Starting /dee2/code/volunteer_pipeline.sh ERR1864444 current disk space = 3052658188288 free memory = 1456822232 ERR1864444 SRAfilesize 0dd55222e409f8bf8a5cad8279a7c0bf ERR1864444.sra ERR1864444.sra file validated ERR1864444 is paired end ERR1864444 is conventional basespace ERR1864444 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.517 34.0 31.0 34.0 30.0 34.0 2 31.99325 34.0 31.0 34.0 30.0 34.0 3 32.33025 34.0 31.0 34.0 30.0 34.0 4 35.7215 37.0 35.0 37.0 35.0 37.0 5 35.44775 37.0 35.0 37.0 33.0 37.0 6 35.583 37.0 35.0 37.0 35.0 37.0 7 35.58825 37.0 36.0 37.0 35.0 37.0 8 35.6135 37.0 36.0 37.0 35.0 37.0 9 37.279 39.0 38.0 39.0 35.0 39.0 10-11 37.200500000000005 39.0 38.0 39.0 35.0 39.0 12-13 37.075874999999996 39.0 38.0 39.0 34.0 39.0 14-15 38.626875 41.0 39.0 41.0 34.5 41.0 16-17 38.584999999999994 41.0 39.0 41.0 34.5 41.0 18-19 38.556875 41.0 39.0 41.0 34.0 41.0 20-21 38.511375 41.0 39.0 41.0 34.0 41.0 22-23 38.42775 41.0 39.0 41.0 34.0 41.0 24-25 38.266999999999996 41.0 38.0 41.0 33.5 41.0 26-27 38.351375000000004 41.0 39.0 41.0 34.0 41.0 28-29 38.266375 41.0 38.0 41.0 34.0 41.0 30-31 38.214625 40.0 38.0 41.0 34.0 41.0 32-33 38.175375 40.0 38.0 41.0 34.0 41.0 34-35 38.073 40.0 38.0 41.0 33.5 41.0 36-37 37.988125 40.0 38.0 41.0 33.0 41.0 38-39 37.929500000000004 40.0 38.0 41.0 33.0 41.0 40-41 37.885000000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.877250000000004 40.0 38.0 41.0 33.0 41.0 44-45 37.716875 40.0 38.0 41.0 33.0 41.0 46-47 37.562124999999995 40.0 38.0 41.0 32.5 41.0 48-49 37.490875 40.0 38.0 41.0 32.0 41.0 50-51 37.28725 40.0 37.0 41.0 31.5 41.0 52-53 37.205375000000004 40.0 37.0 41.0 31.5 41.0 54-55 36.96725 40.0 37.0 41.0 31.0 41.0 56-57 36.778375 40.0 36.0 41.0 31.0 41.0 58-59 36.521 39.0 36.0 41.0 30.5 41.0 60-61 36.355000000000004 39.0 36.0 41.0 30.0 41.0 62-63 36.403875 39.0 35.5 41.0 30.5 41.0 64-65 36.0675 39.0 35.0 40.5 30.0 41.0 66-67 35.77275 38.0 35.0 40.0 30.0 41.0 68-69 35.507999999999996 37.5 35.0 40.0 29.5 41.0 70-71 34.784 36.5 34.5 39.0 28.5 41.0 72-73 34.443375 36.0 34.0 39.0 29.0 40.5 74-75 33.87975 35.5 33.5 38.0 27.5 39.5 76-77 32.193 34.5 31.5 36.0 26.0 39.0 78-79 33.0355 35.0 33.5 37.0 26.0 39.0 80-81 32.89425 35.0 33.5 36.5 26.5 38.5 82-83 32.637 35.0 33.0 36.0 26.5 37.0 84-85 32.398125 35.0 33.0 36.0 26.5 37.0 86-87 32.112125 35.0 33.0 35.0 26.0 36.5 88-89 31.776 35.0 33.0 35.0 25.0 36.0 90-91 31.684125 35.0 33.0 35.0 25.0 36.0 92-93 31.426250000000003 35.0 32.5 35.0 25.0 35.5 94-95 31.198999999999998 35.0 32.0 35.0 24.5 35.0 96-97 31.058500000000002 35.0 32.0 35.0 24.0 35.0 98-99 30.851625 35.0 32.0 35.0 23.0 35.0 100-101 29.836375 34.0 30.5 34.5 11.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 12.0 4 7.0 5 3.0 6 4.0 7 5.0 8 2.0 9 8.0 10 1.0 11 2.0 12 6.0 13 7.0 14 7.0 15 7.0 16 8.0 17 8.0 18 15.0 19 17.0 20 16.0 21 7.0 22 11.0 23 4.0 24 17.0 25 21.0 26 23.0 27 29.0 28 37.0 29 40.0 30 50.0 31 68.0 32 74.0 33 129.0 34 177.0 35 217.0 36 410.0 37 908.0 38 1346.0 39 261.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.25975359342916 11.704312114989733 9.625256673511293 50.41067761806981 2 19.1 16.675 39.6 24.625 3 19.55 22.725 23.724999999999998 34.0 4 22.325 30.75 21.175 25.75 5 21.85 32.375 26.1 19.675 6 16.55 36.6 26.700000000000003 20.150000000000002 7 12.675 26.05 42.825 18.45 8 18.475 23.5 32.275 25.75 9 18.675 22.875 34.699999999999996 23.75 10-11 19.4875 33.75 24.55 22.2125 12-13 19.537499999999998 25.650000000000002 28.712500000000002 26.1 14-15 19.662499999999998 28.1 28.762500000000003 23.474999999999998 16-17 19.275000000000002 29.0875 27.462500000000002 24.175 18-19 19.5625 28.1 27.825 24.5125 20-21 19.900000000000002 29.1375 26.775 24.1875 22-23 19.975 28.3125 28.299999999999997 23.4125 24-25 19.2625 28.95 27.500000000000004 24.2875 26-27 19.3875 29.1875 27.474999999999998 23.95 28-29 19.3875 29.0875 27.675 23.849999999999998 30-31 18.9375 29.1125 28.3125 23.6375 32-33 19.25 29.212500000000002 27.675 23.8625 34-35 20.3625 28.8625 27.750000000000004 23.025000000000002 36-37 20.95 28.6875 27.075 23.2875 38-39 20.1875 28.4125 28.1125 23.2875 40-41 20.275000000000002 28.512500000000003 27.35 23.8625 42-43 20.0 29.75 26.6125 23.6375 44-45 19.037499999999998 29.799999999999997 27.2625 23.9 46-47 20.5125 29.2 27.400000000000002 22.8875 48-49 19.9625 27.3 28.65 24.087500000000002 50-51 20.674999999999997 27.875 27.474999999999998 23.974999999999998 52-53 19.225 28.050000000000004 28.0625 24.6625 54-55 19.9125 28.875 27.3125 23.9 56-57 19.0125 28.975 28.075 23.9375 58-59 20.125 29.1875 27.5125 23.175 60-61 20.3625 28.000000000000004 27.9375 23.7 62-63 20.5125 28.449999999999996 28.249999999999996 22.787499999999998 64-65 19.225 28.6125 28.15 24.0125 66-67 20.0875 27.762500000000003 27.8875 24.2625 68-69 20.1125 28.7375 28.000000000000004 23.150000000000002 70-71 20.150000000000002 28.812500000000004 27.625 23.4125 72-73 19.4625 28.675 26.8 25.0625 74-75 19.8 27.8125 28.825 23.5625 76-77 20.7375 28.6875 27.325 23.25 78-79 21.075 28.787499999999998 27.575 22.5625 80-81 19.7625 29.012500000000003 27.750000000000004 23.474999999999998 82-83 19.5875 28.575 27.6375 24.2 84-85 20.7 28.1125 26.700000000000003 24.4875 86-87 20.200000000000003 28.475 27.700000000000003 23.625 88-89 20.6375 28.6875 27.474999999999998 23.200000000000003 90-91 21.725 28.3375 27.325 22.6125 92-93 21.55 28.599999999999998 26.387500000000003 23.4625 94-95 20.2375 28.3125 28.625 22.825 96-97 20.724999999999998 27.625 28.549999999999997 23.1 98-99 20.8125 27.525 27.625 24.0375 100-101 20.7375 29.262500000000003 26.7125 23.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.5 26 3.5 27 9.0 28 9.5 29 11.0 30 19.5 31 25.0 32 31.5 33 38.0 34 48.5 35 74.5 36 105.5 37 124.5 38 152.0 39 186.5 40 198.0 41 215.0 42 248.0 43 257.5 44 257.0 45 257.0 46 257.0 47 246.0 48 227.0 49 195.0 50 167.5 51 142.5 52 104.5 53 85.0 54 67.0 55 50.5 56 39.5 57 32.0 58 23.0 59 20.0 60 22.0 61 15.5 62 8.5 63 5.5 64 3.0 65 1.5 66 0.5 67 1.5 68 2.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.8375 0.0 0.0 0.0 0.0 84-85 1.0750000000000002 0.0 0.0 0.0 0.0 86-87 1.2625000000000002 0.0 0.0 0.0 0.0 88-89 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864444 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09025 33.0 31.0 34.0 30.0 34.0 2 32.152 34.0 31.0 34.0 30.0 34.0 3 32.08225 34.0 31.0 34.0 30.0 34.0 4 35.51125 37.0 35.0 37.0 33.0 37.0 5 35.563 37.0 35.0 37.0 33.0 37.0 6 35.4545 37.0 36.0 37.0 33.0 37.0 7 35.58275 37.0 36.0 37.0 33.0 37.0 8 35.525 37.0 36.0 37.0 33.0 37.0 9 36.98375 39.0 37.0 39.0 33.0 39.0 10-11 37.101 39.0 37.5 39.0 33.5 39.0 12-13 37.03025 39.0 37.5 39.0 33.5 39.0 14-15 38.547124999999994 41.0 38.0 41.0 34.0 41.0 16-17 38.405375 41.0 38.0 41.0 33.5 41.0 18-19 38.49225 41.0 38.5 41.0 34.0 41.0 20-21 38.444 41.0 38.5 41.0 34.0 41.0 22-23 38.431125 41.0 39.0 41.0 34.0 41.0 24-25 38.174499999999995 40.0 38.0 41.0 33.0 41.0 26-27 38.092124999999996 40.0 38.0 41.0 33.0 41.0 28-29 37.993375 40.0 38.0 41.0 33.0 41.0 30-31 37.907875000000004 40.0 38.0 41.0 33.0 41.0 32-33 37.77525 40.0 38.0 41.0 32.5 41.0 34-35 37.67725 40.0 38.0 41.0 32.0 41.0 36-37 37.49675 40.0 38.0 41.0 31.5 41.0 38-39 37.46375 40.0 38.0 41.0 32.0 41.0 40-41 37.501875 40.0 38.0 41.0 31.5 41.0 42-43 37.215625 40.0 37.5 41.0 30.5 41.0 44-45 37.28675 40.0 38.0 41.0 31.0 41.0 46-47 37.055625 40.0 37.0 41.0 30.5 41.0 48-49 37.139125 40.0 37.0 41.0 31.0 41.0 50-51 36.274375 39.0 36.0 40.5 29.5 40.5 52-53 36.34775 39.0 36.0 40.0 30.5 41.0 54-55 36.527375 39.0 36.0 41.0 29.5 41.0 56-57 36.358875 39.0 35.5 41.0 29.5 41.0 58-59 36.122 39.0 35.5 41.0 28.5 41.0 60-61 35.863875 39.0 35.0 40.5 28.5 41.0 62-63 35.675 38.5 35.0 40.0 28.0 41.0 64-65 35.25975 38.0 34.5 40.0 27.5 41.0 66-67 35.30575 38.0 35.0 40.0 28.5 41.0 68-69 35.014125 37.0 35.0 39.5 29.0 41.0 70-71 34.361999999999995 36.5 34.0 39.0 26.0 41.0 72-73 34.02575 36.0 34.0 39.0 27.0 40.5 74-75 32.914 35.0 33.0 37.0 24.0 39.0 76-77 33.099000000000004 35.0 33.5 37.0 26.0 39.0 78-79 32.3785 35.0 33.0 36.5 25.0 39.0 80-81 32.316374999999994 35.0 33.0 36.0 25.5 37.0 82-83 32.156875 35.0 33.0 36.0 25.5 37.0 84-85 31.900375 35.0 33.0 35.5 25.0 36.5 86-87 31.837375 35.0 33.0 35.0 25.0 36.0 88-89 31.606749999999998 35.0 33.0 35.0 25.0 36.0 90-91 31.33325 35.0 32.5 35.0 24.0 36.0 92-93 31.229125 35.0 32.5 35.0 24.0 35.0 94-95 30.83475 35.0 32.0 35.0 21.0 35.0 96-97 30.611125 35.0 32.0 35.0 19.5 35.0 98-99 30.22175 34.5 31.5 35.0 6.0 35.0 100-101 29.1245 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 4.0 4 3.0 5 6.0 6 4.0 7 4.0 8 8.0 9 12.0 10 8.0 11 9.0 12 9.0 13 11.0 14 13.0 15 17.0 16 16.0 17 11.0 18 8.0 19 8.0 20 8.0 21 10.0 22 15.0 23 12.0 24 21.0 25 24.0 26 39.0 27 41.0 28 38.0 29 48.0 30 51.0 31 61.0 32 114.0 33 134.0 34 184.0 35 231.0 36 448.0 37 916.0 38 1223.0 39 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.25 15.775 15.15 38.824999999999996 2 22.475 25.3 37.075 15.15 3 20.599999999999998 28.050000000000004 30.125 21.224999999999998 4 23.375 34.65 21.7 20.275000000000002 5 25.374999999999996 36.025 22.875 15.725 6 19.900000000000002 37.7 24.0 18.4 7 19.725 18.025 41.099999999999994 21.15 8 20.875 23.65 29.549999999999997 25.924999999999997 9 23.175 22.6 30.075000000000003 24.15 10-11 24.1625 31.574999999999996 24.0625 20.200000000000003 12-13 24.9875 25.1875 27.150000000000002 22.675 14-15 22.875 27.675 28.4 21.05 16-17 23.8125 27.750000000000004 27.6125 20.825 18-19 22.900000000000002 29.4875 27.0625 20.549999999999997 20-21 23.775 27.8875 27.1125 21.224999999999998 22-23 23.5125 29.025000000000002 27.0875 20.375 24-25 22.9375 28.812500000000004 28.199999999999996 20.05 26-27 22.537499999999998 28.475 28.1125 20.875 28-29 24.525 27.3 27.800000000000004 20.375 30-31 22.85 28.5875 27.800000000000004 20.7625 32-33 23.0625 28.3875 27.700000000000003 20.849999999999998 34-35 23.474999999999998 27.800000000000004 27.3 21.425 36-37 24.375 26.8625 28.1 20.6625 38-39 23.0 28.1625 27.6 21.2375 40-41 23.05 27.450000000000003 28.275 21.224999999999998 42-43 22.5625 28.575 27.700000000000003 21.1625 44-45 23.599999999999998 28.325 28.762500000000003 19.3125 46-47 23.974999999999998 27.825 27.9375 20.2625 48-49 23.375 27.762500000000003 28.6625 20.200000000000003 50-51 23.799999999999997 28.037499999999998 27.575 20.5875 52-53 22.912499999999998 28.575 27.9375 20.575 54-55 23.1625 28.037499999999998 28.849999999999998 19.950000000000003 56-57 24.375 27.762500000000003 27.762500000000003 20.1 58-59 24.65 26.9625 27.875 20.5125 60-61 23.5375 28.825 27.987499999999997 19.650000000000002 62-63 23.5125 27.325 28.287499999999998 20.875 64-65 23.1 27.875 28.762500000000003 20.2625 66-67 23.724999999999998 27.762500000000003 27.712500000000002 20.8 68-69 23.677298311444652 28.005003126954346 28.542839274546594 19.774859287054408 70-71 24.1875 27.85 27.737499999999997 20.225 72-73 24.474999999999998 27.0875 28.249999999999996 20.1875 74-75 24.2 27.35 28.225 20.225 76-77 23.549999999999997 27.8875 27.6375 20.925 78-79 23.025000000000002 27.650000000000002 28.1625 21.1625 80-81 24.453056632079008 28.091011376422053 27.815976997124643 19.6399549943743 82-83 24.2375 27.787499999999998 27.3375 20.6375 84-85 24.099999999999998 28.4375 27.8125 19.650000000000002 86-87 23.49043630453807 28.55356919614952 28.178522315289413 19.777472184023004 88-89 23.674999999999997 27.950000000000003 28.575 19.8 90-91 24.265533191648956 28.20352544068008 27.94099262407801 19.58994874359295 92-93 23.8375 29.025000000000002 27.5625 19.575 94-95 24.2625 28.299999999999997 27.400000000000002 20.0375 96-97 23.85240775484678 28.467792370231393 27.6172607879925 20.06253908692933 98-99 24.70308788598575 27.703462932866607 27.315914489311165 20.27753469183648 100-101 24.837500000000002 27.3625 27.787499999999998 20.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.5 25 3.5 26 4.5 27 6.5 28 6.5 29 8.0 30 14.0 31 21.0 32 21.5 33 32.0 34 47.0 35 73.5 36 98.5 37 105.0 38 131.5 39 172.0 40 197.5 41 222.5 42 244.0 43 265.0 44 286.5 45 271.5 46 258.0 47 250.5 48 234.5 49 209.5 50 169.0 51 141.5 52 113.0 53 92.0 54 80.0 55 52.0 56 34.0 57 31.5 58 28.0 59 22.0 60 15.5 61 9.0 62 6.0 63 5.5 64 4.5 65 2.5 66 1.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0625 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0125 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0625 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.8125 0.0 0.0 0.0 0.0 84-85 1.0499999999999998 0.0 0.0 0.0 0.0 86-87 1.2374999999999998 0.0 0.0 0.0 0.0 88-89 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894851 spots for ERR1864444.sra Written 894851 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra Read 894832 spots for ERR1864444.sra Written 894832 spots for ERR1864444.sra SRR ids: ['ERR1864444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_13rv1911 ERR1864444.sra spots: 17896659 blocks: [[1, 894832], [894833, 1789664], [1789665, 2684496], [2684497, 3579328], [3579329, 4474160], [4474161, 5368992], [5368993, 6263824], [6263825, 7158656], [7158657, 8053488], [8053489, 8948320], [8948321, 9843152], [9843153, 10737984], [10737985, 11632816], [11632817, 12527648], [12527649, 13422480], [13422481, 14317312], [14317313, 15212144], [15212145, 16106976], [16106977, 17001808], [17001809, 17896659]] ERR1864444 file size 4295169 ERR1864444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864444 ERR1864444_1.fastq ERR1864444_2.fastq Input file: ERR1864444_1.fastq Paired file: ERR1864444_2.fastq trimmed: ERR1864444-trimmed-pair1.fastq, ERR1864444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 09:42:27 2025 >> started Thu Feb 13 09:46:49 2025 >> done (262.296s) 17896659 read pairs processed; of these: 210247 ( 1.17%) short read pairs filtered out after trimming by size control 242782 ( 1.36%) empty read pairs filtered out after trimming by size control 17443630 (97.47%) read pairs available; of these: 4304099 (24.67%) trimmed read pairs available after processing 13139531 (75.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 114 0.00% 19 275 0.00% 20 454 0.00% 21 536 0.00% 22 733 0.00% 23 853 0.00% 24 1038 0.01% 25 1267 0.01% 26 1499 0.01% 27 1689 0.01% 28 1980 0.01% 29 2284 0.01% 30 2666 0.02% 31 2951 0.02% 32 3277 0.02% 33 3775 0.02% 34 3998 0.02% 35 4457 0.03% 36 4796 0.03% 37 5149 0.03% 38 5632 0.03% 39 6026 0.03% 40 6610 0.04% 41 6779 0.04% 42 7168 0.04% 43 7609 0.04% 44 8069 0.05% 45 8540 0.05% 46 8991 0.05% 47 9211 0.05% 48 9841 0.06% 49 10240 0.06% 50 10786 0.06% 51 11426 0.07% 52 11576 0.07% 53 12409 0.07% 54 12757 0.07% 55 13524 0.08% 56 14102 0.08% 57 14865 0.09% 58 15537 0.09% 59 18551 0.11% 60 21525 0.12% 61 22172 0.13% 62 23090 0.13% 63 24132 0.14% 64 25061 0.14% 65 26248 0.15% 66 27090 0.16% 67 28349 0.16% 68 29558 0.17% 69 30629 0.18% 70 32299 0.19% 71 33951 0.19% 72 35211 0.20% 73 38577 0.22% 74 39495 0.23% 75 40837 0.23% 76 40200 0.23% 77 42632 0.24% 78 44443 0.25% 79 45571 0.26% 80 47939 0.27% 81 49945 0.29% 82 53318 0.31% 83 56686 0.32% 84 60601 0.35% 85 65080 0.37% 86 69008 0.40% 87 75474 0.43% 88 76365 0.44% 89 80488 0.46% 90 88725 0.51% 91 98292 0.56% 92 109167 0.63% 93 122094 0.70% 94 137769 0.79% 95 160743 0.92% 96 192491 1.10% 97 237212 1.36% 98 317846 1.82% 99 445904 2.56% 100 833842 4.78% 101 13139531 75.33% 17443630 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=21 prefix-density=0.27 prefix-fanout=2.4 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=14.11 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.6 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=14 prefix-density=0.62 prefix-fanout=2.0 sequence=CTGCAAGTGCGGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=173.25 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.7 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT ERR1864444 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 10:36:16 Started mapping on | Feb 13 10:36:41 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 36.13 Number of input reads | 17443630 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16716922 Uniquely mapped reads % | 95.83% Average mapped length | 195.69 Number of splices: Total | 9728983 Number of splices: Annotated (sjdb) | 9561305 Number of splices: GT/AG | 9582778 Number of splices: GC/AG | 122732 Number of splices: AT/AC | 8356 Number of splices: Non-canonical | 15117 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452567 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 34657 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 291672 291672 291672 N_multimapping 452567 452567 452567 N_noFeature 408253 16534184 517773 N_ambiguous 144108 765 70392 UnstrandedReadsAssigned:16164561 PositiveStrandReadsAssigned:181973 NegativeStrandReadsAssigned:16128757 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864444-trimmed-pair1.fastq ERR1864444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,443,630 reads, 16,333,544 reads pseudoaligned [quant] estimated average fragment length: 169.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 ERR1864444.ke.tsv 34699 ERR1864444.se.tsv 87100 total ==> ERR1864444.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1849.68 2094 69.8736 Potri.005G024800.1.v4.1 1035 866.681 2012 143.285 Potri.004G059700.1.v4.1 961 792.681 36 2.80309 Potri.007G009000.2.v4.1 1416 1247.68 0 0 Potri.003G141000.2.v4.1 2943 2774.68 944.51 21.01 Potri.016G087400.1.v4.1 270 113.554 966 525.059 Potri.015G069301.1.v4.1 564 395.863 0 0 Potri.010G195200.1.v4.1 1773 1604.68 179 6.8849 Potri.012G127500.1.v4.1 977 808.681 17203 1312.99 ==> ERR1864444.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 208 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 198 ERR1864444 completed mapping pipeline successfully