Starting /dee2/code/volunteer_pipeline.sh ERR1864439 current disk space = 3052688195584 free memory = 1432491136 ERR1864439 SRAfilesize 93fd25d6cc1afe80705cd422a3fe08ec ERR1864439.sra ERR1864439.sra file validated ERR1864439 is paired end ERR1864439 is conventional basespace ERR1864439 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5695 34.0 31.0 34.0 30.0 34.0 2 32.101 34.0 31.0 34.0 30.0 34.0 3 32.39775 34.0 31.0 34.0 30.0 34.0 4 35.82925 37.0 35.0 37.0 35.0 37.0 5 35.504 37.0 35.0 37.0 33.0 37.0 6 35.6455 37.0 35.0 37.0 35.0 37.0 7 35.67725 37.0 36.0 37.0 35.0 37.0 8 35.5665 37.0 36.0 37.0 33.0 37.0 9 37.31225 39.0 38.0 39.0 34.0 39.0 10-11 37.2595 39.0 38.0 39.0 34.5 39.0 12-13 37.098749999999995 39.0 37.5 39.0 33.5 39.0 14-15 38.658125 41.0 39.0 41.0 34.0 41.0 16-17 38.547625 41.0 39.0 41.0 34.0 41.0 18-19 38.547375 41.0 38.5 41.0 34.0 41.0 20-21 38.48825 41.0 39.0 41.0 34.0 41.0 22-23 38.45 41.0 39.0 41.0 34.0 41.0 24-25 38.357625 40.5 38.5 41.0 33.5 41.0 26-27 38.408625 40.5 38.5 41.0 33.5 41.0 28-29 38.3645 41.0 38.0 41.0 34.0 41.0 30-31 38.2685 40.5 38.0 41.0 33.5 41.0 32-33 38.155125 40.0 38.0 41.0 33.0 41.0 34-35 38.066125 40.0 38.0 41.0 33.5 41.0 36-37 37.991625 40.0 38.0 41.0 33.0 41.0 38-39 37.91575 40.0 38.0 41.0 33.0 41.0 40-41 37.8865 40.0 38.0 41.0 33.0 41.0 42-43 37.768249999999995 40.0 38.0 41.0 32.5 41.0 44-45 37.603625 40.0 38.0 41.0 32.0 41.0 46-47 37.497749999999996 40.0 38.0 41.0 32.0 41.0 48-49 37.4735 40.0 38.0 41.0 32.0 41.0 50-51 37.301 40.0 37.5 41.0 32.0 41.0 52-53 37.134874999999994 40.0 37.0 41.0 31.0 41.0 54-55 36.948499999999996 40.0 36.5 41.0 30.5 41.0 56-57 36.69025 40.0 36.0 41.0 30.5 41.0 58-59 36.43 39.0 36.0 41.0 29.5 41.0 60-61 36.20975 39.0 35.0 41.0 29.0 41.0 62-63 36.266 39.0 35.0 41.0 30.5 41.0 64-65 36.04725 39.0 35.0 40.5 30.0 41.0 66-67 35.693875000000006 38.0 35.0 40.0 29.5 41.0 68-69 35.429500000000004 37.5 35.0 40.0 29.5 41.0 70-71 34.597625 36.5 34.0 39.0 28.0 41.0 72-73 34.327625 36.0 34.0 39.0 28.0 40.0 74-75 33.681749999999994 35.5 33.5 38.0 27.0 39.5 76-77 31.981749999999998 34.5 31.0 36.0 25.5 39.0 78-79 32.7975 35.0 33.0 37.0 26.0 39.0 80-81 32.73025 35.0 33.0 36.5 26.5 38.0 82-83 32.453 35.0 33.0 36.0 26.0 37.0 84-85 32.167249999999996 35.0 33.0 36.0 26.0 37.0 86-87 31.941875000000003 35.0 33.0 35.0 26.0 36.0 88-89 31.689999999999998 35.0 33.0 35.0 25.5 36.0 90-91 31.579875 35.0 33.0 35.0 25.0 36.0 92-93 31.343 35.0 32.5 35.0 24.5 35.5 94-95 31.120625 35.0 32.0 35.0 24.0 35.0 96-97 30.871375 35.0 32.0 35.0 21.5 35.0 98-99 30.5565 35.0 32.0 35.0 19.0 35.0 100-101 29.609250000000003 33.5 30.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 15.0 4 8.0 5 7.0 6 2.0 7 2.0 8 4.0 9 7.0 10 9.0 11 7.0 12 12.0 13 2.0 14 12.0 15 14.0 16 9.0 17 10.0 18 14.0 19 17.0 20 9.0 21 17.0 22 7.0 23 18.0 24 14.0 25 22.0 26 18.0 27 24.0 28 36.0 29 44.0 30 47.0 31 92.0 32 80.0 33 126.0 34 149.0 35 204.0 36 411.0 37 909.0 38 1375.0 39 231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.81286849525763 10.279415534478339 9.971802102025123 49.93591386823891 2 19.775000000000002 16.075 41.85 22.3 3 20.65 21.15 24.425 33.775 4 23.3 30.675 21.175 24.85 5 21.675 34.150000000000006 24.9 19.275000000000002 6 16.125 36.175000000000004 28.000000000000004 19.7 7 15.0 24.625 43.65 16.725 8 17.875 23.425 32.65 26.05 9 17.724999999999998 22.275 36.675000000000004 23.325000000000003 10-11 20.3 33.425 24.5 21.775 12-13 20.6375 26.275 28.5625 24.525 14-15 19.625 28.537499999999998 28.65 23.1875 16-17 20.962500000000002 28.8375 26.825 23.375 18-19 20.3 29.5375 27.237499999999997 22.925 20-21 19.8375 28.549999999999997 28.425 23.1875 22-23 19.625 29.0875 27.700000000000003 23.5875 24-25 19.787499999999998 29.362500000000004 26.974999999999998 23.875 26-27 19.112499999999997 29.3875 28.125 23.375 28-29 19.6375 28.6125 27.650000000000002 24.099999999999998 30-31 19.5625 28.6125 28.325 23.5 32-33 20.0 29.175 27.05 23.775 34-35 20.7125 28.712500000000002 27.800000000000004 22.775000000000002 36-37 19.787499999999998 29.062500000000004 27.8625 23.2875 38-39 19.6875 28.762500000000003 29.275000000000002 22.275 40-41 20.175 28.3875 27.575 23.8625 42-43 20.25 28.199999999999996 28.349999999999998 23.200000000000003 44-45 20.2375 28.499999999999996 28.9875 22.275 46-47 20.3875 28.175 27.55 23.8875 48-49 20.3125 27.575 28.199999999999996 23.9125 50-51 20.6625 28.425 26.787499999999998 24.125 52-53 20.3125 28.6625 27.800000000000004 23.225 54-55 20.0125 28.575 27.250000000000004 24.1625 56-57 20.200000000000003 28.4 27.187499999999996 24.212500000000002 58-59 20.05 29.012500000000003 27.4125 23.525 60-61 20.5875 27.775 28.0875 23.549999999999997 62-63 21.087500000000002 28.575 26.6125 23.724999999999998 64-65 19.9375 28.9 27.0875 24.075 66-67 21.087500000000002 28.425 26.937499999999996 23.549999999999997 68-69 20.7125 28.325 27.725 23.2375 70-71 19.425 29.225 27.525 23.825 72-73 20.7625 28.249999999999996 27.712500000000002 23.275000000000002 74-75 20.525 27.8375 27.6875 23.95 76-77 20.549999999999997 28.462500000000002 26.4125 24.575 78-79 19.9625 28.5625 27.6875 23.7875 80-81 20.2875 28.275 27.775 23.6625 82-83 20.375 29.037499999999998 27.5625 23.025000000000002 84-85 21.15 27.487499999999997 27.775 23.5875 86-87 21.099999999999998 27.875 27.250000000000004 23.775 88-89 21.0375 29.049999999999997 26.900000000000002 23.0125 90-91 20.95 28.000000000000004 27.8625 23.1875 92-93 20.8 27.35 27.8375 24.0125 94-95 20.75 29.25 26.375 23.625 96-97 21.5625 28.1875 26.9125 23.3375 98-99 21.2625 28.462500000000002 26.987499999999997 23.2875 100-101 21.4125 28.8875 26.137500000000003 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.5 26 3.0 27 6.5 28 9.5 29 9.5 30 14.0 31 18.5 32 33.0 33 44.5 34 47.5 35 69.5 36 94.5 37 110.5 38 132.5 39 161.5 40 194.5 41 234.0 42 262.0 43 285.5 44 282.0 45 276.0 46 274.0 47 244.0 48 219.5 49 194.5 50 162.5 51 135.5 52 113.5 53 90.5 54 62.0 55 42.5 56 35.5 57 29.5 58 21.0 59 14.5 60 12.5 61 10.5 62 10.5 63 6.5 64 4.5 65 5.5 66 5.0 67 3.5 68 1.5 69 1.0 70 1.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.725 0.0 0.0 0.0 0.0 82-83 0.7875 0.0 0.0 0.0 0.0 84-85 1.175 0.0 0.0 0.0 0.0 86-87 1.5375 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864439 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0875 34.0 31.0 34.0 30.0 34.0 2 32.1995 34.0 31.0 34.0 30.0 34.0 3 32.1055 34.0 31.0 34.0 30.0 34.0 4 35.53025 37.0 35.0 37.0 33.0 37.0 5 35.595 37.0 35.0 37.0 33.0 37.0 6 35.59275 37.0 36.0 37.0 33.0 37.0 7 35.60825 37.0 36.0 37.0 33.0 37.0 8 35.6235 37.0 35.0 37.0 33.0 37.0 9 37.168 39.0 37.0 39.0 34.0 39.0 10-11 37.18125 39.0 37.5 39.0 33.0 39.0 12-13 37.12675 39.0 37.5 39.0 33.5 39.0 14-15 38.5715 41.0 38.0 41.0 34.0 41.0 16-17 38.489875 41.0 38.0 41.0 33.5 41.0 18-19 38.546875 41.0 38.5 41.0 34.0 41.0 20-21 38.51075 41.0 39.0 41.0 34.0 41.0 22-23 38.466499999999996 41.0 38.5 41.0 34.0 41.0 24-25 38.17275 40.0 38.0 41.0 33.0 41.0 26-27 38.0295 40.0 38.0 41.0 33.0 41.0 28-29 37.911 40.0 38.0 41.0 32.5 41.0 30-31 37.94725 40.0 38.0 41.0 33.0 41.0 32-33 37.770125 40.0 38.0 41.0 32.0 41.0 34-35 37.790625000000006 40.0 38.0 41.0 33.0 41.0 36-37 37.68775 40.0 38.0 41.0 32.0 41.0 38-39 37.569125 40.0 38.0 41.0 31.0 41.0 40-41 37.609625 40.0 38.0 41.0 32.0 41.0 42-43 37.31175 40.0 37.5 41.0 30.5 41.0 44-45 37.378375000000005 40.0 38.0 41.0 31.0 41.0 46-47 37.094125000000005 40.0 37.0 41.0 30.5 41.0 48-49 37.1605 40.0 37.0 41.0 31.0 41.0 50-51 36.231875 39.0 36.0 40.5 29.5 40.5 52-53 36.255875 39.0 36.0 40.0 30.0 41.0 54-55 36.565875 39.0 36.0 41.0 30.0 41.0 56-57 36.356125 39.0 36.0 41.0 29.5 41.0 58-59 36.05 39.0 35.0 41.0 28.0 41.0 60-61 35.740875 39.0 35.0 40.5 28.0 41.0 62-63 35.6195 38.5 35.0 40.0 28.0 41.0 64-65 35.28125 38.0 34.5 40.0 28.0 41.0 66-67 35.30275 37.5 35.0 40.0 28.0 41.0 68-69 35.044 37.0 35.0 39.5 28.0 41.0 70-71 34.305125000000004 36.5 34.0 39.0 26.0 41.0 72-73 33.993125 36.0 34.0 39.0 26.5 40.5 74-75 32.966375 35.0 33.0 37.0 24.5 39.0 76-77 33.03375 35.0 34.0 37.0 26.0 39.0 78-79 32.3925 35.0 33.0 36.5 24.5 38.5 80-81 32.302625 35.0 33.0 36.0 25.5 37.0 82-83 31.9725 35.0 32.5 36.0 25.0 37.0 84-85 31.75725 35.0 33.0 35.0 25.0 36.5 86-87 31.624375 35.0 33.0 35.0 24.5 36.0 88-89 31.474249999999998 35.0 33.0 35.0 24.0 36.0 90-91 31.204 35.0 32.0 35.0 23.5 36.0 92-93 31.174500000000002 35.0 32.5 35.0 23.0 35.0 94-95 30.878500000000003 35.0 32.0 35.0 20.0 35.0 96-97 30.602 35.0 32.0 35.0 18.5 35.0 98-99 30.213625 34.5 31.5 35.0 9.5 35.0 100-101 29.092125 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 4.0 4 4.0 5 5.0 6 5.0 7 5.0 8 6.0 9 5.0 10 8.0 11 11.0 12 9.0 13 13.0 14 12.0 15 15.0 16 13.0 17 12.0 18 15.0 19 16.0 20 11.0 21 13.0 22 18.0 23 19.0 24 26.0 25 23.0 26 33.0 27 30.0 28 50.0 29 52.0 30 55.0 31 60.0 32 93.0 33 123.0 34 188.0 35 236.0 36 437.0 37 907.0 38 1253.0 39 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.900000000000002 15.299999999999999 14.299999999999999 42.5 2 22.775000000000002 24.025 37.675 15.525 3 20.45 27.625 28.7 23.225 4 23.200000000000003 35.025 22.35 19.425 5 25.424999999999997 37.5 21.15 15.925 6 18.6 39.074999999999996 24.025 18.3 7 19.075 17.75 40.675 22.5 8 20.974999999999998 24.224999999999998 29.175 25.624999999999996 9 22.675 23.375 30.575000000000003 23.375 10-11 24.4375 31.7 23.2875 20.575 12-13 23.575 24.3625 27.6375 24.425 14-15 22.95 27.537499999999998 28.9375 20.575 16-17 23.6875 27.650000000000002 27.3125 21.349999999999998 18-19 22.975 27.800000000000004 27.487499999999997 21.7375 20-21 23.6375 28.499999999999996 26.650000000000002 21.212500000000002 22-23 22.725 28.4375 27.725 21.1125 24-25 22.35 28.7 27.224999999999998 21.725 26-27 24.1375 27.962500000000002 26.7625 21.1375 28-29 22.6125 28.5875 27.625 21.175 30-31 23.1625 28.599999999999998 27.0625 21.175 32-33 23.175 28.512500000000003 26.8 21.512500000000003 34-35 22.8375 28.249999999999996 28.000000000000004 20.9125 36-37 22.7625 27.4125 28.3125 21.512500000000003 38-39 23.0 28.499999999999996 27.800000000000004 20.7 40-41 22.35 27.712500000000002 28.537499999999998 21.4 42-43 22.3125 27.9375 29.037499999999998 20.7125 44-45 23.7125 28.475 27.6125 20.200000000000003 46-47 23.0125 28.325 27.762500000000003 20.9 48-49 22.6375 28.3125 28.0625 20.9875 50-51 22.9875 27.900000000000002 28.0875 21.025 52-53 23.2875 28.249999999999996 28.4 20.0625 54-55 23.625 27.725 27.250000000000004 21.4 56-57 24.0375 28.1125 27.224999999999998 20.625 58-59 23.35 26.55 28.65 21.45 60-61 22.175 28.299999999999997 28.475 21.05 62-63 23.525 27.900000000000002 28.199999999999996 20.375 64-65 23.5375 27.175 28.199999999999996 21.087500000000002 66-67 22.7 27.700000000000003 28.375 21.224999999999998 68-69 24.36859214803701 27.781945486371594 28.49462365591398 19.35483870967742 70-71 23.962500000000002 27.237499999999997 27.987499999999997 20.8125 72-73 23.45 27.800000000000004 28.425 20.325 74-75 23.1375 27.987499999999997 28.050000000000004 20.825 76-77 23.1125 27.8375 28.512500000000003 20.5375 78-79 24.75 27.05 28.15 20.05 80-81 23.543385846461614 27.35683920980245 28.119529882470616 20.980245061265315 82-83 23.400000000000002 27.9125 27.737499999999997 20.95 84-85 24.349999999999998 28.175 27.787499999999998 19.6875 86-87 24.281070267566893 28.28207051762941 27.394348587146787 20.042510627656913 88-89 23.7625 28.4375 27.437499999999996 20.3625 90-91 23.99349837459365 28.457114278569644 27.60690172543136 19.94248562140535 92-93 24.349999999999998 27.950000000000003 27.712500000000002 19.9875 94-95 24.5625 28.625 26.575 20.2375 96-97 23.93397524071527 28.6857571589346 27.11016631236714 20.270101287982996 98-99 24.603075384423054 27.853481685210653 27.053381672709087 20.490061257657207 100-101 24.7 28.3625 26.8125 20.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.5 26 3.0 27 4.0 28 5.0 29 7.0 30 8.5 31 11.0 32 21.0 33 38.0 34 45.5 35 55.0 36 75.0 37 101.5 38 132.5 39 171.0 40 199.0 41 217.5 42 273.0 43 310.5 44 295.5 45 277.0 46 263.0 47 249.5 48 230.0 49 196.0 50 168.5 51 140.5 52 111.0 53 90.0 54 71.5 55 52.0 56 33.0 57 28.0 58 25.0 59 23.0 60 15.0 61 8.0 62 8.5 63 6.5 64 4.5 65 4.5 66 5.0 67 2.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.025 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0375 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.48750000000000004 0.0 0.0 0.0 0.0 78-79 0.5875 0.0 0.0 0.0 0.0 80-81 0.725 0.0 0.0 0.0 0.0 82-83 0.7749999999999999 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.5375 0.0 0.0 0.0 0.0 88-89 1.9500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTGC 25 0.0046641747 57.0 7 >>END_MODULE Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816655 spots for ERR1864439.sra Written 816655 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra Read 816641 spots for ERR1864439.sra Written 816641 spots for ERR1864439.sra SRR ids: ['ERR1864439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_22pgomrk ERR1864439.sra spots: 16332834 blocks: [[1, 816641], [816642, 1633282], [1633283, 2449923], [2449924, 3266564], [3266565, 4083205], [4083206, 4899846], [4899847, 5716487], [5716488, 6533128], [6533129, 7349769], [7349770, 8166410], [8166411, 8983051], [8983052, 9799692], [9799693, 10616333], [10616334, 11432974], [11432975, 12249615], [12249616, 13066256], [13066257, 13882897], [13882898, 14699538], [14699539, 15516179], [15516180, 16332834]] ERR1864439 file size 3917957 ERR1864439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864439 ERR1864439_1.fastq ERR1864439_2.fastq Input file: ERR1864439_1.fastq Paired file: ERR1864439_2.fastq trimmed: ERR1864439-trimmed-pair1.fastq, ERR1864439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:21:15 2025 >> started Thu Feb 13 07:21:29 2025 >> done (14.747s) 16332834 read pairs processed; of these: 178340 ( 1.09%) short read pairs filtered out after trimming by size control 199182 ( 1.22%) empty read pairs filtered out after trimming by size control 15955312 (97.69%) read pairs available; of these: 4088658 (25.63%) trimmed read pairs available after processing 11866654 (74.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 89 0.00% 19 220 0.00% 20 326 0.00% 21 476 0.00% 22 598 0.00% 23 686 0.00% 24 841 0.01% 25 1034 0.01% 26 1237 0.01% 27 1415 0.01% 28 1619 0.01% 29 1822 0.01% 30 2194 0.01% 31 2454 0.02% 32 2690 0.02% 33 3071 0.02% 34 3358 0.02% 35 3733 0.02% 36 4022 0.03% 37 4266 0.03% 38 4676 0.03% 39 5051 0.03% 40 5407 0.03% 41 5768 0.04% 42 6108 0.04% 43 6483 0.04% 44 6869 0.04% 45 7353 0.05% 46 7709 0.05% 47 8101 0.05% 48 8764 0.05% 49 8929 0.06% 50 9332 0.06% 51 9891 0.06% 52 10494 0.07% 53 10997 0.07% 54 11406 0.07% 55 12062 0.08% 56 12705 0.08% 57 13419 0.08% 58 14100 0.09% 59 17314 0.11% 60 19628 0.12% 61 20503 0.13% 62 21447 0.13% 63 22260 0.14% 64 23448 0.15% 65 24221 0.15% 66 25474 0.16% 67 26674 0.17% 68 27649 0.17% 69 29305 0.18% 70 30338 0.19% 71 32216 0.20% 72 34425 0.22% 73 36442 0.23% 74 38018 0.24% 75 39453 0.25% 76 39803 0.25% 77 41560 0.26% 78 43835 0.27% 79 45357 0.28% 80 47683 0.30% 81 50414 0.32% 82 53485 0.34% 83 57488 0.36% 84 61640 0.39% 85 66661 0.42% 86 70633 0.44% 87 76254 0.48% 88 77677 0.49% 89 81595 0.51% 90 89699 0.56% 91 99033 0.62% 92 109068 0.68% 93 121469 0.76% 94 137313 0.86% 95 158344 0.99% 96 185753 1.16% 97 226609 1.42% 98 296806 1.86% 99 408165 2.56% 100 751724 4.71% 101 11866654 74.37% 15955312 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=17 prefix-density=0.22 prefix-fanout=2.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=333.82 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.76 fanout-score-rank=11 prefix-density=0.24 prefix-fanout=3.8 sequence=CAGAAAATGTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=375.69 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=29.9 sequence=AAGAAGAAGAGA ERR1864439 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 07:22:01 Started mapping on | Feb 13 07:22:01 Finished on | Feb 13 07:22:49 Mapping speed, Million of reads per hour | 1196.65 Number of input reads | 15955312 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15203487 Uniquely mapped reads % | 95.29% Average mapped length | 195.50 Number of splices: Total | 8815558 Number of splices: Annotated (sjdb) | 8672854 Number of splices: GT/AG | 8681005 Number of splices: GC/AG | 113253 Number of splices: AT/AC | 7557 Number of splices: Non-canonical | 13743 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 451281 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 27880 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.69% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 316374 316374 316374 N_multimapping 451281 451281 451281 N_noFeature 367071 15024787 481323 N_ambiguous 126624 851 61586 UnstrandedReadsAssigned:14709792 PositiveStrandReadsAssigned:177849 NegativeStrandReadsAssigned:14660578 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864439-trimmed-pair1.fastq ERR1864439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,955,312 reads, 14,894,314 reads pseudoaligned [quant] estimated average fragment length: 163.245 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 ERR1864439.ke.tsv 34699 ERR1864439.se.tsv 87100 total ==> ERR1864439.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1855.76 1463 58.9197 Potri.005G024800.1.v4.1 1035 872.755 765 65.5097 Potri.004G059700.1.v4.1 961 798.761 55 5.14615 Potri.007G009000.2.v4.1 1416 1253.76 0 0 Potri.003G141000.2.v4.1 2943 2780.76 773.37 20.7855 Potri.016G087400.1.v4.1 270 118.322 999 631.012 Potri.015G069301.1.v4.1 564 401.897 0 0 Potri.010G195200.1.v4.1 1773 1610.76 198 9.18697 Potri.012G127500.1.v4.1 977 814.761 10410 954.899 ==> ERR1864439.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 214 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 120 ERR1864439 completed mapping pipeline successfully