Starting /dee2/code/volunteer_pipeline.sh ERR1864438 current disk space = 3052797681664 free memory = 1579790216 ERR1864438 SRAfilesize 6dfc02494670dd3731054b55a1b25ecd ERR1864438.sra ERR1864438.sra file validated ERR1864438 is paired end ERR1864438 is conventional basespace ERR1864438 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4445 34.0 31.0 34.0 30.0 34.0 2 32.02825 34.0 31.0 34.0 30.0 34.0 3 32.31575 34.0 31.0 34.0 30.0 34.0 4 35.8115 37.0 35.0 37.0 35.0 37.0 5 35.45 37.0 35.0 37.0 33.0 37.0 6 35.629 37.0 35.0 37.0 33.0 37.0 7 35.682 37.0 35.0 37.0 35.0 37.0 8 35.57175 37.0 36.0 37.0 35.0 37.0 9 37.2705 39.0 38.0 39.0 34.0 39.0 10-11 37.229625 39.0 38.0 39.0 34.0 39.0 12-13 37.12025 39.0 38.0 39.0 33.5 39.0 14-15 38.643625 41.0 39.0 41.0 34.5 41.0 16-17 38.498875 41.0 38.5 41.0 34.0 41.0 18-19 38.533874999999995 41.0 38.5 41.0 34.0 41.0 20-21 38.461625 41.0 39.0 41.0 34.0 41.0 22-23 38.468125 41.0 39.0 41.0 34.0 41.0 24-25 38.282125 40.5 38.5 41.0 34.0 41.0 26-27 38.37375 41.0 39.0 41.0 34.0 41.0 28-29 38.31325 41.0 38.5 41.0 34.0 41.0 30-31 38.299125000000004 41.0 38.0 41.0 33.5 41.0 32-33 38.187875 40.0 38.0 41.0 33.5 41.0 34-35 37.960499999999996 40.0 38.0 41.0 33.0 41.0 36-37 37.95725 40.0 38.0 41.0 33.0 41.0 38-39 37.874624999999995 40.0 38.0 41.0 33.0 41.0 40-41 37.949749999999995 40.0 38.0 41.0 33.0 41.0 42-43 37.843 40.0 38.0 41.0 33.0 41.0 44-45 37.699124999999995 40.0 38.0 41.0 33.0 41.0 46-47 37.517375 40.0 38.0 41.0 32.0 41.0 48-49 37.512375000000006 40.0 37.5 41.0 32.0 41.0 50-51 37.36275 40.0 37.5 41.0 32.0 41.0 52-53 37.196 40.0 37.0 41.0 31.0 41.0 54-55 36.95675 40.0 37.0 41.0 31.0 41.0 56-57 36.721125 39.5 36.0 41.0 30.5 41.0 58-59 36.442375 39.0 36.0 41.0 29.5 41.0 60-61 36.385125 39.0 35.5 41.0 29.5 41.0 62-63 36.3315 39.0 35.0 41.0 30.0 41.0 64-65 36.147875 38.5 35.0 40.5 30.5 41.0 66-67 35.717124999999996 38.0 35.0 40.0 29.0 41.0 68-69 35.413624999999996 37.0 35.0 40.0 29.5 41.0 70-71 34.7445 36.5 34.0 39.0 28.5 41.0 72-73 34.338499999999996 36.0 34.0 39.0 28.0 40.0 74-75 33.7665 35.5 33.5 38.0 27.0 39.5 76-77 32.126625 34.5 31.5 36.0 25.5 39.0 78-79 32.855999999999995 35.0 33.0 37.0 26.0 39.0 80-81 32.9195 35.0 34.0 36.0 27.5 38.0 82-83 32.586375000000004 35.0 33.0 36.0 27.0 37.0 84-85 32.30500000000001 35.0 33.0 35.5 26.5 37.0 86-87 32.052375 35.0 33.0 35.0 26.0 36.0 88-89 31.811374999999998 35.0 33.0 35.0 26.0 36.0 90-91 31.609 35.0 33.0 35.0 25.5 36.0 92-93 31.341625 35.0 32.5 35.0 24.5 35.5 94-95 31.212875 35.0 32.5 35.0 25.0 35.0 96-97 31.0165 35.0 33.0 35.0 23.0 35.0 98-99 30.696375 34.5 32.0 35.0 21.0 35.0 100-101 29.548375 33.5 30.5 34.5 8.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 10.0 4 10.0 5 6.0 6 4.0 7 4.0 8 6.0 9 7.0 10 1.0 11 7.0 12 4.0 13 5.0 14 4.0 15 11.0 16 7.0 17 6.0 18 9.0 19 13.0 20 10.0 21 19.0 22 15.0 23 20.0 24 18.0 25 30.0 26 17.0 27 35.0 28 33.0 29 38.0 30 49.0 31 65.0 32 99.0 33 124.0 34 157.0 35 213.0 36 400.0 37 879.0 38 1436.0 39 203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.15167095115681 10.359897172236504 9.3573264781491 51.131105398457585 2 19.925 16.3 41.25 22.525000000000002 3 20.525 21.475 23.35 34.65 4 22.275 29.075 21.85 26.8 5 22.575 33.6 24.9 18.925 6 17.525 35.525 25.974999999999998 20.974999999999998 7 13.3 24.875 43.5 18.325 8 18.0 23.5 32.824999999999996 25.674999999999997 9 17.65 23.25 34.875 24.224999999999998 10-11 20.6625 33.425 24.6625 21.25 12-13 20.1625 25.7 29.037499999999998 25.1 14-15 19.3375 27.6375 28.3125 24.712500000000002 16-17 20.549999999999997 28.262500000000003 27.525 23.6625 18-19 20.3125 28.475 27.2625 23.95 20-21 20.225 28.512500000000003 28.025 23.2375 22-23 20.7 28.375 27.525 23.400000000000002 24-25 20.7375 29.15 26.6125 23.5 26-27 19.75 28.975 28.349999999999998 22.925 28-29 19.950000000000003 28.625 27.975 23.45 30-31 19.45 28.462500000000002 28.125 23.962500000000002 32-33 20.9375 27.462500000000002 27.5125 24.087500000000002 34-35 20.2875 28.1625 27.650000000000002 23.9 36-37 20.7 28.025 26.887499999999996 24.3875 38-39 20.075000000000003 27.6 27.987499999999997 24.337500000000002 40-41 20.4875 28.487499999999997 27.450000000000003 23.575 42-43 19.787499999999998 27.5875 28.425 24.2 44-45 20.1 28.1 27.900000000000002 23.9 46-47 20.1125 28.3875 27.8625 23.6375 48-49 20.525 27.962500000000002 27.500000000000004 24.0125 50-51 20.599999999999998 28.1375 27.425 23.8375 52-53 20.45 28.725 26.9125 23.9125 54-55 19.9625 28.825 26.775 24.4375 56-57 21.2625 27.6625 27.325 23.75 58-59 20.2625 29.262500000000003 26.937499999999996 23.5375 60-61 20.625 28.425 26.3625 24.587500000000002 62-63 20.5625 28.7 27.474999999999998 23.2625 64-65 20.7375 28.050000000000004 27.625 23.5875 66-67 20.2625 28.875 27.575 23.2875 68-69 20.5125 28.0875 27.8375 23.5625 70-71 21.75 27.250000000000004 27.075 23.925 72-73 20.424999999999997 28.299999999999997 27.962500000000002 23.3125 74-75 20.674999999999997 26.525 28.475 24.325 76-77 21.587500000000002 27.675 27.712500000000002 23.025000000000002 78-79 19.525000000000002 29.125 27.250000000000004 24.099999999999998 80-81 21.175 28.262500000000003 27.287499999999998 23.275000000000002 82-83 20.525 28.65 27.787499999999998 23.0375 84-85 20.9125 27.8625 27.987499999999997 23.2375 86-87 20.6125 28.1125 27.462500000000002 23.8125 88-89 21.825 28.237499999999997 27.175 22.7625 90-91 21.325 27.200000000000003 27.287499999999998 24.1875 92-93 20.525 27.6125 28.237499999999997 23.625 94-95 20.7875 28.9 27.6 22.7125 96-97 20.8 28.512500000000003 26.8625 23.825 98-99 20.865108138517314 29.041130141267658 26.690836354544317 23.40292536567071 100-101 21.8 28.8875 26.400000000000002 22.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 3.5 27 4.0 28 6.5 29 12.0 30 17.0 31 20.0 32 22.0 33 36.0 34 50.0 35 56.0 36 79.0 37 112.5 38 128.5 39 152.0 40 189.5 41 217.5 42 248.0 43 262.0 44 273.0 45 282.5 46 274.5 47 255.5 48 236.0 49 214.5 50 179.5 51 147.5 52 117.0 53 88.0 54 70.5 55 54.5 56 43.0 57 36.5 58 24.5 59 18.0 60 15.5 61 10.5 62 5.0 63 2.0 64 3.5 65 6.0 66 4.5 67 2.5 68 2.5 69 3.0 70 3.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.2625 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.3375 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 0.95 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864438 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12675 33.0 31.0 34.0 30.0 34.0 2 32.19425 34.0 31.0 34.0 30.0 34.0 3 32.0855 34.0 31.0 34.0 30.0 34.0 4 35.51025 37.0 35.0 37.0 33.0 37.0 5 35.56375 37.0 35.0 37.0 33.0 37.0 6 35.5005 37.0 36.0 37.0 33.0 37.0 7 35.633 37.0 36.0 37.0 33.0 37.0 8 35.53875 37.0 36.0 37.0 33.0 37.0 9 37.1675 39.0 37.0 39.0 33.0 39.0 10-11 37.245125 39.0 38.0 39.0 33.5 39.0 12-13 37.16975 39.0 37.5 39.0 33.5 39.0 14-15 38.635125 41.0 39.0 41.0 34.5 41.0 16-17 38.518375 41.0 38.0 41.0 34.0 41.0 18-19 38.562375 41.0 38.5 41.0 34.0 41.0 20-21 38.48175 41.0 38.5 41.0 34.0 41.0 22-23 38.53175 41.0 39.0 41.0 34.0 41.0 24-25 38.167874999999995 40.0 38.0 41.0 33.0 41.0 26-27 38.047125 40.0 38.0 41.0 33.0 41.0 28-29 38.045249999999996 40.0 38.0 41.0 33.0 41.0 30-31 37.997375 40.0 38.0 41.0 33.0 41.0 32-33 37.806375 40.0 38.0 41.0 32.0 41.0 34-35 37.815875 40.0 38.0 41.0 32.0 41.0 36-37 37.663125 40.0 38.0 41.0 31.5 41.0 38-39 37.50375 40.0 38.0 41.0 31.0 41.0 40-41 37.51775000000001 40.0 38.0 41.0 31.0 41.0 42-43 37.2625 40.0 37.5 41.0 30.5 41.0 44-45 37.329625 40.0 37.0 41.0 30.5 41.0 46-47 37.120374999999996 40.0 37.0 41.0 30.5 41.0 48-49 37.25775 40.0 37.0 41.0 31.0 41.0 50-51 36.333124999999995 39.0 36.0 40.0 29.5 40.5 52-53 36.405625 39.0 36.0 40.0 30.0 41.0 54-55 36.566125 39.0 36.0 41.0 29.5 41.0 56-57 36.33725 39.0 35.5 41.0 29.0 41.0 58-59 36.09825 39.0 35.0 41.0 28.5 41.0 60-61 35.849125 39.0 35.0 40.5 28.5 41.0 62-63 35.587500000000006 38.5 35.0 40.0 28.0 41.0 64-65 35.211 38.0 34.5 40.0 27.0 41.0 66-67 35.277375 37.5 35.0 40.0 28.0 41.0 68-69 34.928250000000006 37.0 34.5 39.5 28.0 41.0 70-71 34.329 36.5 34.0 39.0 26.0 41.0 72-73 34.000625 36.0 34.0 39.0 26.5 40.5 74-75 32.88125 35.0 33.0 37.0 23.5 39.0 76-77 33.011375 35.0 33.0 37.0 26.0 39.0 78-79 32.27575 35.0 33.0 36.5 24.5 38.0 80-81 32.258625 35.0 33.0 36.0 25.5 37.0 82-83 31.9375 35.0 33.0 36.0 24.5 37.0 84-85 31.793 35.0 33.0 35.0 25.0 36.5 86-87 31.641750000000002 35.0 33.0 35.0 25.0 36.0 88-89 31.35325 35.0 32.0 35.0 24.0 36.0 90-91 31.0235 35.0 32.0 35.0 23.0 35.0 92-93 30.970374999999997 35.0 32.0 35.0 20.5 35.0 94-95 30.729875 35.0 32.0 35.0 20.0 35.0 96-97 30.338625 35.0 32.0 35.0 14.5 35.0 98-99 30.02275 34.5 31.5 35.0 2.0 35.0 100-101 28.823875 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 5.0 5 4.0 6 1.0 7 6.0 8 7.0 9 6.0 10 8.0 11 10.0 12 12.0 13 14.0 14 15.0 15 14.0 16 8.0 17 16.0 18 16.0 19 10.0 20 12.0 21 12.0 22 19.0 23 16.0 24 28.0 25 28.0 26 36.0 27 41.0 28 47.0 29 51.0 30 65.0 31 91.0 32 97.0 33 118.0 34 163.0 35 236.0 36 405.0 37 929.0 38 1249.0 39 189.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.225 16.775000000000002 13.925 39.074999999999996 2 22.475 25.025 37.625 14.875 3 20.150000000000002 28.4 28.449999999999996 23.0 4 24.9 34.625 21.925 18.55 5 25.974999999999998 35.949999999999996 22.075 16.0 6 19.625 36.85 25.35 18.175 7 20.25 18.575 41.15 20.025000000000002 8 20.599999999999998 23.3 29.75 26.35 9 22.650000000000002 23.575 30.099999999999998 23.674999999999997 10-11 23.75 31.3125 23.45 21.4875 12-13 23.6625 24.5375 28.275 23.525 14-15 22.0125 28.749999999999996 28.012500000000003 21.224999999999998 16-17 24.675 27.3875 26.775 21.1625 18-19 23.65 28.025 27.6875 20.6375 20-21 23.2375 28.000000000000004 27.3875 21.375 22-23 23.3125 27.875 27.6875 21.125 24-25 23.05 28.4125 27.6875 20.849999999999998 26-27 23.075000000000003 28.4125 27.762500000000003 20.75 28-29 22.8375 28.6875 27.187499999999996 21.2875 30-31 23.65 28.225 27.462500000000002 20.6625 32-33 22.7125 28.1625 27.787499999999998 21.337500000000002 34-35 21.95 28.749999999999996 27.5125 21.7875 36-37 22.75 28.425 27.400000000000002 21.425 38-39 23.7875 28.499999999999996 26.9625 20.75 40-41 23.125 27.450000000000003 27.5125 21.912499999999998 42-43 22.775000000000002 28.6375 27.187499999999996 21.4 44-45 23.05 28.1125 27.800000000000004 21.0375 46-47 23.5125 27.575 27.725 21.1875 48-49 22.8375 28.000000000000004 27.737499999999997 21.425 50-51 23.9875 26.275 27.187499999999996 22.55 52-53 23.1125 27.625 28.0625 21.2 54-55 22.95 27.5125 28.262500000000003 21.275 56-57 23.8125 27.287499999999998 28.3625 20.5375 58-59 24.099999999999998 27.287499999999998 27.6875 20.925 60-61 23.4875 28.5875 27.525 20.4 62-63 23.5125 27.987499999999997 27.55 20.95 64-65 23.9125 27.875 27.975 20.2375 66-67 22.6875 27.5625 28.462500000000002 21.2875 68-69 23.30497873405054 28.658994245684262 27.808356267200402 20.2276707530648 70-71 23.925 27.400000000000002 28.625 20.05 72-73 24.3 27.3125 27.787499999999998 20.599999999999998 74-75 23.65 28.475 27.900000000000002 19.975 76-77 24.65 27.175 27.975 20.200000000000003 78-79 23.64045505688211 29.16614576822103 27.11588948618577 20.07750968871109 80-81 23.252906613326665 27.815976997124643 27.753469183647955 21.177647205900737 82-83 24.37804725590699 27.25340667583448 27.84098012251531 20.527565945743216 84-85 23.3375 28.1 28.012500000000003 20.549999999999997 86-87 23.97799724965621 28.178522315289413 27.50343792974122 20.340042505313164 88-89 24.762500000000003 27.0125 28.725 19.5 90-91 23.455863965991497 27.206801700425103 28.89472368092023 20.442610652663166 92-93 23.3125 27.725 29.0875 19.875 94-95 24.275 27.8375 27.700000000000003 20.1875 96-97 24.271237332666082 27.786813461779058 28.26222945076942 19.679719754785438 98-99 23.75296912114014 27.853481685210653 27.065883235404424 21.327665958244783 100-101 25.0 27.224999999999998 27.1 20.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 0.5 24 1.5 25 1.0 26 2.0 27 3.0 28 4.0 29 7.5 30 12.0 31 15.5 32 18.0 33 27.5 34 42.5 35 52.0 36 73.0 37 104.5 38 130.0 39 153.5 40 189.0 41 233.5 42 268.5 43 293.0 44 291.5 45 274.5 46 272.5 47 269.0 48 246.5 49 218.5 50 178.5 51 136.0 52 108.0 53 82.5 54 64.0 55 48.0 56 38.0 57 34.5 58 26.0 59 18.0 60 11.5 61 9.0 62 7.0 63 5.0 64 4.5 65 5.0 66 4.0 67 2.5 68 3.0 69 1.5 70 1.0 71 1.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.075 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0125 82-83 0.0125 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.08750000000000001 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.275 0.0 0.0 0.0 0.0 70-71 0.3125 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.725 0.0 0.0 0.0 0.0 84-85 0.8999999999999999 0.0 0.0 0.0 0.0 86-87 1.125 0.0 0.0 0.0 0.0 88-89 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 885996 spots for ERR1864438.sra Written 885996 spots for ERR1864438.sra Read 886010 spots for ERR1864438.sra Written 886010 spots for ERR1864438.sra SRR ids: ['ERR1864438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tgl68pxg ERR1864438.sra spots: 17719934 blocks: [[1, 885996], [885997, 1771992], [1771993, 2657988], [2657989, 3543984], [3543985, 4429980], [4429981, 5315976], [5315977, 6201972], [6201973, 7087968], [7087969, 7973964], [7973965, 8859960], [8859961, 9745956], [9745957, 10631952], [10631953, 11517948], [11517949, 12403944], [12403945, 13289940], [13289941, 14175936], [14175937, 15061932], [15061933, 15947928], [15947929, 16833924], [16833925, 17719934]] ERR1864438 file size 4252541 ERR1864438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864438 ERR1864438_1.fastq ERR1864438_2.fastq Input file: ERR1864438_1.fastq Paired file: ERR1864438_2.fastq trimmed: ERR1864438-trimmed-pair1.fastq, ERR1864438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:50:21 2025 >> started Thu Feb 13 09:55:03 2025 >> done (282.226s) 17719934 read pairs processed; of these: 184568 ( 1.04%) short read pairs filtered out after trimming by size control 205923 ( 1.16%) empty read pairs filtered out after trimming by size control 17329443 (97.80%) read pairs available; of these: 4205165 (24.27%) trimmed read pairs available after processing 13124278 (75.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 99 0.00% 19 199 0.00% 20 344 0.00% 21 485 0.00% 22 564 0.00% 23 807 0.00% 24 856 0.00% 25 1030 0.01% 26 1282 0.01% 27 1460 0.01% 28 1657 0.01% 29 1884 0.01% 30 2274 0.01% 31 2622 0.02% 32 2838 0.02% 33 3320 0.02% 34 3533 0.02% 35 3896 0.02% 36 4261 0.02% 37 4476 0.03% 38 4828 0.03% 39 5398 0.03% 40 5762 0.03% 41 6100 0.04% 42 6475 0.04% 43 6877 0.04% 44 7276 0.04% 45 7699 0.04% 46 8154 0.05% 47 8571 0.05% 48 8799 0.05% 49 9380 0.05% 50 9685 0.06% 51 10247 0.06% 52 10804 0.06% 53 11217 0.06% 54 11758 0.07% 55 12458 0.07% 56 13088 0.08% 57 13578 0.08% 58 14601 0.08% 59 18005 0.10% 60 20597 0.12% 61 21369 0.12% 62 22160 0.13% 63 23604 0.14% 64 24047 0.14% 65 25067 0.14% 66 26138 0.15% 67 27062 0.16% 68 28196 0.16% 69 29526 0.17% 70 30961 0.18% 71 32813 0.19% 72 34833 0.20% 73 37526 0.22% 74 38604 0.22% 75 39912 0.23% 76 39681 0.23% 77 41476 0.24% 78 43281 0.25% 79 45232 0.26% 80 47556 0.27% 81 49655 0.29% 82 52179 0.30% 83 55906 0.32% 84 59897 0.35% 85 64817 0.37% 86 68606 0.40% 87 74516 0.43% 88 76293 0.44% 89 79433 0.46% 90 88340 0.51% 91 97968 0.57% 92 107770 0.62% 93 120943 0.70% 94 138046 0.80% 95 158662 0.92% 96 189298 1.09% 97 234873 1.36% 98 311300 1.80% 99 435781 2.51% 100 812594 4.69% 101 13124278 75.73% 17329443 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=14 prefix-density=0.23 prefix-fanout=2.5 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=311.84 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=29.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAGACCAGCAGAGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=337.63 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=30.2 sequence=AAGAAGAAGAAA ERR1864438 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:09:57 Started mapping on | Feb 13 10:10:00 Finished on | Feb 13 10:48:27 Mapping speed, Million of reads per hour | 27.04 Number of input reads | 17329443 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 16518063 Uniquely mapped reads % | 95.32% Average mapped length | 195.92 Number of splices: Total | 9569698 Number of splices: Annotated (sjdb) | 9420245 Number of splices: GT/AG | 9423487 Number of splices: GC/AG | 123567 Number of splices: AT/AC | 8462 Number of splices: Non-canonical | 14182 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483533 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 19105 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 346622 346622 346622 N_multimapping 483533 483533 483533 N_noFeature 376710 16337956 486435 N_ambiguous 138499 734 67625 UnstrandedReadsAssigned:16002854 PositiveStrandReadsAssigned:179373 NegativeStrandReadsAssigned:15964003 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864438-trimmed-pair1.fastq ERR1864438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,329,443 reads, 16,207,789 reads pseudoaligned [quant] estimated average fragment length: 167.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 ERR1864438.ke.tsv 34699 ERR1864438.se.tsv 87100 total ==> ERR1864438.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1851.84 1579 57.3126 Potri.005G024800.1.v4.1 1035 868.842 808 62.509 Potri.004G059700.1.v4.1 961 794.847 89 7.52625 Potri.007G009000.2.v4.1 1416 1249.84 0 0 Potri.003G141000.2.v4.1 2943 2776.84 858.354 20.7772 Potri.016G087400.1.v4.1 270 115.171 1107 646.067 Potri.015G069301.1.v4.1 564 398.001 0 0 Potri.010G195200.1.v4.1 1773 1606.84 227 9.49565 Potri.012G127500.1.v4.1 977 810.842 11801 978.261 ==> ERR1864438.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 383 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 104 ERR1864438 completed mapping pipeline successfully