Starting /dee2/code/volunteer_pipeline.sh ERR1864442 current disk space = 3052662652928 free memory = 1447390212 ERR1864442 SRAfilesize 459948400da62c14ff9686837d4ac3fb ERR1864442.sra ERR1864442.sra file validated ERR1864442 is paired end ERR1864442 is conventional basespace ERR1864442 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.50775 33.0 31.0 34.0 26.0 34.0 2 31.38575 34.0 31.0 34.0 27.0 34.0 3 32.012 34.0 31.0 34.0 28.0 34.0 4 35.34025 37.0 35.0 37.0 32.0 37.0 5 35.337 37.0 35.0 37.0 33.0 37.0 6 35.297 37.0 35.0 37.0 33.0 37.0 7 35.269 37.0 35.0 37.0 33.0 37.0 8 35.246 37.0 35.0 37.0 32.0 37.0 9 37.0605 39.0 37.0 39.0 34.0 39.0 10-11 37.040625 39.0 37.0 39.0 33.0 39.0 12-13 36.934375 39.0 37.0 39.0 33.0 39.0 14-15 38.24225 41.0 38.0 41.0 33.0 41.0 16-17 38.075375 40.0 38.0 41.0 33.0 41.0 18-19 38.071375 40.0 38.0 41.0 33.0 41.0 20-21 37.967375 40.0 38.0 41.0 32.0 41.0 22-23 37.839875 40.0 38.0 41.0 32.0 41.0 24-25 37.7685 40.0 38.0 41.0 32.5 41.0 26-27 37.79625 40.0 38.0 41.0 32.0 41.0 28-29 37.679625 40.0 38.0 41.0 32.0 41.0 30-31 37.471875 40.0 38.0 41.0 31.0 41.0 32-33 37.433875 40.0 38.0 41.0 31.0 41.0 34-35 37.234375 40.0 37.5 41.0 30.5 41.0 36-37 37.151875000000004 40.0 37.0 41.0 30.5 41.0 38-39 37.066375 40.0 37.0 41.0 30.5 41.0 40-41 36.94 40.0 37.0 41.0 30.0 41.0 42-43 36.77075 40.0 37.0 41.0 30.0 41.0 44-45 36.673875 40.0 36.5 41.0 30.0 41.0 46-47 36.690250000000006 40.0 37.0 41.0 29.5 41.0 48-49 36.61575 40.0 36.5 41.0 30.0 41.0 50-51 36.499625 40.0 36.0 41.0 30.0 41.0 52-53 36.2725 40.0 36.0 41.0 29.0 41.0 54-55 36.048125 39.5 36.0 41.0 28.0 41.0 56-57 35.870625 39.0 35.0 41.0 28.0 41.0 58-59 35.610625 39.0 35.0 41.0 28.0 41.0 60-61 35.405125 39.0 35.0 40.5 27.5 41.0 62-63 35.038375 38.0 34.0 40.0 26.5 41.0 64-65 34.625 38.0 34.0 40.0 26.0 41.0 66-67 34.25425 37.0 34.0 40.0 26.0 41.0 68-69 33.90375 37.0 34.0 39.0 25.5 41.0 70-71 33.5725 36.0 33.0 39.0 25.5 40.5 72-73 33.081375 36.0 33.0 38.5 24.0 40.0 74-75 32.454625 35.0 32.5 37.0 22.0 39.0 76-77 31.373625 34.5 30.5 36.0 21.0 39.0 78-79 31.61575 35.0 32.0 36.0 20.5 38.5 80-81 31.443 35.0 32.0 36.0 20.5 37.0 82-83 31.212375 35.0 32.0 36.0 20.5 37.0 84-85 30.849125 35.0 32.0 35.0 18.0 37.0 86-87 30.12175 34.0 31.0 35.0 12.0 36.0 88-89 29.920875000000002 34.0 30.0 35.0 7.0 36.0 90-91 29.82975 34.0 31.0 35.0 6.0 35.0 92-93 29.459375 34.0 30.5 35.0 2.0 35.0 94-95 29.164625 34.0 30.0 35.0 2.0 35.0 96-97 28.93875 34.0 30.0 35.0 2.0 35.0 98-99 28.602625 34.0 29.5 35.0 2.0 35.0 100-101 27.7515 33.0 28.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 14.0 4 12.0 5 6.0 6 6.0 7 5.0 8 8.0 9 6.0 10 8.0 11 16.0 12 15.0 13 15.0 14 15.0 15 12.0 16 21.0 17 12.0 18 14.0 19 19.0 20 15.0 21 16.0 22 15.0 23 15.0 24 25.0 25 32.0 26 31.0 27 49.0 28 53.0 29 64.0 30 57.0 31 76.0 32 108.0 33 135.0 34 183.0 35 294.0 36 449.0 37 901.0 38 1111.0 39 135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.27125717266563 5.659885237350027 7.016171100678142 47.052686489306204 2 25.35 9.075 34.35 31.225 3 24.375 12.1 22.5 41.025 4 29.4 18.675 20.525 31.4 5 29.697272954716038 24.26820115086315 23.367525644233176 22.66700025018764 6 21.605401350337583 28.382095523880967 27.481870467616904 22.53063265816454 7 17.1 22.85 42.95 17.1 8 18.104526131532882 23.705926481620406 36.75918979744936 21.43035758939735 9 18.5 21.4 38.025 22.075 10-11 20.342585646411603 32.645661415353835 27.419354838709676 19.592398099524882 12-13 21.030257564391096 25.51887971992998 30.182545636409102 23.268317079269817 14-15 21.442860715178792 27.59439859964991 29.044761190297574 21.91797949487372 16-17 21.68584292146073 27.188594297148573 28.58929464732366 22.536268134067033 18-19 21.867966991747938 28.244561140285075 27.46936734183546 22.418104526131533 20-21 22.143035758939735 27.544386096524132 27.35683920980245 22.95573893473368 22-23 20.08504252126063 28.12656328164082 29.202101050525265 22.586293146573286 24-25 20.907840440165064 27.61035388270601 28.110541453044892 23.371264224084033 26-27 20.370138802050768 27.860447667875455 27.860447667875455 23.908965862198325 28-29 20.907840440165064 27.747905464549206 27.597849193447544 23.74640490183819 30-31 20.657746654995623 27.485306990121295 28.273102413405027 23.583843941478055 32-33 21.383018631986992 27.11016631236714 28.210578967112664 23.296236088533202 34-35 22.280570142535634 27.481870467616904 27.506876719179797 22.73068267066767 36-37 20.657746654995623 27.435288233087405 27.58534450418907 24.321620607727898 38-39 21.4705514567963 26.872577216456172 28.585719644866824 23.071151681880707 40-41 20.59264816204051 27.85696424106027 28.219554888722183 23.330832708177045 42-43 21.160580290145074 27.888944472236116 27.56378189094547 23.386693346673336 44-45 20.460230115057527 28.301650825412704 28.639319659829916 22.59879939969985 46-47 21.173086543271637 27.263631815907953 28.151575787893947 23.411705852926463 48-49 22.13053263315829 27.731932983245812 26.85671417854464 23.280820205051263 50-51 21.23296236088533 28.085532074527947 27.560335125672125 23.121170438914593 52-53 20.614035087719298 28.383458646616543 26.829573934837093 24.172932330827066 54-55 22.083281230461424 27.38526947605352 28.010503938977116 22.52094535450794 56-57 21.655413853463365 28.19454863715929 27.769442360590148 22.380595148787197 58-59 21.442860715178792 28.232058014503625 27.91947986996749 22.405601400350086 60-61 21.030257564391096 28.54463615903976 27.369342335583895 23.055763940985248 62-63 20.837500000000002 27.8875 28.000000000000004 23.275000000000002 64-65 21.175 27.425 28.5625 22.8375 66-67 20.925 27.025 28.1 23.95 68-69 20.9875 28.125 28.525 22.3625 70-71 20.849999999999998 27.975 27.525 23.65 72-73 21.9625 27.975 27.3875 22.675 74-75 21.9 27.737499999999997 27.35 23.0125 76-77 20.7625 28.287499999999998 28.3125 22.6375 78-79 21.35970952798297 27.745085764367094 27.23175159634406 23.66345311130587 80-81 21.54288572143036 27.86946736684171 27.819454863715933 22.768192048012004 82-83 20.282605977241467 28.49818682005752 27.79792422158309 23.42128298111792 84-85 22.1375 26.700000000000003 27.6125 23.549999999999997 86-87 22.2625 26.937499999999996 27.6625 23.1375 88-89 21.85 28.3375 27.450000000000003 22.3625 90-91 20.9125 27.825 27.875 23.3875 92-93 21.349999999999998 28.4 27.287499999999998 22.9625 94-95 21.675 28.512500000000003 27.4125 22.400000000000002 96-97 22.6125 27.400000000000002 27.05 22.9375 98-99 21.875 27.725 27.6125 22.787499999999998 100-101 22.325 27.9125 27.0875 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 3.0 27 3.0 28 7.0 29 9.0 30 11.5 31 16.0 32 16.5 33 28.0 34 44.5 35 47.5 36 59.5 37 89.5 38 119.5 39 138.5 40 182.0 41 216.0 42 242.0 43 257.0 44 251.5 45 277.0 46 289.5 47 268.0 48 247.5 49 223.0 50 186.5 51 155.0 52 125.0 53 101.5 54 82.0 55 66.5 56 53.5 57 40.0 58 26.0 59 20.5 60 15.0 61 14.0 62 15.0 63 9.5 64 7.0 65 6.5 66 5.0 67 3.0 68 4.0 69 4.0 70 2.5 71 1.5 72 1.5 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.075 6 0.025 7 0.0 8 0.025 9 0.0 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.05 18-19 0.025 20-21 0.025 22-23 0.05 24-25 0.0375 26-27 0.0375 28-29 0.0375 30-31 0.0375 32-33 0.0375 34-35 0.025 36-37 0.0375 38-39 0.0375 40-41 0.025 42-43 0.05 44-45 0.05 46-47 0.05 48-49 0.025 50-51 0.0375 52-53 0.25 54-55 0.0375 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.1625 80-81 0.025 82-83 0.0375 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5035246727089627 1.0 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864442 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.951 34.0 31.0 34.0 30.0 34.0 2 32.01225 34.0 31.0 34.0 30.0 34.0 3 32.0655 34.0 31.0 34.0 30.0 34.0 4 35.292 37.0 35.0 37.0 33.0 37.0 5 35.2755 37.0 35.0 37.0 33.0 37.0 6 35.3135 37.0 35.0 37.0 33.0 37.0 7 35.39675 37.0 35.0 37.0 33.0 37.0 8 35.4175 37.0 35.0 37.0 33.0 37.0 9 36.95525 39.0 37.0 39.0 33.0 39.0 10-11 36.945750000000004 39.0 37.0 39.0 33.0 39.0 12-13 36.866375000000005 39.0 37.0 39.0 33.0 39.0 14-15 38.114999999999995 41.0 38.0 41.0 33.0 41.0 16-17 38.094875 41.0 38.0 41.0 33.0 41.0 18-19 38.050250000000005 40.0 38.0 41.0 33.0 41.0 20-21 38.044250000000005 40.0 38.0 41.0 33.0 41.0 22-23 37.723375000000004 40.0 38.0 41.0 32.0 41.0 24-25 37.875875 40.0 38.0 41.0 33.0 41.0 26-27 37.75175 40.0 38.0 41.0 32.5 41.0 28-29 37.608000000000004 40.0 38.0 41.0 32.0 41.0 30-31 37.489374999999995 40.0 38.0 41.0 31.5 41.0 32-33 37.335 40.0 38.0 41.0 31.0 41.0 34-35 37.221875 40.0 37.5 41.0 31.0 41.0 36-37 37.067 40.0 37.0 41.0 30.5 41.0 38-39 36.971374999999995 40.0 37.0 41.0 30.0 41.0 40-41 36.952375 40.0 37.0 41.0 30.0 41.0 42-43 36.848375000000004 40.0 37.0 41.0 30.0 41.0 44-45 36.58225 40.0 37.0 41.0 30.0 41.0 46-47 36.4025 39.5 36.0 41.0 30.0 41.0 48-49 36.207750000000004 39.0 36.0 41.0 28.5 41.0 50-51 35.955124999999995 39.0 35.5 40.5 29.0 41.0 52-53 36.167125 39.0 36.0 40.5 29.5 41.0 54-55 36.42775 40.0 36.0 41.0 29.0 41.0 56-57 36.216625 40.0 36.0 41.0 28.0 41.0 58-59 35.979749999999996 39.0 35.5 41.0 28.0 41.0 60-61 35.723375000000004 39.0 35.0 41.0 28.0 41.0 62-63 35.478750000000005 39.0 35.0 41.0 27.5 41.0 64-65 35.140625 38.0 35.0 40.0 26.5 41.0 66-67 34.786874999999995 37.5 34.5 40.0 26.0 41.0 68-69 34.333375000000004 37.0 34.0 39.5 26.0 41.0 70-71 33.877125 36.5 34.0 39.0 26.0 41.0 72-73 33.422125 36.0 34.0 39.0 25.5 40.0 74-75 32.954375 35.5 33.0 37.5 24.5 39.5 76-77 32.172625 35.0 32.5 37.0 22.5 39.0 78-79 31.808124999999997 35.0 32.0 36.5 21.5 38.5 80-81 31.443 35.0 32.0 36.0 20.5 37.0 82-83 31.108249999999998 35.0 32.0 35.5 20.0 37.0 84-85 30.67275 34.5 31.0 35.0 18.5 36.5 86-87 30.170125 34.0 31.0 35.0 12.5 36.0 88-89 29.776 34.0 30.0 35.0 7.5 36.0 90-91 29.76925 34.0 30.5 35.0 7.0 35.0 92-93 29.534625 34.0 30.5 35.0 2.0 35.0 94-95 29.335625 34.0 30.0 35.0 2.0 35.0 96-97 28.483125 34.0 29.5 35.0 2.0 35.0 98-99 28.036749999999998 34.0 29.0 35.0 2.0 35.0 100-101 26.909 33.0 26.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 6.0 4 6.0 5 7.0 6 9.0 7 9.0 8 8.0 9 5.0 10 8.0 11 13.0 12 18.0 13 11.0 14 10.0 15 8.0 16 12.0 17 19.0 18 14.0 19 12.0 20 24.0 21 24.0 22 15.0 23 23.0 24 26.0 25 39.0 26 25.0 27 50.0 28 50.0 29 52.0 30 73.0 31 84.0 32 116.0 33 137.0 34 185.0 35 264.0 36 491.0 37 888.0 38 1075.0 39 151.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.33133133133133 18.26826826826827 13.113113113113112 37.287287287287285 2 24.111166750125186 25.38808212318478 33.750625938908364 16.750125187781673 3 19.73980485364023 27.89592194145609 30.072554415811858 22.291718789091817 4 21.4321482223335 32.97446169253881 24.361542313470206 21.231847771657485 5 24.568426319739807 34.32574430823117 24.568426319739807 16.537403052289218 6 19.825 38.324999999999996 24.25 17.599999999999998 7 20.474999999999998 20.474999999999998 38.2 20.849999999999998 8 20.640480360270203 25.093820365273956 28.87165374030523 25.39404553415061 9 21.475 25.0 30.349999999999998 23.175 10-11 22.568142035508878 32.50812703175794 23.3183295823956 21.605401350337583 12-13 23.907873325823008 25.184628864688946 27.51283014144449 23.39466766804356 14-15 22.911186270825503 27.50845546786922 27.65877489665539 21.92158336464988 16-17 23.98297659281512 28.401552134184506 26.073350857428967 21.54212041557141 18-19 23.317488116087066 29.28446334751063 25.91943957968476 21.478608956717537 20-21 22.32087032637239 28.298111791921972 27.3477554082781 22.033262473427534 22-23 23.0125 28.1625 27.125 21.7 24-25 22.3125 29.349999999999998 27.500000000000004 20.837500000000002 26-27 21.94024253031629 29.22865358169771 26.978372296537067 21.852731591448933 28-29 23.193298324581146 27.431857964491122 27.93198299574894 21.442860715178792 30-31 22.6 28.1375 27.5125 21.75 32-33 22.662499999999998 28.4 27.3125 21.625 34-35 23.3625 27.55 27.175 21.912499999999998 36-37 23.0875 27.700000000000003 27.537499999999998 21.675 38-39 23.0875 27.8375 28.000000000000004 21.075 40-41 23.183693885206953 28.510691509315993 26.447417781668126 21.858196823808928 42-43 22.565320665083135 28.55356919614952 27.315914489311165 21.565195649456182 44-45 21.675 28.3625 27.712500000000002 22.25 46-47 23.7 27.6875 27.450000000000003 21.1625 48-49 23.175 28.0875 27.35 21.3875 50-51 23.225 27.8875 27.6375 21.25 52-53 23.168292073018254 28.40710177544386 26.79419854963741 21.630407601900476 54-55 22.295860947855445 28.085532074527947 28.010503938977116 21.608103038639488 56-57 22.084584584584587 28.253253253253252 27.865365365365363 21.796796796796798 58-59 23.158684506690008 28.585719644866824 26.93510066274853 21.320495185694636 60-61 23.5125 27.3125 27.2625 21.912499999999998 62-63 22.8375 27.1375 28.3375 21.6875 64-65 22.237499999999997 27.987499999999997 28.012500000000003 21.762500000000003 66-67 22.8875 27.537499999999998 27.85 21.725 68-69 22.775000000000002 28.675 27.875 20.674999999999997 70-71 22.5625 27.037499999999998 28.1625 22.237499999999997 72-73 23.4625 26.637499999999996 27.925 21.975 74-75 22.95 28.7375 27.3875 20.925 76-77 22.7625 28.65 26.8 21.7875 78-79 23.325000000000003 27.525 27.950000000000003 21.2 80-81 22.62782847855982 28.54106763345418 27.103387923490434 21.727715964495562 82-83 23.175 27.825 27.325 21.675 84-85 22.8375 28.199999999999996 27.4125 21.55 86-87 23.8875 27.525 27.6125 20.974999999999998 88-89 24.9 28.125 26.450000000000003 20.525 90-91 23.4875 28.499999999999996 26.9125 21.099999999999998 92-93 23.35 28.849999999999998 26.8125 20.9875 94-95 23.724999999999998 27.737499999999997 27.35 21.1875 96-97 24.025 28.237499999999997 26.6 21.1375 98-99 24.2625 28.762500000000003 26.25 20.724999999999998 100-101 25.2375 28.1125 25.587500000000002 21.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 2.0 26 2.5 27 3.5 28 4.5 29 6.5 30 7.0 31 13.5 32 22.5 33 27.0 34 40.0 35 58.0 36 80.5 37 112.5 38 130.0 39 149.5 40 192.0 41 224.0 42 259.5 43 283.0 44 285.0 45 288.5 46 272.0 47 253.0 48 225.0 49 191.0 50 161.5 51 134.5 52 114.0 53 97.5 54 85.5 55 66.5 56 52.0 57 36.0 58 22.5 59 18.5 60 13.0 61 11.0 62 12.5 63 10.0 64 7.0 65 4.0 66 2.5 67 3.0 68 3.5 69 2.0 70 1.5 71 2.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.15 3 0.075 4 0.15 5 0.075 6 0.0 7 0.0 8 0.075 9 0.0 10-11 0.025 12-13 0.13749999999999998 14-15 0.21250000000000002 16-17 0.13749999999999998 18-19 0.075 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0375 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0375 56-57 0.1 58-59 0.0375 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5375000000000001 0.0 0.0 0.0 0.0 80-81 0.5874999999999999 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 1.0875 0.0 0.0 0.0 0.0 88-89 1.5499999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631879 spots for ERR1864442.sra Written 631879 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra Read 631872 spots for ERR1864442.sra Written 631872 spots for ERR1864442.sra SRR ids: ['ERR1864442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_233h6ptk ERR1864442.sra spots: 12637447 blocks: [[1, 631872], [631873, 1263744], [1263745, 1895616], [1895617, 2527488], [2527489, 3159360], [3159361, 3791232], [3791233, 4423104], [4423105, 5054976], [5054977, 5686848], [5686849, 6318720], [6318721, 6950592], [6950593, 7582464], [7582465, 8214336], [8214337, 8846208], [8846209, 9478080], [9478081, 10109952], [10109953, 10741824], [10741825, 11373696], [11373697, 12005568], [12005569, 12637447]] ERR1864442 file size 3026590 ERR1864442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864442 ERR1864442_1.fastq ERR1864442_2.fastq Input file: ERR1864442_1.fastq Paired file: ERR1864442_2.fastq trimmed: ERR1864442-trimmed-pair1.fastq, ERR1864442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 07:44:20 2025 >> started Thu Feb 13 07:56:28 2025 >> done (728.091s) 12637447 read pairs processed; of these: 140438 ( 1.11%) short read pairs filtered out after trimming by size control 154017 ( 1.22%) empty read pairs filtered out after trimming by size control 12342992 (97.67%) read pairs available; of these: 2790787 (22.61%) trimmed read pairs available after processing 9552205 (77.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 77 0.00% 19 152 0.00% 20 236 0.00% 21 293 0.00% 22 440 0.00% 23 469 0.00% 24 598 0.00% 25 711 0.01% 26 854 0.01% 27 983 0.01% 28 1120 0.01% 29 1264 0.01% 30 1466 0.01% 31 1667 0.01% 32 1890 0.02% 33 2145 0.02% 34 2435 0.02% 35 2433 0.02% 36 2640 0.02% 37 3035 0.02% 38 3219 0.03% 39 3423 0.03% 40 3741 0.03% 41 3987 0.03% 42 4226 0.03% 43 4388 0.04% 44 4633 0.04% 45 4886 0.04% 46 5013 0.04% 47 5532 0.04% 48 5724 0.05% 49 6062 0.05% 50 6275 0.05% 51 6613 0.05% 52 7210 0.06% 53 7359 0.06% 54 7829 0.06% 55 8175 0.07% 56 8499 0.07% 57 9181 0.07% 58 9828 0.08% 59 12678 0.10% 60 15116 0.12% 61 15637 0.13% 62 16153 0.13% 63 16918 0.14% 64 17428 0.14% 65 18228 0.15% 66 19057 0.15% 67 20135 0.16% 68 20585 0.17% 69 21800 0.18% 70 22452 0.18% 71 23613 0.19% 72 24862 0.20% 73 26165 0.21% 74 27384 0.22% 75 27849 0.23% 76 28148 0.23% 77 30217 0.24% 78 31566 0.26% 79 33330 0.27% 80 35663 0.29% 81 37335 0.30% 82 39369 0.32% 83 42130 0.34% 84 44878 0.36% 85 47625 0.39% 86 50459 0.41% 87 53800 0.44% 88 54761 0.44% 89 58760 0.48% 90 64380 0.52% 91 70469 0.57% 92 78300 0.63% 93 86254 0.70% 94 97984 0.79% 95 112332 0.91% 96 132214 1.07% 97 163217 1.32% 98 209035 1.69% 99 271351 2.20% 100 420439 3.41% 101 9552205 77.39% 12342992 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=31 prefix-density=0.19 prefix-fanout=2.5 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=309.19 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=24.0 sequence=TCTTCTTCTTTT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=5.43 fanout-score-rank=23 prefix-density=0.16 prefix-fanout=3.8 sequence=ATGCAGATCTTTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=318.69 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=30.3 sequence=AAGAAGAAGAAA ERR1864442 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 08:53:26 Started mapping on | Feb 13 08:53:44 Finished on | Feb 13 11:00:16 Mapping speed, Million of reads per hour | 5.85 Number of input reads | 12342992 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 11853523 Uniquely mapped reads % | 96.03% Average mapped length | 196.01 Number of splices: Total | 7346730 Number of splices: Annotated (sjdb) | 7218551 Number of splices: GT/AG | 7234197 Number of splices: GC/AG | 96143 Number of splices: AT/AC | 5689 Number of splices: Non-canonical | 10701 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353574 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 19302 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 149421 149421 149421 N_multimapping 353574 353574 353574 N_noFeature 281603 11722180 355049 N_ambiguous 104720 633 46346 UnstrandedReadsAssigned:11467200 PositiveStrandReadsAssigned:130710 NegativeStrandReadsAssigned:11452128 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864442-trimmed-pair1.fastq ERR1864442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,342,992 reads, 11,651,741 reads pseudoaligned [quant] estimated average fragment length: 150.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 ERR1864442.ke.tsv 34699 ERR1864442.se.tsv 87100 total ==> ERR1864442.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1868.56 711 39.49 Potri.005G024800.1.v4.1 1035 885.561 138 16.1728 Potri.004G059700.1.v4.1 961 811.561 6 0.767282 Potri.007G009000.2.v4.1 1416 1266.56 0 0 Potri.003G141000.2.v4.1 2943 2793.56 533.349 19.8143 Potri.016G087400.1.v4.1 270 124.741 766 637.299 Potri.015G069301.1.v4.1 564 414.637 0 0 Potri.010G195200.1.v4.1 1773 1623.56 203 12.9763 Potri.012G127500.1.v4.1 977 827.561 2745 344.245 ==> ERR1864442.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 248 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 402 ERR1864442 completed mapping pipeline successfully