Starting /dee2/code/volunteer_pipeline.sh ERR1864440 current disk space = 3052633972736 free memory = 1495151880 ERR1864440 SRAfilesize 1ec5abcc71f5f10615a0d5b8de4e7111 ERR1864440.sra ERR1864440.sra file validated ERR1864440 is paired end ERR1864440 is conventional basespace ERR1864440 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60375 34.0 31.0 34.0 30.0 34.0 2 32.10525 34.0 31.0 34.0 30.0 34.0 3 32.42425 34.0 31.0 34.0 30.0 34.0 4 35.8015 37.0 37.0 37.0 35.0 37.0 5 35.588 37.0 35.0 37.0 35.0 37.0 6 35.61725 37.0 35.0 37.0 35.0 37.0 7 35.6895 37.0 36.0 37.0 35.0 37.0 8 35.651 37.0 36.0 37.0 33.0 37.0 9 37.371 39.0 38.0 39.0 34.0 39.0 10-11 37.31162500000001 39.0 38.0 39.0 34.0 39.0 12-13 37.149375 39.0 37.5 39.0 34.0 39.0 14-15 38.669 41.0 39.0 41.0 34.5 41.0 16-17 38.572375 41.0 39.0 41.0 34.5 41.0 18-19 38.563 41.0 39.0 41.0 34.0 41.0 20-21 38.5415 41.0 39.0 41.0 34.5 41.0 22-23 38.475125 41.0 39.0 41.0 34.0 41.0 24-25 38.36475 41.0 38.0 41.0 34.0 41.0 26-27 38.484375 41.0 39.0 41.0 34.0 41.0 28-29 38.404624999999996 41.0 38.0 41.0 34.0 41.0 30-31 38.339124999999996 41.0 38.0 41.0 34.0 41.0 32-33 38.228375 40.0 38.0 41.0 33.5 41.0 34-35 38.108625 40.0 38.0 41.0 33.5 41.0 36-37 38.08625 40.0 38.0 41.0 33.0 41.0 38-39 38.012125 40.0 38.0 41.0 33.0 41.0 40-41 37.9285 40.0 38.0 41.0 33.0 41.0 42-43 37.915125 40.0 38.0 41.0 33.0 41.0 44-45 37.730374999999995 40.0 38.0 41.0 32.5 41.0 46-47 37.575375 40.0 38.0 41.0 32.0 41.0 48-49 37.62425 40.0 38.0 41.0 32.5 41.0 50-51 37.3775 40.0 37.0 41.0 32.0 41.0 52-53 37.245875 40.0 37.0 41.0 31.5 41.0 54-55 36.982 40.0 37.0 41.0 31.0 41.0 56-57 36.727125 40.0 36.0 41.0 31.0 41.0 58-59 36.45875 39.0 36.0 41.0 29.5 41.0 60-61 36.426375 39.0 35.5 41.0 30.0 41.0 62-63 36.426625 39.0 35.5 41.0 31.0 41.0 64-65 36.177 39.0 35.0 40.5 30.5 41.0 66-67 35.820499999999996 38.0 35.0 40.0 29.5 41.0 68-69 35.583124999999995 37.5 35.0 40.0 30.0 41.0 70-71 34.828875 36.5 34.5 39.0 28.5 41.0 72-73 34.536 36.0 34.0 39.0 29.0 40.0 74-75 33.93625 35.5 33.5 38.0 27.5 39.5 76-77 32.214 34.5 31.5 36.0 26.0 39.0 78-79 33.09462499999999 35.0 33.5 37.0 27.0 39.0 80-81 32.99425 35.0 34.0 36.5 27.5 37.5 82-83 32.713375 35.0 34.0 36.0 27.0 37.0 84-85 32.444500000000005 35.0 33.0 35.5 27.0 37.0 86-87 32.159625000000005 35.0 33.0 35.0 26.0 36.0 88-89 31.949 35.0 33.0 35.0 26.0 36.0 90-91 31.784625 35.0 33.0 35.0 26.0 36.0 92-93 31.469125 35.0 33.0 35.0 24.5 35.5 94-95 31.372625 35.0 33.0 35.0 25.0 35.0 96-97 31.16725 35.0 32.0 35.0 24.5 35.0 98-99 30.847250000000003 35.0 32.0 35.0 22.0 35.0 100-101 29.844 34.0 30.5 34.5 11.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 10.0 4 5.0 5 6.0 6 3.0 7 2.0 8 5.0 9 8.0 10 3.0 11 7.0 12 8.0 13 8.0 14 4.0 15 7.0 16 8.0 17 8.0 18 7.0 19 8.0 20 13.0 21 12.0 22 12.0 23 16.0 24 16.0 25 25.0 26 20.0 27 29.0 28 30.0 29 40.0 30 51.0 31 78.0 32 92.0 33 133.0 34 166.0 35 200.0 36 377.0 37 917.0 38 1405.0 39 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.343926191696568 10.199897488467451 8.58534085084572 51.870835468990265 2 18.475 16.35 41.875 23.3 3 20.424999999999997 20.200000000000003 24.125 35.25 4 24.125 30.925000000000004 20.275000000000002 24.675 5 23.0 33.475 23.625 19.900000000000002 6 16.0 35.35 28.449999999999996 20.200000000000003 7 13.875000000000002 23.925 43.25 18.95 8 18.825 23.375 31.8 26.0 9 18.55 22.55 35.55 23.35 10-11 20.1375 33.6125 24.3875 21.8625 12-13 19.8875 25.900000000000002 27.987499999999997 26.224999999999998 14-15 19.6875 27.750000000000004 28.9 23.6625 16-17 20.724999999999998 28.525 27.525 23.225 18-19 19.425 28.8625 27.8375 23.875 20-21 19.325 28.537499999999998 28.462500000000002 23.674999999999997 22-23 20.150000000000002 28.275 28.237499999999997 23.3375 24-25 19.35 28.925 27.487499999999997 24.2375 26-27 19.7 29.1125 27.150000000000002 24.0375 28-29 19.950000000000003 29.5375 27.5875 22.925 30-31 19.5 28.325 27.537499999999998 24.637500000000003 32-33 19.35 28.849999999999998 27.9125 23.8875 34-35 19.7 28.5875 27.987499999999997 23.724999999999998 36-37 20.45 28.512500000000003 27.525 23.5125 38-39 20.3375 29.1875 27.3875 23.0875 40-41 20.1625 29.099999999999998 27.450000000000003 23.2875 42-43 19.975 28.1625 27.675 24.1875 44-45 20.7375 27.925 28.0875 23.25 46-47 19.6875 28.475 27.8375 24.0 48-49 20.025000000000002 28.449999999999996 26.8375 24.6875 50-51 19.85 29.037499999999998 27.675 23.4375 52-53 20.65 28.6625 27.1125 23.575 54-55 19.900000000000002 28.1 28.1125 23.8875 56-57 20.0125 28.6875 27.4125 23.8875 58-59 20.2375 28.0625 27.575 24.125 60-61 20.375 28.0625 27.5625 24.0 62-63 19.6375 28.3375 28.0875 23.9375 64-65 20.3125 28.037499999999998 28.249999999999996 23.400000000000002 66-67 19.400000000000002 28.712500000000002 27.525 24.3625 68-69 20.6625 28.9375 27.1375 23.2625 70-71 20.1375 28.775000000000002 27.35 23.7375 72-73 20.075000000000003 26.9125 28.775000000000002 24.2375 74-75 20.6125 28.3625 28.349999999999998 22.675 76-77 20.575 28.8625 27.3125 23.25 78-79 20.200000000000003 28.799999999999997 26.825 24.175 80-81 20.2375 28.462500000000002 27.8875 23.4125 82-83 20.65 28.65 26.6 24.099999999999998 84-85 20.8875 28.037499999999998 27.825 23.25 86-87 20.75 27.675 27.925 23.65 88-89 20.962500000000002 29.175 26.150000000000002 23.7125 90-91 20.9125 28.1875 28.0625 22.8375 92-93 20.599999999999998 27.474999999999998 27.800000000000004 24.125 94-95 20.775 28.3375 27.8625 23.025000000000002 96-97 20.5625 28.1625 27.4125 23.8625 98-99 20.6875 28.799999999999997 27.35 23.1625 100-101 20.875 29.025000000000002 26.974999999999998 23.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 2.5 26 5.0 27 8.0 28 10.5 29 15.0 30 23.0 31 29.5 32 34.0 33 38.5 34 37.0 35 51.0 36 83.0 37 110.0 38 140.5 39 176.0 40 194.0 41 209.0 42 240.0 43 264.5 44 265.5 45 264.0 46 272.0 47 265.0 48 232.0 49 204.0 50 172.0 51 144.0 52 130.5 53 102.5 54 73.0 55 47.5 56 32.5 57 27.5 58 22.5 59 18.0 60 10.5 61 7.0 62 9.5 63 7.5 64 4.0 65 3.0 66 2.5 67 2.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.425 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6625 0.0 0.0 0.0 0.0 84-85 0.875 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.2374999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864440 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23675 34.0 31.0 34.0 30.0 34.0 2 32.27875 34.0 31.0 34.0 30.0 34.0 3 32.21775 34.0 31.0 34.0 30.0 34.0 4 35.59375 37.0 35.0 37.0 33.0 37.0 5 35.6225 37.0 35.0 37.0 35.0 37.0 6 35.56175 37.0 36.0 37.0 33.0 37.0 7 35.6515 37.0 36.0 37.0 33.0 37.0 8 35.6145 37.0 36.0 37.0 33.0 37.0 9 37.19425 39.0 37.0 39.0 34.0 39.0 10-11 37.285624999999996 39.0 38.0 39.0 34.0 39.0 12-13 37.2145 39.0 38.0 39.0 34.5 39.0 14-15 38.63875 41.0 39.0 41.0 34.0 41.0 16-17 38.519 41.0 38.5 41.0 33.5 41.0 18-19 38.616875 41.0 39.0 41.0 34.0 41.0 20-21 38.58775 41.0 39.0 41.0 34.0 41.0 22-23 38.516999999999996 41.0 39.0 41.0 34.0 41.0 24-25 38.195875 40.0 38.0 41.0 33.0 41.0 26-27 38.1125 40.0 38.0 41.0 33.0 41.0 28-29 38.092749999999995 40.0 38.0 41.0 33.0 41.0 30-31 38.01775 40.0 38.0 41.0 33.0 41.0 32-33 37.916 40.0 38.0 41.0 33.0 41.0 34-35 37.877625 40.0 38.0 41.0 32.5 41.0 36-37 37.658375 40.0 38.0 41.0 32.0 41.0 38-39 37.516625000000005 40.0 38.0 41.0 31.0 41.0 40-41 37.549499999999995 40.0 38.0 41.0 31.5 41.0 42-43 37.307625 40.0 38.0 41.0 30.5 41.0 44-45 37.373999999999995 40.0 38.0 41.0 31.0 41.0 46-47 37.173874999999995 40.0 37.0 41.0 30.5 41.0 48-49 37.233000000000004 40.0 37.0 41.0 31.0 41.0 50-51 36.466375 39.0 36.0 40.5 30.0 40.5 52-53 36.426874999999995 39.0 36.5 40.0 30.0 41.0 54-55 36.6205 39.5 36.0 41.0 29.5 41.0 56-57 36.486125 39.5 36.0 41.0 29.0 41.0 58-59 36.304500000000004 39.0 36.0 41.0 29.0 41.0 60-61 36.13975 39.0 35.0 41.0 29.5 41.0 62-63 35.76175 38.5 35.0 40.5 28.0 41.0 64-65 35.42475 38.0 34.5 40.0 28.5 41.0 66-67 35.504875 38.0 35.0 40.0 28.5 41.0 68-69 35.161874999999995 37.0 35.0 39.5 29.0 41.0 70-71 34.473375000000004 37.0 34.0 39.0 27.0 41.0 72-73 34.149125 36.0 34.0 39.0 27.0 40.5 74-75 33.08375 35.0 33.0 37.0 25.0 39.0 76-77 33.136 35.0 33.5 37.0 26.0 39.0 78-79 32.38425 35.0 33.0 36.5 24.0 39.0 80-81 32.332375 35.0 33.0 36.0 25.5 37.0 82-83 32.034 35.0 33.0 36.0 25.5 37.0 84-85 31.832125 35.0 33.0 35.0 25.0 37.0 86-87 31.7395 35.0 33.0 35.0 25.0 36.0 88-89 31.545 35.0 33.0 35.0 24.5 36.0 90-91 31.180374999999998 35.0 32.0 35.0 23.0 36.0 92-93 31.18475 35.0 32.0 35.0 23.5 35.0 94-95 30.912625 35.0 32.0 35.0 21.5 35.0 96-97 30.55575 35.0 32.0 35.0 19.0 35.0 98-99 30.190375 35.0 31.5 35.0 7.5 35.0 100-101 29.269 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 4.0 4 7.0 5 1.0 6 5.0 7 3.0 8 9.0 9 4.0 10 14.0 11 5.0 12 9.0 13 10.0 14 4.0 15 2.0 16 15.0 17 21.0 18 13.0 19 12.0 20 11.0 21 16.0 22 15.0 23 16.0 24 24.0 25 34.0 26 34.0 27 31.0 28 53.0 29 51.0 30 64.0 31 77.0 32 103.0 33 124.0 34 171.0 35 220.0 36 382.0 37 905.0 38 1307.0 39 205.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.675 16.575 12.9 40.849999999999994 2 22.2 24.224999999999998 38.550000000000004 15.024999999999999 3 20.1 28.999999999999996 28.475 22.425 4 23.974999999999998 33.1 22.3 20.625 5 24.349999999999998 34.55 24.325 16.775000000000002 6 19.375 38.175 24.8 17.65 7 19.175 17.724999999999998 41.199999999999996 21.9 8 20.674999999999997 21.875 31.75 25.7 9 22.325 22.25 30.15 25.275 10-11 24.4 31.612499999999997 22.9625 21.025 12-13 24.1375 24.65 27.975 23.2375 14-15 23.7875 28.5625 27.2625 20.3875 16-17 23.525 28.449999999999996 26.5125 21.512500000000003 18-19 23.75 28.749999999999996 26.8 20.7 20-21 23.075000000000003 28.4 27.700000000000003 20.825 22-23 22.475 28.925 27.675 20.925 24-25 22.9375 27.750000000000004 28.3625 20.95 26-27 23.2125 29.475 27.437499999999996 19.875 28-29 22.9375 27.962500000000002 27.9375 21.1625 30-31 22.8625 28.275 27.950000000000003 20.9125 32-33 23.8125 27.1125 28.499999999999996 20.575 34-35 23.5625 26.9125 28.625 20.9 36-37 22.7375 27.0875 28.725 21.45 38-39 23.525 27.825 28.7 19.950000000000003 40-41 23.6875 27.275 28.075 20.962500000000002 42-43 23.35 27.400000000000002 27.474999999999998 21.775 44-45 23.275000000000002 27.712500000000002 28.4125 20.599999999999998 46-47 23.8875 27.250000000000004 27.4125 21.45 48-49 22.475 28.462500000000002 28.3625 20.7 50-51 23.599999999999998 28.1375 27.325 20.9375 52-53 23.5625 27.6625 27.6625 21.1125 54-55 23.2125 28.375 27.5875 20.825 56-57 23.175 28.425 27.500000000000004 20.9 58-59 23.1 26.9625 29.3375 20.599999999999998 60-61 23.375 27.187499999999996 27.8875 21.55 62-63 24.0625 27.487499999999997 27.6625 20.7875 64-65 23.2125 28.625 28.425 19.7375 66-67 23.5 27.500000000000004 28.712500000000002 20.2875 68-69 23.71185592796398 27.088544272136065 28.639319659829916 20.560280140070038 70-71 22.7625 27.474999999999998 28.4125 21.349999999999998 72-73 24.587500000000002 27.625 27.474999999999998 20.3125 74-75 24.712500000000002 27.737499999999997 27.787499999999998 19.7625 76-77 23.1875 27.9125 27.800000000000004 21.099999999999998 78-79 23.849999999999998 28.275 27.975 19.900000000000002 80-81 23.962500000000002 27.9375 27.625 20.474999999999998 82-83 24.1875 26.650000000000002 28.537499999999998 20.625 84-85 24.1625 27.6625 27.9375 20.2375 86-87 23.0625 28.487499999999997 28.1125 20.3375 88-89 24.1375 28.5875 26.700000000000003 20.575 90-91 23.4875 28.462500000000002 27.975 20.075000000000003 92-93 24.875 27.500000000000004 27.825 19.8 94-95 24.637500000000003 28.3625 27.537499999999998 19.4625 96-97 24.765478424015008 27.85490931832395 28.180112570356474 19.199499687304566 98-99 24.1875 27.800000000000004 27.474999999999998 20.5375 100-101 24.712500000000002 28.125 26.75 20.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 1.5 25 3.5 26 4.0 27 6.5 28 10.0 29 13.0 30 16.0 31 17.5 32 20.5 33 32.0 34 46.5 35 60.5 36 71.0 37 97.0 38 143.5 39 166.5 40 191.5 41 208.5 42 225.5 43 265.5 44 273.0 45 277.5 46 290.0 47 279.0 48 242.5 49 201.5 50 171.0 51 146.0 52 116.0 53 91.0 54 76.0 55 52.0 56 42.5 57 35.5 58 25.5 59 20.5 60 14.0 61 10.0 62 6.5 63 5.0 64 4.0 65 4.0 66 2.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.05 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0625 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.07500000000000001 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.45 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.9 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.2625000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849032 spots for ERR1864440.sra Written 849032 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra Read 849015 spots for ERR1864440.sra Written 849015 spots for ERR1864440.sra SRR ids: ['ERR1864440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j2glx3bb ERR1864440.sra spots: 16980317 blocks: [[1, 849015], [849016, 1698030], [1698031, 2547045], [2547046, 3396060], [3396061, 4245075], [4245076, 5094090], [5094091, 5943105], [5943106, 6792120], [6792121, 7641135], [7641136, 8490150], [8490151, 9339165], [9339166, 10188180], [10188181, 11037195], [11037196, 11886210], [11886211, 12735225], [12735226, 13584240], [13584241, 14433255], [14433256, 15282270], [15282271, 16131285], [16131286, 16980317]] ERR1864440 file size 4074137 ERR1864440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864440 ERR1864440_1.fastq ERR1864440_2.fastq Input file: ERR1864440_1.fastq Paired file: ERR1864440_2.fastq trimmed: ERR1864440-trimmed-pair1.fastq, ERR1864440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:18:45 2025 >> started Thu Feb 13 09:24:41 2025 >> done (355.623s) 16980317 read pairs processed; of these: 175812 ( 1.04%) short read pairs filtered out after trimming by size control 194253 ( 1.14%) empty read pairs filtered out after trimming by size control 16610252 (97.82%) read pairs available; of these: 4016475 (24.18%) trimmed read pairs available after processing 12593777 (75.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 95 0.00% 19 234 0.00% 20 327 0.00% 21 456 0.00% 22 577 0.00% 23 718 0.00% 24 928 0.01% 25 972 0.01% 26 1238 0.01% 27 1352 0.01% 28 1607 0.01% 29 1897 0.01% 30 2146 0.01% 31 2475 0.01% 32 2671 0.02% 33 3118 0.02% 34 3437 0.02% 35 3849 0.02% 36 4002 0.02% 37 4271 0.03% 38 4826 0.03% 39 4908 0.03% 40 5286 0.03% 41 5719 0.03% 42 6146 0.04% 43 6471 0.04% 44 6800 0.04% 45 7200 0.04% 46 7678 0.05% 47 8148 0.05% 48 8512 0.05% 49 8901 0.05% 50 9150 0.06% 51 9669 0.06% 52 10186 0.06% 53 10803 0.07% 54 11154 0.07% 55 11592 0.07% 56 12498 0.08% 57 13198 0.08% 58 14047 0.08% 59 17153 0.10% 60 19336 0.12% 61 20160 0.12% 62 20677 0.12% 63 21858 0.13% 64 22708 0.14% 65 23923 0.14% 66 25050 0.15% 67 25948 0.16% 68 27557 0.17% 69 28507 0.17% 70 29859 0.18% 71 31147 0.19% 72 33247 0.20% 73 35448 0.21% 74 36762 0.22% 75 37724 0.23% 76 37814 0.23% 77 40099 0.24% 78 41586 0.25% 79 43664 0.26% 80 44785 0.27% 81 47132 0.28% 82 50498 0.30% 83 53755 0.32% 84 57434 0.35% 85 62499 0.38% 86 65923 0.40% 87 72063 0.43% 88 72800 0.44% 89 76988 0.46% 90 84499 0.51% 91 93730 0.56% 92 104084 0.63% 93 115258 0.69% 94 130990 0.79% 95 152444 0.92% 96 180673 1.09% 97 224753 1.35% 98 296379 1.78% 99 414602 2.50% 100 775697 4.67% 101 12593777 75.82% 16610252 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.24 fanout-score-rank=16 prefix-density=0.23 prefix-fanout=2.4 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=312.71 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=29.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.98 fanout-score-rank=8 prefix-density=0.23 prefix-fanout=3.8 sequence=CAGAAAATGTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=356.76 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.6 sequence=AAGAAGAAGAAA ERR1864440 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:25:52 Started mapping on | Feb 13 10:26:05 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 25.19 Number of input reads | 16610252 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 15844278 Uniquely mapped reads % | 95.39% Average mapped length | 195.93 Number of splices: Total | 9210822 Number of splices: Annotated (sjdb) | 9061189 Number of splices: GT/AG | 9070545 Number of splices: GC/AG | 118528 Number of splices: AT/AC | 7957 Number of splices: Non-canonical | 13792 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470069 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 16416 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.67% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 311795 311795 311795 N_multimapping 470069 470069 470069 N_noFeature 385333 15649728 512762 N_ambiguous 132827 882 65080 UnstrandedReadsAssigned:15326118 PositiveStrandReadsAssigned:193668 NegativeStrandReadsAssigned:15266436 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864440-trimmed-pair1.fastq ERR1864440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,610,252 reads, 15,506,769 reads pseudoaligned [quant] estimated average fragment length: 165.41 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 ERR1864440.ke.tsv 34699 ERR1864440.se.tsv 87100 total ==> ERR1864440.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1853.59 1538 59.3017 Potri.005G024800.1.v4.1 1035 870.59 790 64.8542 Potri.004G059700.1.v4.1 961 796.6 59 5.29342 Potri.007G009000.2.v4.1 1416 1251.59 0 0 Potri.003G141000.2.v4.1 2943 2778.59 867 22.3007 Potri.016G087400.1.v4.1 270 115.96 1015 625.582 Potri.015G069301.1.v4.1 564 399.754 0 0 Potri.010G195200.1.v4.1 1773 1608.59 219.873 9.76902 Potri.012G127500.1.v4.1 977 812.59 10565 929.229 ==> ERR1864440.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 270 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 102 ERR1864440 completed mapping pipeline successfully