Starting /dee2/code/volunteer_pipeline.sh ERR1864441 current disk space = 3052655419392 free memory = 1450551620 ERR1864441 SRAfilesize b6570d9b9173a27aba5c1b51735c185d ERR1864441.sra ERR1864441.sra file validated ERR1864441 is paired end ERR1864441 is conventional basespace ERR1864441 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864441_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.641 34.0 31.0 34.0 27.0 34.0 2 31.51425 34.0 31.0 34.0 28.0 34.0 3 32.12025 34.0 31.0 34.0 28.0 34.0 4 35.543 37.0 35.0 37.0 33.0 37.0 5 35.4205 37.0 35.0 37.0 33.0 37.0 6 35.26075 37.0 35.0 37.0 33.0 37.0 7 35.2995 37.0 35.0 37.0 33.0 37.0 8 35.29775 37.0 35.0 37.0 33.0 37.0 9 37.135 39.0 38.0 39.0 34.0 39.0 10-11 37.006249999999994 39.0 37.5 39.0 34.0 39.0 12-13 36.939499999999995 39.0 37.0 39.0 33.0 39.0 14-15 38.358375 41.0 38.5 41.0 34.0 41.0 16-17 38.25875 41.0 38.0 41.0 33.5 41.0 18-19 38.2145 40.5 38.0 41.0 33.0 41.0 20-21 38.138625 40.0 38.0 41.0 33.0 41.0 22-23 37.939875 40.0 38.0 41.0 33.0 41.0 24-25 37.889375 40.0 38.0 41.0 32.5 41.0 26-27 37.841375 40.0 38.0 41.0 33.0 41.0 28-29 37.73125 40.0 38.0 41.0 32.5 41.0 30-31 37.599999999999994 40.0 38.0 41.0 32.0 41.0 32-33 37.598375000000004 40.0 38.0 41.0 32.0 41.0 34-35 37.362375 40.0 37.5 41.0 31.5 41.0 36-37 37.2615 40.0 38.0 41.0 31.0 41.0 38-39 37.14875 40.0 37.5 41.0 30.5 41.0 40-41 37.044624999999996 40.0 37.0 41.0 30.5 41.0 42-43 36.807125 40.0 37.0 41.0 30.0 41.0 44-45 36.75175 40.0 36.5 41.0 30.0 41.0 46-47 36.83725 40.0 37.0 41.0 30.5 41.0 48-49 36.813 40.0 37.0 41.0 30.0 41.0 50-51 36.69325 40.0 36.5 41.0 30.0 41.0 52-53 36.491125 40.0 36.0 41.0 30.0 41.0 54-55 36.16475 40.0 35.5 41.0 28.0 41.0 56-57 36.054874999999996 39.0 35.5 41.0 28.5 41.0 58-59 35.803 39.0 35.0 41.0 28.0 41.0 60-61 35.57225 39.0 35.0 41.0 28.0 41.0 62-63 35.24875 38.5 35.0 40.0 27.5 41.0 64-65 34.801375 38.0 34.0 40.0 26.0 41.0 66-67 34.533 37.0 34.0 40.0 26.0 41.0 68-69 34.198375 37.0 34.0 39.5 26.0 41.0 70-71 33.751875 36.0 33.5 39.0 26.0 40.5 72-73 33.227875 36.0 33.0 39.0 25.5 40.0 74-75 32.604375000000005 35.0 32.0 37.5 23.5 39.0 76-77 31.601875 34.5 30.5 36.0 22.0 39.0 78-79 31.798125 35.0 32.0 36.5 22.0 38.5 80-81 31.59375 35.0 32.0 36.0 22.5 37.0 82-83 31.322875000000003 35.0 32.0 36.0 21.5 37.0 84-85 30.963124999999998 35.0 31.5 35.0 20.0 36.5 86-87 30.318125000000002 34.0 31.0 35.0 17.5 36.0 88-89 30.188375 34.0 31.0 35.0 17.5 36.0 90-91 30.0645 34.0 31.0 35.0 16.5 35.0 92-93 29.685875 34.0 30.5 35.0 7.0 35.0 94-95 29.478625 34.0 30.0 35.0 2.0 35.0 96-97 29.269 34.0 30.0 35.0 2.0 35.0 98-99 28.762375 34.0 29.5 35.0 2.0 35.0 100-101 27.80525 33.0 28.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 15.0 4 11.0 5 3.0 6 6.0 7 6.0 8 9.0 9 9.0 10 11.0 11 5.0 12 6.0 13 12.0 14 12.0 15 16.0 16 9.0 17 15.0 18 14.0 19 18.0 20 17.0 21 18.0 22 11.0 23 12.0 24 23.0 25 26.0 26 36.0 27 44.0 28 52.0 29 48.0 30 81.0 31 69.0 32 107.0 33 140.0 34 213.0 35 291.0 36 427.0 37 863.0 38 1157.0 39 149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.998959417273674 4.656607700312175 6.3735691987513015 47.97086368366285 2 24.325 8.475000000000001 36.3 30.9 3 22.775000000000002 11.425 23.75 42.05 4 28.849999999999998 18.625 20.825 31.7 5 26.400000000000002 24.95 24.75 23.9 6 21.725 29.5 26.825 21.95 7 16.950000000000003 23.474999999999998 42.95 16.625 8 18.025 23.5 35.175 23.3 9 18.575 22.900000000000002 37.75 20.775 10-11 20.377547193399177 33.0166270783848 27.340917614701837 19.26490811351419 12-13 21.99299824956239 25.906476619154787 29.80745186296574 22.29307326831708 14-15 20.180045011252815 27.619404851212803 29.694923730932732 22.50562640660165 16-17 21.705426356589147 27.28182045511378 28.032008002000502 22.980745186296573 18-19 21.230307576894223 28.75718929732433 27.294323580895224 22.718179544886222 20-21 21.342835708927232 27.91947986996749 28.019504876219052 22.718179544886222 22-23 21.608103038639488 27.522821057896714 27.710391396773794 23.158684506690008 24-25 21.867966991747938 27.144286071517882 28.432108027006752 22.55563890972743 26-27 21.092773193298324 27.806951737934483 28.107026756689173 22.99324831207802 28-29 20.99274818704676 27.581895473868467 28.219554888722183 23.20580145036259 30-31 20.067516879219806 26.944236059014752 29.319829957489375 23.668417104276067 32-33 21.05526381595399 26.51912978244561 28.857214303575894 23.568392098024507 34-35 21.002625328166022 27.040880110013752 28.978622327790976 22.977872234029252 36-37 21.590198774846854 27.015876984623077 27.84098012251531 23.55294411801475 38-39 21.867966991747938 26.969242310577645 27.819454863715933 23.34333583395849 40-41 21.080270067516878 27.406851712928233 27.781945486371594 23.730932733183295 42-43 21.29282320580145 28.08202050512628 27.394348587146787 23.23080770192548 44-45 21.408028010503937 26.697511566837562 27.872952357133922 24.02150806552457 46-47 21.833187445291983 28.010503938977116 27.060147555333252 23.096161060397648 48-49 21.267816954238562 28.069517379344838 27.306826706676667 23.355838959739934 50-51 21.205301325331334 26.894223555888974 28.369592398099524 23.53088272068017 52-53 21.873043696006008 27.194190559659447 27.26931263302867 23.66345311130587 54-55 21.36784196049012 26.581645411352838 28.532133033258315 23.518379594898725 56-57 21.690211276409553 27.15339417427178 28.20352544068008 22.95286910863858 58-59 22.36809202300575 27.206801700425103 27.231807951987996 23.193298324581146 60-61 21.017754438609654 28.044511127781945 27.66941735433858 23.268317079269817 62-63 21.05 26.6125 28.1375 24.2 64-65 20.625 26.775 28.212500000000002 24.3875 66-67 20.962500000000002 26.4625 28.462500000000002 24.1125 68-69 21.025 28.3125 27.900000000000002 22.7625 70-71 21.4125 26.775 27.950000000000003 23.8625 72-73 21.55 26.1625 28.625 23.6625 74-75 21.337500000000002 27.212500000000002 28.537499999999998 22.912499999999998 76-77 21.762500000000003 27.5875 28.225 22.425 78-79 22.773886943471737 27.176088044022013 27.063531765882942 22.98649324662331 80-81 22.35 27.237499999999997 27.85 22.5625 82-83 20.962500000000002 28.15 27.825 23.0625 84-85 21.0375 26.987499999999997 27.9375 24.0375 86-87 21.925 26.924999999999997 27.487499999999997 23.6625 88-89 21.85 28.325 26.787499999999998 23.0375 90-91 21.762500000000003 26.5 27.975 23.7625 92-93 22.025 26.75 28.199999999999996 23.025000000000002 94-95 22.650000000000002 27.737499999999997 27.474999999999998 22.1375 96-97 22.075 27.575 27.6125 22.7375 98-99 22.6375 27.962500000000002 27.212500000000002 22.1875 100-101 22.6875 27.8375 26.3625 23.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 2.5 27 4.5 28 3.5 29 5.0 30 6.5 31 13.0 32 19.0 33 29.0 34 42.5 35 46.5 36 57.0 37 77.5 38 100.0 39 139.5 40 189.5 41 205.5 42 235.0 43 277.0 44 274.0 45 273.5 46 279.5 47 253.5 48 235.0 49 216.5 50 184.0 51 162.0 52 129.0 53 106.5 54 100.0 55 84.0 56 59.5 57 37.0 58 30.0 59 28.5 60 21.5 61 15.5 62 11.5 63 8.0 64 4.5 65 6.5 66 6.5 67 5.5 68 4.0 69 0.0 70 2.5 71 3.0 72 1.0 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.0375 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.0125 36-37 0.0125 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.0375 46-47 0.0375 48-49 0.025 50-51 0.025 52-53 0.1625 54-55 0.025 56-57 0.0125 58-59 0.025 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.05 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2375 0.0 0.0 0.0 0.0 68-69 0.2875 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.42500000000000004 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7250000000000001 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.1375 0.0 0.0 0.0 0.0 86-87 1.3875000000000002 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864441 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864441_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0745 34.0 31.0 34.0 30.0 34.0 2 32.08975 34.0 31.0 34.0 30.0 34.0 3 32.21675 34.0 31.0 34.0 30.0 34.0 4 35.4775 37.0 35.0 37.0 33.0 37.0 5 35.5085 37.0 35.0 37.0 33.0 37.0 6 35.43825 37.0 36.0 37.0 33.0 37.0 7 35.5085 37.0 36.0 37.0 33.0 37.0 8 35.55625 37.0 36.0 37.0 33.0 37.0 9 37.09075 39.0 38.0 39.0 33.0 39.0 10-11 37.0785 39.0 38.0 39.0 33.5 39.0 12-13 37.0265 39.0 37.5 39.0 33.5 39.0 14-15 38.3375 41.0 38.0 41.0 33.5 41.0 16-17 38.19775 41.0 38.0 41.0 33.0 41.0 18-19 38.233374999999995 40.5 38.0 41.0 33.5 41.0 20-21 38.16475 40.0 38.0 41.0 33.0 41.0 22-23 37.9135 40.0 38.0 41.0 32.0 41.0 24-25 37.9945 40.0 38.0 41.0 33.0 41.0 26-27 37.854375000000005 40.0 38.0 41.0 32.5 41.0 28-29 37.747749999999996 40.0 38.0 41.0 32.5 41.0 30-31 37.59675 40.0 38.0 41.0 31.5 41.0 32-33 37.450125 40.0 38.0 41.0 31.0 41.0 34-35 37.373625000000004 40.0 38.0 41.0 31.0 41.0 36-37 37.09375 40.0 37.5 41.0 30.0 41.0 38-39 36.982625 40.0 37.5 41.0 30.0 41.0 40-41 36.989375 40.0 37.0 41.0 30.0 41.0 42-43 36.903875 40.0 37.0 41.0 30.0 41.0 44-45 36.618125 40.0 37.0 41.0 30.0 41.0 46-47 36.415 40.0 36.0 41.0 30.0 41.0 48-49 36.223375000000004 39.0 36.0 41.0 29.0 41.0 50-51 35.950874999999996 39.0 35.5 40.5 29.0 41.0 52-53 36.184125 39.0 36.0 40.5 29.5 41.0 54-55 36.476625 40.0 36.5 41.0 30.0 41.0 56-57 36.335750000000004 40.0 36.0 41.0 28.5 41.0 58-59 36.087125 39.0 35.5 41.0 28.5 41.0 60-61 35.77875 39.0 35.0 41.0 28.0 41.0 62-63 35.525000000000006 39.0 35.0 41.0 27.5 41.0 64-65 35.1135 38.0 35.0 40.5 26.5 41.0 66-67 34.768875 37.5 34.0 40.0 26.5 41.0 68-69 34.38312500000001 37.0 34.0 39.5 26.0 41.0 70-71 33.86 36.0 34.0 39.0 26.0 41.0 72-73 33.40275 36.0 34.0 39.0 26.0 40.0 74-75 33.01175 35.0 33.5 37.5 25.5 39.0 76-77 32.2305 35.0 32.0 37.0 23.0 39.0 78-79 31.886875 35.0 32.0 36.5 22.0 38.5 80-81 31.518 35.0 32.0 36.0 20.0 37.0 82-83 31.128999999999998 35.0 32.0 35.5 20.0 37.0 84-85 30.8375 35.0 31.5 35.0 18.5 36.5 86-87 30.418875 34.5 31.0 35.0 16.5 36.0 88-89 30.009749999999997 34.0 30.5 35.0 9.5 36.0 90-91 29.97525 34.0 31.0 35.0 7.0 35.0 92-93 29.616 34.0 30.5 35.0 2.0 35.0 94-95 29.401875 34.0 30.5 35.0 2.0 35.0 96-97 28.661625 34.0 29.5 35.0 2.0 35.0 98-99 28.15175 34.0 29.0 35.0 2.0 35.0 100-101 26.976125 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 4.0 4 8.0 5 8.0 6 8.0 7 6.0 8 13.0 9 8.0 10 8.0 11 13.0 12 15.0 13 15.0 14 9.0 15 14.0 16 9.0 17 12.0 18 11.0 19 19.0 20 18.0 21 26.0 22 17.0 23 21.0 24 22.0 25 36.0 26 45.0 27 42.0 28 48.0 29 59.0 30 69.0 31 71.0 32 97.0 33 136.0 34 170.0 35 272.0 36 484.0 37 877.0 38 1129.0 39 154.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.725 18.675 13.750000000000002 37.85 2 25.56278139069535 24.537268634317158 34.642321160580295 15.257628814407203 3 20.575 27.650000000000002 29.575000000000003 22.2 4 22.28614307153577 33.516758379189596 22.961480740370185 21.235617808904454 5 25.05 36.125 22.650000000000002 16.175 6 18.95 38.824999999999996 24.05 18.175 7 20.875 20.325 38.125 20.674999999999997 8 21.475 24.8 28.875 24.85 9 21.675 25.624999999999996 30.125 22.575 10-11 23.375 31.95 23.05 21.625 12-13 24.52169563586345 25.54708015505815 26.7725397023884 23.158684506690008 14-15 22.941176470588236 28.28535669586984 27.221526908635795 21.551939924906133 16-17 23.03363761410529 28.49818682005752 26.860072527197698 21.608103038639488 18-19 22.768192048012004 27.419354838709676 27.51937984496124 22.29307326831708 20-21 22.925 28.65 27.200000000000003 21.224999999999998 22-23 23.7375 27.375 27.6 21.2875 24-25 23.200000000000003 28.4375 26.775 21.587500000000002 26-27 23.025000000000002 28.475 27.0125 21.4875 28-29 23.25 29.1375 26.3125 21.3 30-31 22.45 28.9875 26.9625 21.6 32-33 23.2875 28.6375 26.974999999999998 21.099999999999998 34-35 23.3125 27.725 27.1125 21.85 36-37 23.0375 27.987499999999997 26.700000000000003 22.275 38-39 23.7 28.712500000000002 26.25 21.337500000000002 40-41 22.875 28.375 27.200000000000003 21.55 42-43 23.6625 27.8875 27.224999999999998 21.224999999999998 44-45 23.25 27.9125 27.200000000000003 21.637500000000003 46-47 23.35 27.4125 27.525 21.712500000000002 48-49 22.8375 27.737499999999997 27.437499999999996 21.987499999999997 50-51 23.8625 28.4125 27.3125 20.4125 52-53 23.3875 27.8375 26.887499999999996 21.8875 54-55 22.3125 29.299999999999997 26.487500000000004 21.9 56-57 22.665333166645834 28.153519189898734 27.140892611576444 22.040255031878985 58-59 23.1625 27.650000000000002 27.500000000000004 21.6875 60-61 23.849999999999998 27.6625 26.75 21.7375 62-63 22.8625 28.025 26.924999999999997 22.1875 64-65 22.7375 28.999999999999996 27.1125 21.15 66-67 23.2375 28.5875 26.6625 21.512500000000003 68-69 23.400000000000002 28.549999999999997 26.55 21.5 70-71 23.6375 27.9125 26.437500000000004 22.0125 72-73 23.3875 28.65 26.700000000000003 21.2625 74-75 22.725 28.625 27.1625 21.4875 76-77 24.337500000000002 27.975 26.224999999999998 21.462500000000002 78-79 22.9625 27.8625 27.224999999999998 21.95 80-81 22.95 28.537499999999998 27.175 21.337500000000002 82-83 23.5875 27.825 27.3625 21.224999999999998 84-85 23.375 28.000000000000004 26.6125 22.0125 86-87 23.2875 27.712500000000002 27.200000000000003 21.8 88-89 24.5625 27.4125 26.2875 21.7375 90-91 23.425 29.2875 26.474999999999998 20.8125 92-93 24.337500000000002 28.075 26.387500000000003 21.2 94-95 24.887500000000003 28.287499999999998 26.025 20.8 96-97 24.3625 28.000000000000004 26.35 21.2875 98-99 24.7 28.825 25.2 21.275 100-101 25.1 28.5875 24.4125 21.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 2.5 27 1.5 28 3.5 29 7.0 30 8.5 31 10.0 32 22.0 33 29.0 34 38.5 35 51.5 36 65.5 37 95.5 38 129.5 39 155.0 40 180.5 41 208.5 42 235.5 43 273.5 44 293.0 45 284.0 46 256.5 47 240.5 48 244.0 49 237.0 50 188.0 51 130.5 52 111.5 53 100.0 54 85.0 55 73.5 56 58.5 57 41.5 58 27.0 59 19.5 60 17.0 61 16.5 62 16.0 63 9.0 64 6.5 65 5.5 66 3.0 67 3.5 68 4.0 69 2.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0375 14-15 0.125 16-17 0.0375 18-19 0.025 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.4 0.0 0.0 0.0 0.0 74-75 0.4625 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.8500000000000001 0.0 0.0 0.0 0.0 84-85 1.125 0.0 0.0 0.0 0.0 86-87 1.3875000000000002 0.0 0.0 0.0 0.0 88-89 1.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Read 606788 spots for ERR1864441.sra Read 606769 spots for ERR1864441.sra Written 606769 spots for ERR1864441.sra Written 606788 spots for ERR1864441.sra SRR ids: ['ERR1864441.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l8vv86pk ERR1864441.sra spots: 12135399 blocks: [[1, 606769], [606770, 1213538], [1213539, 1820307], [1820308, 2427076], [2427077, 3033845], [3033846, 3640614], [3640615, 4247383], [4247384, 4854152], [4854153, 5460921], [5460922, 6067690], [6067691, 6674459], [6674460, 7281228], [7281229, 7887997], [7887998, 8494766], [8494767, 9101535], [9101536, 9708304], [9708305, 10315073], [10315074, 10921842], [10921843, 11528611], [11528612, 12135399]] ERR1864441 file size 2905490 ERR1864441 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864441 ERR1864441_1.fastq ERR1864441_2.fastq Input file: ERR1864441_1.fastq Paired file: ERR1864441_2.fastq trimmed: ERR1864441-trimmed-pair1.fastq, ERR1864441-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:00:03 2025 >> started Thu Feb 13 09:03:13 2025 >> done (189.375s) 12135399 read pairs processed; of these: 131837 ( 1.09%) short read pairs filtered out after trimming by size control 155288 ( 1.28%) empty read pairs filtered out after trimming by size control 11848274 (97.63%) read pairs available; of these: 2659949 (22.45%) trimmed read pairs available after processing 9188325 (77.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 66 0.00% 19 138 0.00% 20 184 0.00% 21 270 0.00% 22 347 0.00% 23 402 0.00% 24 543 0.00% 25 647 0.01% 26 774 0.01% 27 884 0.01% 28 1074 0.01% 29 1220 0.01% 30 1295 0.01% 31 1563 0.01% 32 1754 0.01% 33 2001 0.02% 34 2139 0.02% 35 2393 0.02% 36 2652 0.02% 37 2799 0.02% 38 2999 0.03% 39 3286 0.03% 40 3388 0.03% 41 3722 0.03% 42 3973 0.03% 43 4152 0.04% 44 4412 0.04% 45 4657 0.04% 46 4915 0.04% 47 5169 0.04% 48 5588 0.05% 49 5859 0.05% 50 6153 0.05% 51 6393 0.05% 52 6591 0.06% 53 7181 0.06% 54 7535 0.06% 55 7914 0.07% 56 8301 0.07% 57 8786 0.07% 58 9494 0.08% 59 12160 0.10% 60 14463 0.12% 61 15036 0.13% 62 15497 0.13% 63 16040 0.14% 64 17004 0.14% 65 17443 0.15% 66 18342 0.15% 67 19173 0.16% 68 19988 0.17% 69 20670 0.17% 70 21854 0.18% 71 23057 0.19% 72 24019 0.20% 73 24892 0.21% 74 26223 0.22% 75 26835 0.23% 76 27389 0.23% 77 28759 0.24% 78 30118 0.25% 79 32434 0.27% 80 34478 0.29% 81 36291 0.31% 82 38352 0.32% 83 40915 0.35% 84 43065 0.36% 85 46040 0.39% 86 48880 0.41% 87 51575 0.44% 88 53161 0.45% 89 56785 0.48% 90 62083 0.52% 91 67890 0.57% 92 74679 0.63% 93 82687 0.70% 94 93184 0.79% 95 106538 0.90% 96 125558 1.06% 97 153725 1.30% 98 196043 1.65% 99 253729 2.14% 100 399282 3.37% 101 9188325 77.55% 11848274 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=24 prefix-density=0.21 prefix-fanout=2.8 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=6 fanout-score=313.22 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=29.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.62 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.3 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=8 fanout-score=374.64 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=31.2 sequence=AAGAAGAAGAGAAG ERR1864441 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:49:21 Started mapping on | Feb 13 09:49:32 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 9.34 Number of input reads | 11848274 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 11357504 Uniquely mapped reads % | 95.86% Average mapped length | 196.03 Number of splices: Total | 7065312 Number of splices: Annotated (sjdb) | 6944083 Number of splices: GT/AG | 6956986 Number of splices: GC/AG | 92539 Number of splices: AT/AC | 5507 Number of splices: Non-canonical | 10280 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360272 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 12645 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 143670 143670 143670 N_multimapping 360272 360272 360272 N_noFeature 256447 11251973 306487 N_ambiguous 102442 556 46579 UnstrandedReadsAssigned:10998615 PositiveStrandReadsAssigned:104975 NegativeStrandReadsAssigned:11004438 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864441 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864441-trimmed-pair1.fastq ERR1864441-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,848,274 reads, 11,217,526 reads pseudoaligned [quant] estimated average fragment length: 149.553 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 ERR1864441.ke.tsv 34699 ERR1864441.se.tsv 87100 total ==> ERR1864441.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1869.45 734 41.6745 Potri.005G024800.1.v4.1 1035 886.447 123 14.7279 Potri.004G059700.1.v4.1 961 812.447 11 1.43709 Potri.007G009000.2.v4.1 1416 1267.45 0 0 Potri.003G141000.2.v4.1 2943 2794.45 494 18.7637 Potri.016G087400.1.v4.1 270 125.053 798.77 677.975 Potri.015G069301.1.v4.1 564 415.473 0 0 Potri.010G195200.1.v4.1 1773 1624.45 221 14.4402 Potri.012G127500.1.v4.1 977 828.447 2936 376.165 ==> ERR1864441.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 34 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 231 ERR1864441 completed mapping pipeline successfully