.240000000000002 34.0 30.0 35.0 2.0 35.0 96-97 28.96425 34.0 30.0 35.0 2.0 35.0 98-99 28.583624999999998 34.0 29.5 35.0 2.0 35.0 100-101 27.497999999999998 33.0 27.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 40.0 3 17.0 4 21.0 5 7.0 6 8.0 7 10.0 8 8.0 9 13.0 10 12.0 11 8.0 12 11.0 13 13.0 14 6.0 15 14.0 16 20.0 17 16.0 18 13.0 19 18.0 20 18.0 21 23.0 22 16.0 23 23.0 24 23.0 25 25.0 26 47.0 27 43.0 28 43.0 29 56.0 30 77.0 31 109.0 32 113.0 33 144.0 34 179.0 35 280.0 36 475.0 37 876.0 38 1020.0 39 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.29221435793731 6.294236602628918 4.145601617795753 40.26794742163802 2 28.375 5.800000000000001 30.45 35.375 3 25.074999999999996 8.275 23.150000000000002 43.5 4 29.775000000000002 14.05 21.275 34.9 5 30.099999999999998 19.45 24.075 26.375 6 23.674999999999997 24.275 25.324999999999996 26.724999999999998 7 17.925 25.4 38.65 18.025 8 18.0 23.05 36.125 22.825 9 18.175 23.125 37.45 21.25 10-11 20.674999999999997 32.0 28.625 18.7 12-13 21.337500000000002 27.125 29.812499999999996 21.725 14-15 20.9125 27.05 30.2125 21.825 16-17 21.5 28.0625 28.325 22.112499999999997 18-19 21.8875 28.375 27.450000000000003 22.287499999999998 20-21 21.1625 27.400000000000002 27.712500000000002 23.724999999999998 22-23 21.2625 27.8875 27.6375 23.2125 24-25 21.2625 27.925 26.950000000000003 23.8625 26-27 21.3 27.6 27.725 23.375 28-29 21.775 27.0875 28.3875 22.75 30-31 22.0125 26.4125 28.237499999999997 23.3375 32-33 21.475 27.8625 27.325 23.3375 34-35 21.6 27.375 27.537499999999998 23.4875 36-37 21.7875 27.6375 27.9125 22.662499999999998 38-39 22.0 26.7625 28.9125 22.325 40-41 21.45 28.475 27.35 22.725 42-43 21.462500000000002 27.575 27.950000000000003 23.0125 44-45 22.1875 27.05 28.037499999999998 22.725 46-47 21.1625 27.400000000000002 27.6125 23.825 48-49 21.725 27.1125 27.9125 23.25 50-51 21.175 27.8625 27.35 23.6125 52-53 21.637500000000003 27.5875 27.6625 23.1125 54-55 21.5 26.2625 29.675 22.5625 56-57 22.375 26.700000000000003 28.4375 22.4875 58-59 21.45 26.400000000000002 27.900000000000002 24.25 60-61 21.275 26.8375 28.7375 23.150000000000002 62-63 21.675 26.7125 28.050000000000004 23.5625 64-65 22.662499999999998 26.55 27.775 23.0125 66-67 22.05 27.037499999999998 28.0625 22.85 68-69 21.8625 26.5625 28.5625 23.0125 70-71 21.25 28.075 27.575 23.1 72-73 21.337500000000002 27.750000000000004 27.250000000000004 23.6625 74-75 21.762500000000003 27.712500000000002 27.8875 22.6375 76-77 21.8625 26.987499999999997 28.1625 22.9875 78-79 22.237499999999997 27.5125 27.975 22.275 80-81 20.849999999999998 27.737499999999997 27.762500000000003 23.65 82-83 22.35 27.962500000000002 28.050000000000004 21.637500000000003 84-85 22.0125 28.0625 27.3375 22.5875 86-87 22.3125 27.487499999999997 26.325 23.875 88-89 22.25 27.5875 27.0625 23.1 90-91 23.2375 27.975 26.3125 22.475 92-93 21.475 27.737499999999997 27.275 23.5125 94-95 22.2625 28.199999999999996 26.575 22.9625 96-97 21.975 28.512500000000003 27.787499999999998 21.725 98-99 22.912499999999998 26.875 27.987499999999997 22.225 100-101 22.3625 27.6625 26.9625 23.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 1.0 25 0.5 26 1.5 27 3.5 28 6.5 29 9.0 30 9.0 31 17.0 32 22.0 33 21.0 34 32.5 35 43.0 36 53.0 37 74.5 38 100.0 39 126.0 40 158.0 41 191.0 42 207.5 43 227.0 44 241.5 45 258.5 46 289.5 47 306.0 48 268.5 49 216.5 50 198.5 51 171.0 52 146.0 53 122.5 54 101.5 55 86.5 56 67.5 57 56.0 58 44.0 59 32.0 60 25.5 61 19.5 62 11.0 63 5.5 64 2.5 65 4.0 66 6.5 67 3.0 68 0.5 69 0.0 70 0.0 71 0.0 72 1.0 73 2.0 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2622029133657 96.125 2 1.3544594939943777 2.65 3 0.33222591362126247 0.975 4 0.025555839509327882 0.1 5 0.0 0.0 6 0.025555839509327882 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCGGCAATAAAGCTGATGCACTGCACTTGACGCGTGTTGTCGAATCCGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.725 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864437 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.616 33.0 31.0 34.0 30.0 34.0 2 31.62775 34.0 31.0 34.0 28.0 34.0 3 31.69325 34.0 31.0 34.0 28.0 34.0 4 35.14025 37.0 35.0 37.0 32.0 37.0 5 35.205 37.0 35.0 37.0 33.0 37.0 6 35.08625 37.0 35.0 37.0 32.0 37.0 7 35.24525 37.0 35.0 37.0 33.0 37.0 8 35.079 37.0 35.0 37.0 32.0 37.0 9 36.72525 39.0 37.0 39.0 33.0 39.0 10-11 36.794624999999996 39.0 37.0 39.0 33.0 39.0 12-13 36.63975 39.0 37.0 39.0 32.0 39.0 14-15 38.008624999999995 40.5 38.0 41.0 32.5 41.0 16-17 37.8865 40.0 38.0 41.0 32.0 41.0 18-19 37.986875 40.0 38.0 41.0 32.5 41.0 20-21 37.93325 40.0 38.0 41.0 32.0 41.0 22-23 37.790625000000006 40.0 38.0 41.0 32.0 41.0 24-25 37.753 40.0 38.0 41.0 32.0 41.0 26-27 37.46775 40.0 38.0 41.0 31.5 41.0 28-29 37.417375 40.0 38.0 41.0 31.0 41.0 30-31 37.209875 40.0 37.5 41.0 30.5 41.0 32-33 37.08725 40.0 37.5 41.0 30.0 41.0 34-35 37.04625 40.0 37.0 41.0 30.0 41.0 36-37 36.83025000000001 40.0 37.0 41.0 30.0 41.0 38-39 36.718500000000006 40.0 37.0 41.0 30.0 41.0 40-41 36.53775 40.0 37.0 41.0 29.5 41.0 42-43 36.27225 39.5 36.0 41.0 28.5 41.0 44-45 36.0685 39.0 35.5 41.0 28.5 41.0 46-47 36.203500000000005 39.0 36.0 41.0 28.5 41.0 48-49 35.9375 39.0 36.0 41.0 27.0 41.0 50-51 35.197874999999996 38.5 34.5 40.0 27.0 40.5 52-53 35.182625 38.0 34.5 39.5 27.0 40.5 54-55 36.0275 39.0 36.0 40.5 28.0 41.0 56-57 35.912125 39.0 35.5 41.0 28.0 41.0 58-59 35.852374999999995 39.0 35.0 41.0 28.0 41.0 60-61 35.63775 39.0 35.0 41.0 28.0 41.0 62-63 35.2295 38.5 35.0 40.5 26.0 41.0 64-65 34.926625 38.0 34.5 40.0 26.0 41.0 66-67 34.496125 37.0 34.0 40.0 26.0 41.0 68-69 34.119625 37.0 34.0 39.0 26.0 41.0 70-71 33.614875 36.0 34.0 39.0 25.5 41.0 72-73 33.243624999999994 36.0 33.5 38.5 24.5 40.0 74-75 32.710499999999996 35.0 33.0 37.0 24.5 39.0 76-77 32.18625 35.0 32.5 37.0 22.5 39.0 78-79 31.717375 35.0 32.0 36.0 20.5 38.5 80-81 31.5105 35.0 32.0 36.0 21.0 37.0 82-83 31.0535 35.0 32.0 35.5 19.5 37.0 84-85 30.674374999999998 35.0 31.0 35.0 17.5 36.0 86-87 30.34525 34.5 31.0 35.0 16.0 36.0 88-89 30.006749999999997 34.0 31.0 35.0 8.5 36.0 90-91 29.912750000000003 34.0 31.0 35.0 8.5 35.5 92-93 29.648625000000003 34.0 30.0 35.0 4.5 35.0 94-95 29.32725 34.0 30.0 35.0 2.0 35.0 96-97 28.93925 34.0 30.0 35.0 2.0 35.0 98-99 28.444125 34.0 29.0 35.0 2.0 35.0 100-101 27.36525 33.5 27.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 8.0 4 7.0 5 1.0 6 7.0 7 9.0 8 5.0 9 14.0 10 10.0 11 9.0 12 11.0 13 9.0 14 18.0 15 10.0 16 18.0 17 12.0 18 18.0 19 28.0 20 12.0 21 13.0 22 29.0 23 24.0 24 38.0 25 42.0 26 30.0 27 49.0 28 57.0 29 57.0 30 68.0 31 79.0 32 106.0 33 131.0 34 179.0 35 276.0 36 474.0 37 949.0 38 1028.0 39 127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.875 23.75 9.725 33.650000000000006 2 26.275 24.725 32.2 16.8 3 20.150000000000002 26.525 31.424999999999997 21.9 4 22.25 32.975 24.4 20.375 5 26.025 34.425 21.75 17.8 6 20.775 38.550000000000004 21.45 19.225 7 20.25 23.525 36.85 19.375 8 19.400000000000002 26.575 28.050000000000004 25.974999999999998 9 20.875 25.025 30.15 23.95 10-11 22.075 31.95 24.6 21.375 12-13 23.325000000000003 25.85 28.025 22.8 14-15 22.4875 27.975 27.200000000000003 22.3375 16-17 23.2875 28.1 25.837500000000002 22.775000000000002 18-19 22.225 29.012500000000003 26.737499999999997 22.025 20-21 23.0875 28.7 27.6875 20.525 22-23 23.2375 29.025000000000002 26.8625 20.875 24-25 22.5625 28.4375 27.625 21.375 26-27 23.3375 28.6125 26.9125 21.1375 28-29 23.150000000000002 28.199999999999996 26.7125 21.9375 30-31 22.4875 28.475 27.3625 21.675 32-33 23.7875 28.375 26.5375 21.3 34-35 22.625 27.975 27.375 22.025 36-37 22.237499999999997 28.537499999999998 27.800000000000004 21.425 38-39 22.2 28.1375 26.974999999999998 22.6875 40-41 22.7 28.5875 27.150000000000002 21.5625 42-43 23.0625 28.050000000000004 27.275 21.6125 44-45 24.275 28.012500000000003 26.8625 20.849999999999998 46-47 23.2375 28.0625 26.125 22.575 48-49 22.475 28.1 27.8625 21.5625 50-51 22.9375 27.975 27.55 21.5375 52-53 23.3375 28.7375 26.35 21.575 54-55 22.525000000000002 28.325 27.462500000000002 21.6875 56-57 23.1625 27.575 27.700000000000003 21.5625 58-59 23.1375 27.8375 27.525 21.5 60-61 22.8625 27.5125 27.200000000000003 22.425 62-63 22.9875 27.537499999999998 27.05 22.425 64-65 21.85 28.425 27.200000000000003 22.525000000000002 66-67 22.3125 28.299999999999997 27.425 21.9625 68-69 23.0 27.800000000000004 26.9625 22.237499999999997 70-71 23.65 27.8625 26.400000000000002 22.0875 72-73 22.912499999999998 28.3625 27.0 21.725 74-75 22.425 28.475 27.025 22.075 76-77 23.4625 28.7 26.650000000000002 21.1875 78-79 23.4375 27.5125 27.212500000000002 21.837500000000002 80-81 22.662499999999998 29.075 26.474999999999998 21.7875 82-83 23.8875 28.1625 26.325 21.625 84-85 23.275000000000002 27.775 26.700000000000003 22.25 86-87 22.95 28.749999999999996 27.200000000000003 21.099999999999998 88-89 23.674999999999997 27.1125 26.637499999999996 22.575 90-91 23.025000000000002 27.700000000000003 27.150000000000002 22.125 92-93 24.875 27.85 26.35 20.925 94-95 23.7 27.6375 26.6 22.0625 96-97 23.75 28.537499999999998 26.025 21.6875 98-99 25.074999999999996 27.525 26.25 21.15 100-101 25.087500000000002 27.8875 25.874999999999996 21.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 0.0 28 5.0 29 9.5 30 15.0 31 20.5 32 19.5 33 26.5 34 39.0 35 46.0 36 67.5 37 97.5 38 110.5 39 143.5 40 193.5 41 220.5 42 233.0 43 266.5 44 279.0 45 284.0 46 285.5 47 260.5 48 233.5 49 212.5 50 181.5 51 136.5 52 128.0 53 119.5 54 90.0 55 65.0 56 52.0 57 41.0 58 28.0 59 19.5 60 19.0 61 14.5 62 7.5 63 7.0 64 5.5 65 3.0 66 1.0 67 0.5 68 2.0 69 1.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2375 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.75 0.0 0.0 0.0 0.0 82-83 0.9 0.0 0.0 0.0 0.0 84-85 1.175 0.0 0.0 0.0 0.0 86-87 1.3875 0.0 0.0 0.0 0.0 88-89 1.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTAG 15 0.009957196 47.5 60-61 >>END_MODULE Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra Read 788934 spots for ERR1864437.sra Written 788934 spots for ERR1864437.sra SRR ids: ['ERR1864437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7gsgq1p ERR1864437.sra spots: 15778680 blocks: [[1, 788934], [788935, 1577868], [1577869, 2366802], [2366803, 3155736], [3155737, 3944670], [3944671, 4733604], [4733605, 5522538], [5522539, 6311472], [6311473, 7100406], [7100407, 7889340], [7889341, 8678274], [8678275, 9467208], [9467209, 10256142], [10256143, 11045076], [11045077, 11834010], [11834011, 12622944], [12622945, 13411878], [13411879, 14200812], [14200813, 14989746], [14989747, 15778680]] ERR1864437 file size 3784289 ERR1864437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864437 ERR1864437_1.fastq ERR1864437_2.fastq Input file: ERR1864437_1.fastq Paired file: ERR1864437_2.fastq trimmed: ERR1864437-trimmed-pair1.fastq, ERR1864437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:42:35 2025 >> started Thu Feb 13 09:48:23 2025 >> done (348.380s) 15778680 read pairs processed; of these: 274799 ( 1.74%) short read pairs filtered out after trimming by size control 340012 ( 2.15%) empty read pairs filtered out after trimming by size control 15163869 (96.10%) read pairs available; of these: 3724887 (24.56%) trimmed read pairs available after processing 11438982 (75.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 123 0.00% 19 271 0.00% 20 424 0.00% 21 582 0.00% 22 696 0.00% 23 885 0.01% 24 1093 0.01% 25 1238 0.01% 26 1504 0.01% 27 1670 0.01% 28 1964 0.01% 29 2222 0.01% 30 2585 0.02% 31 2814 0.02% 32 3159 0.02% 33 3500 0.02% 34 3938 0.03% 35 4201 0.03% 36 4448 0.03% 37 4844 0.03% 38 5132 0.03% 39 5324 0.04% 40 5673 0.04% 41 6092 0.04% 42 6334 0.04% 43 6655 0.04% 44 7129 0.05% 45 7481 0.05% 46 7813 0.05% 47 8153 0.05% 48 8629 0.06% 49 9000 0.06% 50 9507 0.06% 51 10047 0.07% 52 10570 0.07% 53 11137 0.07% 54 11280 0.07% 55 12313 0.08% 56 12895 0.09% 57 13497 0.09% 58 14488 0.10% 59 18572 0.12% 60 21860 0.14% 61 22621 0.15% 62 23021 0.15% 63 23870 0.16% 64 24359 0.16% 65 25357 0.17% 66 25966 0.17% 67 27001 0.18% 68 28256 0.19% 69 29974 0.20% 70 30819 0.20% 71 32251 0.21% 72 33893 0.22% 73 35210 0.23% 74 37170 0.25% 75 38086 0.25% 76 38394 0.25% 77 40285 0.27% 78 42300 0.28% 79 44942 0.30% 80 48060 0.32% 81 50292 0.33% 82 53074 0.35% 83 55798 0.37% 84 59916 0.40% 85 64424 0.42% 86 68919 0.45% 87 72765 0.48% 88 74544 0.49% 89 77936 0.51% 90 86654 0.57% 91 95166 0.63% 92 105180 0.69% 93 118784 0.78% 94 134794 0.89% 95 153361 1.01% 96 179509 1.18% 97 217881 1.44% 98 278484 1.84% 99 364493 2.40% 100 489336 3.23% 101 11438982 75.44% 15163869 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=2.1 sequence=GCGAAGAAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=46.96 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.3 sequence=TCAACAATTCTCGCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAATGATATTCATCTCCAAAAACCCAATAAAAA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.32 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=54.37 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.4 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC ERR1864437 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:23:10 Started mapping on | Feb 13 10:23:18 Finished on | Feb 13 11:05:40 Mapping speed, Million of reads per hour | 21.48 Number of input reads | 15163869 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 14627919 Uniquely mapped reads % | 96.47% Average mapped length | 195.10 Number of splices: Total | 9091349 Number of splices: Annotated (sjdb) | 8985451 Number of splices: GT/AG | 8924680 Number of splices: GC/AG | 148894 Number of splices: AT/AC | 5938 Number of splices: Non-canonical | 11837 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348159 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 48786 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 219637 219637 219637 N_multimapping 348159 348159 348159 N_noFeature 242450 14479328 297589 N_ambiguous 141976 488 48279 UnstrandedReadsAssigned:14243493 PositiveStrandReadsAssigned:148103 NegativeStrandReadsAssigned:14282051 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864437-trimmed-pair1.fastq ERR1864437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,163,869 reads, 14,488,832 reads pseudoaligned [quant] estimated average fragment length: 148.862 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 ERR1864437.ke.tsv 34699 ERR1864437.se.tsv 87100 total ==> ERR1864437.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1870.14 2031 71.9007 Potri.005G024800.1.v4.1 1035 887.138 414 30.8963 Potri.004G059700.1.v4.1 961 813.138 25 2.03551 Potri.007G009000.2.v4.1 1416 1268.14 0 0 Potri.003G141000.2.v4.1 2943 2795.14 1244.36 29.4741 Potri.016G087400.1.v4.1 270 126.723 706.712 369.219 Potri.015G069301.1.v4.1 564 416.187 0 0 Potri.010G195200.1.v4.1 1773 1625.14 83 3.38131 Potri.012G127500.1.v4.1 977 829.138 68 5.42974 ==> ERR1864437.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 61 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 ERR1864437 completed mapping pipeline successfully