Starting /dee2/code/volunteer_pipeline.sh ERR1864443 current disk space = 3052650721280 free memory = 1418902016 ERR1864443 SRAfilesize a0a8f9f6512a47ed635a1b06dd6b2240 ERR1864443.sra ERR1864443.sra file validated ERR1864443 is paired end ERR1864443 is conventional basespace ERR1864443 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.80025 33.0 31.0 34.0 27.0 34.0 2 31.52225 34.0 31.0 34.0 28.0 34.0 3 32.10975 34.0 31.0 34.0 28.0 34.0 4 35.465 37.0 35.0 37.0 33.0 37.0 5 35.522 37.0 35.0 37.0 33.0 37.0 6 35.38425 37.0 35.0 37.0 33.0 37.0 7 35.38775 37.0 35.0 37.0 33.0 37.0 8 35.32775 37.0 35.0 37.0 33.0 37.0 9 37.108 39.0 37.0 39.0 34.0 39.0 10-11 37.013 39.0 37.0 39.0 33.0 39.0 12-13 36.954499999999996 39.0 37.0 39.0 33.0 39.0 14-15 38.319125 41.0 38.0 41.0 33.0 41.0 16-17 38.163 40.0 38.0 41.0 33.0 41.0 18-19 38.147375 40.0 38.0 41.0 33.0 41.0 20-21 38.039875 40.0 38.0 41.0 33.0 41.0 22-23 37.800875 40.0 38.0 41.0 32.0 41.0 24-25 37.82025 40.0 38.0 41.0 32.5 41.0 26-27 37.872125 40.0 38.0 41.0 33.0 41.0 28-29 37.746 40.0 38.0 41.0 32.5 41.0 30-31 37.544125 40.0 38.0 41.0 32.0 41.0 32-33 37.471875 40.0 38.0 41.0 31.5 41.0 34-35 37.367875 40.0 37.5 41.0 31.5 41.0 36-37 37.1865 40.0 37.0 41.0 31.0 41.0 38-39 37.0475 40.0 37.0 41.0 30.5 41.0 40-41 36.93925 40.0 37.0 41.0 30.0 41.0 42-43 36.693 40.0 37.0 41.0 30.0 41.0 44-45 36.692499999999995 40.0 36.5 41.0 30.0 41.0 46-47 36.79325 40.0 37.0 41.0 30.0 41.0 48-49 36.772999999999996 40.0 37.0 41.0 30.0 41.0 50-51 36.591499999999996 40.0 37.0 41.0 30.0 41.0 52-53 36.429 40.0 36.0 41.0 29.5 41.0 54-55 36.098625 39.5 35.5 41.0 28.5 41.0 56-57 35.836124999999996 39.0 35.0 41.0 28.0 41.0 58-59 35.731 39.0 35.0 41.0 28.0 41.0 60-61 35.562375 39.0 35.0 40.0 28.0 41.0 62-63 35.1605 38.0 34.5 40.0 27.0 41.0 64-65 34.688125 38.0 34.0 40.0 26.0 41.0 66-67 34.290375 37.0 34.0 40.0 26.0 41.0 68-69 34.1065 37.0 34.0 39.0 26.0 41.0 70-71 33.640874999999994 36.0 33.5 39.0 25.5 40.5 72-73 33.24975 36.0 33.0 38.5 25.5 40.0 74-75 32.645624999999995 35.0 32.0 37.5 24.5 39.0 76-77 31.618875000000003 34.0 30.5 36.0 23.5 39.0 78-79 31.862625 35.0 32.0 36.0 23.0 38.5 80-81 31.59275 35.0 32.0 36.0 22.0 37.0 82-83 31.256875 35.0 32.0 35.5 22.0 37.0 84-85 30.988374999999998 34.0 31.5 35.0 20.5 36.5 86-87 30.072000000000003 34.0 30.0 35.0 14.0 36.0 88-89 29.98875 34.0 30.5 35.0 14.0 36.0 90-91 29.834625000000003 34.0 30.0 35.0 9.0 35.0 92-93 29.544375000000002 34.0 30.5 35.0 4.5 35.0 94-95 29.307125 34.0 30.0 35.0 2.0 35.0 96-97 29.011625 34.0 30.0 35.0 2.0 35.0 98-99 28.4625 34.0 29.0 35.0 2.0 35.0 100-101 27.413625 33.0 27.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 20.0 4 10.0 5 6.0 6 7.0 7 11.0 8 6.0 9 8.0 10 9.0 11 8.0 12 11.0 13 9.0 14 13.0 15 15.0 16 14.0 17 13.0 18 16.0 19 6.0 20 13.0 21 12.0 22 17.0 23 25.0 24 27.0 25 30.0 26 33.0 27 44.0 28 50.0 29 58.0 30 76.0 31 89.0 32 111.0 33 154.0 34 196.0 35 294.0 36 469.0 37 902.0 38 1048.0 39 145.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.6055900621118 6.159420289855073 7.039337474120083 46.19565217391305 2 25.025 8.425 35.05 31.5 3 24.375 11.075 22.8 41.75 4 28.95 18.075 21.475 31.5 5 28.299999999999997 23.925 24.9 22.875 6 20.905226306576644 29.80745186296574 26.63165791447862 22.655663915978995 7 16.579144786196547 24.006001500375092 42.385596399099775 17.029257314328582 8 16.179044761190298 24.8062015503876 36.75918979744936 22.255563890972745 9 18.35458864716179 21.930482620655166 38.284571142785694 21.43035758939735 10-11 19.79244811202801 32.97074268567142 27.544386096524132 19.692423105776445 12-13 20.555138784696176 25.943985996499126 30.357589397349336 23.143285821455365 14-15 20.180045011252815 26.944236059014752 30.720180045011254 22.155538884721178 16-17 20.78019504876219 28.232058014503625 28.33208302075519 22.655663915978995 18-19 21.005251312828207 27.544386096524132 28.394598649662417 23.055763940985248 20-21 20.492623155788948 28.169542385596397 27.569392348087025 23.768442110527634 22-23 21.042760690172543 27.74443610902726 28.857214303575894 22.355588897224308 24-25 21.21780445111278 27.60690172543136 27.91947986996749 23.25581395348837 26-27 20.367591897974492 26.506626656664167 29.019754938734682 24.10602650662666 28-29 21.205301325331334 27.44436109027257 28.419604901225306 22.930732683170792 30-31 21.467866966741685 27.319329832458116 27.981995498874717 23.23080770192548 32-33 21.630407601900476 27.544386096524132 27.79444861215304 23.030757689422355 34-35 21.43035758939735 27.51937984496124 28.00700175043761 23.0432608152038 36-37 20.767691922980745 26.806701675418854 27.719429857464366 24.706176544136035 38-39 21.705426356589147 28.069517379344838 26.969242310577645 23.25581395348837 40-41 21.642910727681922 28.382095523880967 27.106776694173547 22.868217054263564 42-43 21.467866966741685 27.74443610902726 27.619404851212803 23.168292073018254 44-45 21.530382595648913 27.556889222305575 28.094523630907727 22.818204551137786 46-47 21.530382595648913 27.19429857464366 27.544386096524132 23.730932733183295 48-49 20.892723180795198 26.994248562140534 28.694673668417103 23.418354588647162 50-51 20.742685671417853 27.19429857464366 28.132033008252062 23.93098274568642 52-53 21.50200601805416 27.53259779338014 27.80842527582748 23.156970912738213 54-55 21.06776694173543 27.68192048012003 27.74443610902726 23.50587646911728 56-57 20.892723180795198 27.831957989497376 28.069517379344838 23.20580145036259 58-59 21.180295073768445 27.7569392348087 27.694423605901473 23.36834208552138 60-61 21.717929482370593 26.84421105276319 27.781945486371594 23.655913978494624 62-63 20.75259407425928 27.47843480435054 28.353544193024128 23.415426928366045 64-65 21.912499999999998 27.150000000000002 28.012500000000003 22.925 66-67 20.1625 27.8125 28.6125 23.4125 68-69 20.705176294073517 28.182045511377847 27.94448612153038 23.168292073018254 70-71 21.165145643205403 27.25340667583448 29.1911488936117 22.39029878734842 72-73 22.075 26.6 27.55 23.775 74-75 20.60257532191524 27.815976997124643 29.028628578572324 22.552819102387797 76-77 21.365170646330792 28.2410301287661 27.953494186773348 22.440305038129765 78-79 22.28614307153577 27.01350675337669 27.176088044022013 23.524262131065534 80-81 22.25 27.224999999999998 27.800000000000004 22.725 82-83 21.637500000000003 27.725 27.762500000000003 22.875 84-85 21.575 27.6375 27.3625 23.425 86-87 21.3875 28.6375 27.224999999999998 22.75 88-89 21.637500000000003 28.525 26.900000000000002 22.9375 90-91 22.1375 27.712500000000002 26.9125 23.2375 92-93 21.95 26.950000000000003 27.3875 23.7125 94-95 21.9 27.962500000000002 26.950000000000003 23.1875 96-97 21.15 27.9375 26.900000000000002 24.0125 98-99 21.7875 27.0 27.987499999999997 23.225 100-101 22.025 27.224999999999998 27.6125 23.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 2.0 28 4.0 29 8.0 30 10.5 31 12.5 32 19.5 33 24.5 34 42.5 35 59.0 36 76.5 37 96.0 38 113.0 39 144.5 40 172.5 41 196.0 42 222.0 43 268.5 44 284.5 45 279.5 46 289.0 47 277.5 48 237.5 49 197.5 50 175.5 51 148.5 52 121.5 53 109.0 54 96.0 55 71.5 56 50.0 57 34.5 58 27.0 59 23.0 60 17.0 61 11.5 62 13.5 63 16.0 64 11.5 65 5.0 66 4.0 67 6.5 68 5.0 69 5.0 70 4.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.025 38-39 0.025 40-41 0.025 42-43 0.025 44-45 0.025 46-47 0.025 48-49 0.025 50-51 0.025 52-53 0.3 54-55 0.025 56-57 0.025 58-59 0.025 60-61 0.025 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0125 72-73 0.0 74-75 0.0125 76-77 0.0125 78-79 0.05 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.42821158690176325 0.8500000000000001 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCACATCTCGTAT 6 0.15 TruSeq Adapter, Index 18 (97% over 40bp) CTGGGAGATAGTCCTCGATCACATCTGCTCTGCTCTTCCTGCCATCCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.42500000000000004 0.0 0.0 0.0 0.0 76-77 0.4875 0.0 0.0 0.0 0.0 78-79 0.6125 0.0 0.0 0.0 0.0 80-81 0.7125 0.0 0.0 0.0 0.0 82-83 0.9375 0.0 0.0 0.0 0.0 84-85 1.1875 0.0 0.0 0.0 0.0 86-87 1.4375 0.0 0.0 0.0 0.0 88-89 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864443 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864443_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95775 34.0 31.0 34.0 30.0 34.0 2 32.0175 34.0 31.0 34.0 30.0 34.0 3 32.10475 34.0 31.0 34.0 30.0 34.0 4 35.3225 37.0 35.0 37.0 33.0 37.0 5 35.4085 37.0 35.0 37.0 33.0 37.0 6 35.38675 37.0 35.0 37.0 33.0 37.0 7 35.438 37.0 35.0 37.0 33.0 37.0 8 35.43 37.0 35.0 37.0 33.0 37.0 9 37.00875 39.0 37.0 39.0 33.0 39.0 10-11 37.017125 39.0 37.0 39.0 33.0 39.0 12-13 36.85125 39.0 37.0 39.0 33.0 39.0 14-15 38.176375 41.0 38.0 41.0 33.0 41.0 16-17 38.051 40.0 38.0 41.0 32.5 41.0 18-19 38.048249999999996 40.0 38.0 41.0 33.0 41.0 20-21 38.034499999999994 40.0 38.0 41.0 33.0 41.0 22-23 37.75575 40.0 38.0 41.0 32.0 41.0 24-25 37.759625 40.0 38.0 41.0 32.0 41.0 26-27 37.73675 40.0 38.0 41.0 32.5 41.0 28-29 37.584500000000006 40.0 38.0 41.0 32.0 41.0 30-31 37.496375 40.0 38.0 41.0 31.5 41.0 32-33 37.295375 40.0 37.0 41.0 31.0 41.0 34-35 37.26575 40.0 37.5 41.0 31.0 41.0 36-37 37.040625 40.0 37.0 41.0 30.0 41.0 38-39 36.936375 40.0 37.0 41.0 30.0 41.0 40-41 36.912625 40.0 37.0 41.0 30.0 41.0 42-43 36.769125 40.0 37.0 41.0 30.0 41.0 44-45 36.59375 40.0 36.0 41.0 30.0 41.0 46-47 36.287625000000006 39.0 36.0 41.0 29.5 41.0 48-49 35.9805 39.0 35.0 41.0 28.0 41.0 50-51 35.852625 38.5 35.5 40.5 28.5 40.5 52-53 36.038875000000004 39.0 36.0 40.0 28.0 41.0 54-55 36.288 40.0 36.0 41.0 28.0 41.0 56-57 36.1395 39.0 36.0 41.0 28.0 41.0 58-59 35.797625 39.0 35.5 41.0 28.0 41.0 60-61 35.47825 39.0 35.0 41.0 27.0 41.0 62-63 35.192875 38.0 35.0 40.0 26.5 41.0 64-65 34.94425 38.0 34.5 40.0 26.0 41.0 66-67 34.547875000000005 37.0 34.0 40.0 26.0 41.0 68-69 34.141 37.0 34.0 39.0 26.0 41.0 70-71 33.58425 36.0 33.5 39.0 25.0 40.5 72-73 33.085 36.0 33.0 38.5 23.5 40.0 74-75 32.5835 35.0 32.5 37.0 22.5 39.0 76-77 31.826375 35.0 31.5 37.0 21.0 39.0 78-79 31.545375 35.0 31.5 36.0 21.0 38.0 80-81 31.288874999999997 35.0 31.5 36.0 20.5 37.0 82-83 30.80375 35.0 31.0 35.5 18.0 37.0 84-85 30.425 34.0 31.0 35.0 17.0 36.0 86-87 29.918875 34.0 30.5 35.0 10.0 36.0 88-89 29.538375000000002 34.0 29.5 35.0 7.0 35.5 90-91 29.483375000000002 34.0 30.0 35.0 3.5 35.0 92-93 29.0915 34.0 29.0 35.0 2.0 35.0 94-95 28.893125 34.0 30.0 35.0 2.0 35.0 96-97 27.927625 34.0 28.0 35.0 2.0 35.0 98-99 27.252000000000002 34.0 27.0 35.0 2.0 35.0 100-101 25.924625 32.5 22.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 12.0 4 6.0 5 5.0 6 5.0 7 3.0 8 5.0 9 5.0 10 5.0 11 14.0 12 11.0 13 15.0 14 14.0 15 14.0 16 16.0 17 16.0 18 19.0 19 16.0 20 21.0 21 22.0 22 28.0 23 21.0 24 38.0 25 44.0 26 41.0 27 30.0 28 60.0 29 62.0 30 79.0 31 95.0 32 113.0 33 132.0 34 221.0 35 308.0 36 489.0 37 878.0 38 980.0 39 130.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.61480740370185 19.409704852426213 13.856928464232116 37.11855927963982 2 26.388194097048522 24.087043521760883 34.04202101050525 15.482741370685343 3 20.255063765941486 27.631907976994246 29.782445611402853 22.330582645661416 4 22.461230615307652 31.740870435217612 25.11255627813907 20.68534267133567 5 24.381095273818453 34.55863965991498 23.355838959739934 17.704426106526633 6 19.35 37.625 24.3 18.725 7 19.775000000000002 20.599999999999998 37.925 21.7 8 20.9 25.374999999999996 29.4 24.325 9 21.25 24.525 30.0 24.224999999999998 10-11 23.0625 32.175 23.775 20.9875 12-13 23.078848560700877 25.707133917396746 26.933667083854818 24.28035043804756 14-15 22.04112337011033 27.745737211634903 28.046639919759276 22.166499498495487 16-17 23.439649781113197 27.37961225766104 27.754846779237024 21.425891181988742 18-19 23.055763940985248 27.819454863715933 27.419354838709676 21.705426356589147 20-21 23.702962870358796 28.92861607700963 25.740717589698715 21.627703462932867 22-23 23.325000000000003 27.8375 26.987499999999997 21.85 24-25 23.5125 28.625 26.987499999999997 20.875 26-27 23.6375 28.000000000000004 27.35 21.0125 28-29 22.675 29.062500000000004 26.3625 21.9 30-31 22.7 28.1 28.175 21.025 32-33 23.9875 28.6125 26.187500000000004 21.212500000000002 34-35 24.1125 27.3625 26.4625 22.0625 36-37 22.475 28.575 26.8625 22.0875 38-39 23.3875 27.6625 27.825 21.125 40-41 23.577947243405426 27.815976997124643 27.815976997124643 20.790098762345295 42-43 22.6125 28.025 27.450000000000003 21.912499999999998 44-45 22.9625 27.9375 27.6375 21.462500000000002 46-47 23.7125 27.6875 27.05 21.55 48-49 22.975 28.037499999999998 27.700000000000003 21.2875 50-51 23.575 27.462500000000002 27.575 21.3875 52-53 22.925 28.925 26.75 21.4 54-55 23.355838959739934 28.232058014503625 27.26931732933233 21.142785696424106 56-57 22.97111416781293 28.2856071026635 27.360260097536575 21.383018631986992 58-59 24.278034754344294 27.303412926615827 27.11588948618577 21.302662832854107 60-61 23.2375 28.025 27.6 21.1375 62-63 22.5875 28.4 28.0875 20.925 64-65 23.7625 28.012500000000003 27.025 21.2 66-67 23.225 28.325 27.462500000000002 20.9875 68-69 23.65 27.725 26.787499999999998 21.837500000000002 70-71 23.1625 28.537499999999998 26.6625 21.637500000000003 72-73 23.9125 27.975 26.775 21.337500000000002 74-75 22.912499999999998 28.475 26.7625 21.85 76-77 23.45 28.262500000000003 26.775 21.512500000000003 78-79 23.0875 28.762500000000003 26.5875 21.5625 80-81 22.8625 28.9 26.6625 21.575 82-83 24.7875 28.025 26.0375 21.15 84-85 23.474999999999998 28.525 27.5875 20.4125 86-87 23.5 28.237499999999997 27.025 21.2375 88-89 24.5625 28.475 26.2625 20.7 90-91 23.875 28.225 26.387500000000003 21.512500000000003 92-93 23.549999999999997 28.725 26.625 21.099999999999998 94-95 24.5 27.950000000000003 26.275 21.275 96-97 24.1125 28.000000000000004 26.674999999999997 21.212500000000002 98-99 24.2 29.099999999999998 25.7875 20.9125 100-101 24.3625 27.462500000000002 26.237500000000004 21.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 3.0 27 3.5 28 6.0 29 8.5 30 13.5 31 19.5 32 23.0 33 34.0 34 41.5 35 46.5 36 66.0 37 86.0 38 115.5 39 161.0 40 189.5 41 216.5 42 255.5 43 275.5 44 282.0 45 284.0 46 271.0 47 242.5 48 217.5 49 202.5 50 188.5 51 152.0 52 118.5 53 108.5 54 84.5 55 57.0 56 42.5 57 31.5 58 23.0 59 22.5 60 18.5 61 16.5 62 16.5 63 10.0 64 8.0 65 7.5 66 5.5 67 5.0 68 4.0 69 2.5 70 1.5 71 2.5 72 1.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.025 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.125 14-15 0.3 16-17 0.0625 18-19 0.025 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0375 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1625 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.1125 0.0 0.0 0.0 0.0 86-87 1.3875000000000002 0.0 0.0 0.0 0.0 88-89 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647133 spots for ERR1864443.sra Written 647133 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra Read 647132 spots for ERR1864443.sra Written 647132 spots for ERR1864443.sra SRR ids: ['ERR1864443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jbyq4jl ERR1864443.sra spots: 12942641 blocks: [[1, 647132], [647133, 1294264], [1294265, 1941396], [1941397, 2588528], [2588529, 3235660], [3235661, 3882792], [3882793, 4529924], [4529925, 5177056], [5177057, 5824188], [5824189, 6471320], [6471321, 7118452], [7118453, 7765584], [7765585, 8412716], [8412717, 9059848], [9059849, 9706980], [9706981, 10354112], [10354113, 11001244], [11001245, 11648376], [11648377, 12295508], [12295509, 12942641]] ERR1864443 file size 3100206 ERR1864443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864443 ERR1864443_1.fastq ERR1864443_2.fastq Input file: ERR1864443_1.fastq Paired file: ERR1864443_2.fastq trimmed: ERR1864443-trimmed-pair1.fastq, ERR1864443-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:05:14 2025 >> started Thu Feb 13 09:13:41 2025 >> done (506.640s) 12942641 read pairs processed; of these: 145908 ( 1.13%) short read pairs filtered out after trimming by size control 160442 ( 1.24%) empty read pairs filtered out after trimming by size control 12636291 (97.63%) read pairs available; of these: 2858363 (22.62%) trimmed read pairs available after processing 9777928 (77.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 67 0.00% 19 164 0.00% 20 264 0.00% 21 314 0.00% 22 391 0.00% 23 496 0.00% 24 653 0.01% 25 695 0.01% 26 858 0.01% 27 1022 0.01% 28 1195 0.01% 29 1354 0.01% 30 1546 0.01% 31 1766 0.01% 32 2044 0.02% 33 2218 0.02% 34 2482 0.02% 35 2650 0.02% 36 2768 0.02% 37 3142 0.02% 38 3369 0.03% 39 3578 0.03% 40 3910 0.03% 41 3980 0.03% 42 4364 0.03% 43 4499 0.04% 44 4838 0.04% 45 5123 0.04% 46 5545 0.04% 47 5634 0.04% 48 5922 0.05% 49 6334 0.05% 50 6614 0.05% 51 6908 0.05% 52 7398 0.06% 53 7534 0.06% 54 7979 0.06% 55 8514 0.07% 56 9064 0.07% 57 9517 0.08% 58 10095 0.08% 59 13012 0.10% 60 15808 0.13% 61 16415 0.13% 62 16675 0.13% 63 17322 0.14% 64 18273 0.14% 65 18873 0.15% 66 19453 0.15% 67 20681 0.16% 68 21324 0.17% 69 22757 0.18% 70 23577 0.19% 71 24694 0.20% 72 25900 0.20% 73 26598 0.21% 74 28069 0.22% 75 28786 0.23% 76 28895 0.23% 77 30451 0.24% 78 32369 0.26% 79 34456 0.27% 80 36765 0.29% 81 38145 0.30% 82 40594 0.32% 83 42979 0.34% 84 45761 0.36% 85 48518 0.38% 86 51394 0.41% 87 54390 0.43% 88 55906 0.44% 89 59502 0.47% 90 65345 0.52% 91 72270 0.57% 92 78923 0.62% 93 88030 0.70% 94 99276 0.79% 95 114069 0.90% 96 134884 1.07% 97 166713 1.32% 98 213857 1.69% 99 278484 2.20% 100 431362 3.41% 101 9777928 77.38% 12636291 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=28 prefix-density=0.18 prefix-fanout=2.6 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=305.22 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=21.7 sequence=TCTTCTTCTTTCT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=29 prefix-density=0.15 prefix-fanout=2.0 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=410.95 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=29.9 sequence=AAGAAGAAGAGTTACTTTGAGCAAGCCAAGGACATGATACCAGCATATAAGAAAACTGAAGA ERR1864443 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 09:20:50 Started mapping on | Feb 13 09:20:56 Finished on | Feb 13 09:35:14 Mapping speed, Million of reads per hour | 53.02 Number of input reads | 12636291 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 12112337 Uniquely mapped reads % | 95.85% Average mapped length | 195.98 Number of splices: Total | 7569382 Number of splices: Annotated (sjdb) | 7429548 Number of splices: GT/AG | 7452138 Number of splices: GC/AG | 100065 Number of splices: AT/AC | 5933 Number of splices: Non-canonical | 11246 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364824 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 12471 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 174466 174466 174466 N_multimapping 364824 364824 364824 N_noFeature 297909 11995766 357741 N_ambiguous 106676 582 49541 UnstrandedReadsAssigned:11707752 PositiveStrandReadsAssigned:115989 NegativeStrandReadsAssigned:11705055 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864443 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864443-trimmed-pair1.fastq ERR1864443-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,636,291 reads, 11,904,204 reads pseudoaligned [quant] estimated average fragment length: 154.52 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 ERR1864443.ke.tsv 34699 ERR1864443.se.tsv 87100 total ==> ERR1864443.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1864.48 875 47.4711 Potri.005G024800.1.v4.1 1035 881.48 192 22.0327 Potri.004G059700.1.v4.1 961 807.48 5 0.62635 Potri.007G009000.2.v4.1 1416 1262.48 0 0 Potri.003G141000.2.v4.1 2943 2789.48 565.549 20.5081 Potri.016G087400.1.v4.1 270 122.447 970.797 801.971 Potri.015G069301.1.v4.1 564 410.6 0 0 Potri.010G195200.1.v4.1 1773 1619.48 226 14.116 Potri.012G127500.1.v4.1 977 823.48 2293 281.663 ==> ERR1864443.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 187 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 72 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 494 ERR1864443 completed mapping pipeline successfully