Starting /dee2/code/volunteer_pipeline.sh ERR1864445 current disk space = 3093354762240 free memory = 1436144212 ERR1864445 SRAfilesize 3f54ba3bf97b39df60f88c95b7991763 ERR1864445.sra ERR1864445.sra file validated ERR1864445 is paired end ERR1864445 is conventional basespace ERR1864445 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864445_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.667 34.0 31.0 34.0 30.0 34.0 2 32.21175 34.0 31.0 34.0 30.0 34.0 3 32.516 34.0 31.0 34.0 30.0 34.0 4 35.913 37.0 37.0 37.0 35.0 37.0 5 35.67725 37.0 35.0 37.0 35.0 37.0 6 35.73625 37.0 36.0 37.0 35.0 37.0 7 35.8095 37.0 36.0 37.0 35.0 37.0 8 35.78475 37.0 37.0 37.0 35.0 37.0 9 37.543 39.0 39.0 39.0 35.0 39.0 10-11 37.4515 39.0 38.0 39.0 35.0 39.0 12-13 37.2935 39.0 38.0 39.0 34.5 39.0 14-15 38.835375 41.0 39.0 41.0 34.5 41.0 16-17 38.755125 41.0 39.0 41.0 35.0 41.0 18-19 38.816874999999996 41.0 39.0 41.0 35.0 41.0 20-21 38.690124999999995 41.0 39.0 41.0 35.0 41.0 22-23 38.67975 41.0 39.0 41.0 34.0 41.0 24-25 38.445875 41.0 38.5 41.0 33.5 41.0 26-27 38.625875 41.0 39.0 41.0 34.0 41.0 28-29 38.59125 41.0 39.0 41.0 34.0 41.0 30-31 38.535375 41.0 39.0 41.0 34.0 41.0 32-33 38.455875 41.0 38.5 41.0 34.0 41.0 34-35 38.300250000000005 40.5 38.0 41.0 33.5 41.0 36-37 38.21875 40.0 38.0 41.0 33.5 41.0 38-39 38.185375 40.0 38.0 41.0 33.5 41.0 40-41 38.11225 40.0 38.0 41.0 33.0 41.0 42-43 38.09075 40.0 38.0 41.0 33.0 41.0 44-45 37.825125 40.0 38.0 41.0 33.0 41.0 46-47 37.698125000000005 40.0 38.0 41.0 33.0 41.0 48-49 37.733000000000004 40.0 38.0 41.0 33.0 41.0 50-51 37.539249999999996 40.0 37.5 41.0 32.5 41.0 52-53 37.414875 40.0 37.0 41.0 32.0 41.0 54-55 37.195 40.0 37.0 41.0 31.0 41.0 56-57 36.900125 40.0 36.5 41.0 31.0 41.0 58-59 36.6895 39.0 36.0 41.0 31.0 41.0 60-61 36.540375 39.0 36.0 41.0 30.5 41.0 62-63 36.532 39.0 35.5 41.0 31.0 41.0 64-65 36.376999999999995 39.0 35.0 40.5 31.0 41.0 66-67 35.987 38.5 35.0 40.0 30.0 41.0 68-69 35.690124999999995 37.5 35.0 40.0 30.5 41.0 70-71 35.026875000000004 37.0 34.5 39.0 29.0 41.0 72-73 34.638 36.0 34.0 39.0 29.0 40.5 74-75 34.110625 35.5 34.0 38.0 28.5 39.5 76-77 32.460625 34.5 31.5 36.0 26.0 39.0 78-79 33.26325 35.0 33.5 37.0 28.0 39.0 80-81 33.118375 35.0 34.0 36.0 28.0 38.0 82-83 32.831125 35.0 34.0 36.0 27.5 37.0 84-85 32.569 35.0 33.0 36.0 27.0 37.0 86-87 32.3765 35.0 33.0 35.0 27.5 36.5 88-89 32.087625 35.0 33.0 35.0 26.5 36.0 90-91 31.929875 35.0 33.0 35.0 26.0 36.0 92-93 31.799999999999997 35.0 33.0 35.0 26.5 35.5 94-95 31.552875 35.0 33.0 35.0 25.0 35.0 96-97 31.362625 35.0 33.0 35.0 25.0 35.0 98-99 31.119625 35.0 33.0 35.0 24.0 35.0 100-101 30.0225 34.5 30.5 35.0 19.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 7.0 4 4.0 5 6.0 6 2.0 7 3.0 8 8.0 9 4.0 10 6.0 11 8.0 12 12.0 13 9.0 14 6.0 15 5.0 16 10.0 17 4.0 18 6.0 19 8.0 20 12.0 21 14.0 22 18.0 23 12.0 24 22.0 25 14.0 26 20.0 27 20.0 28 32.0 29 40.0 30 45.0 31 68.0 32 84.0 33 108.0 34 154.0 35 222.0 36 386.0 37 906.0 38 1463.0 39 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.795687885010267 10.934291581108829 8.572895277207392 54.69712525667351 2 18.275 16.45 44.275 21.0 3 18.95 21.125 23.799999999999997 36.125 4 22.275 30.4 21.775 25.55 5 23.175 33.825 24.5 18.5 6 17.299999999999997 35.85 25.974999999999998 20.875 7 13.3 24.95 43.175000000000004 18.575 8 17.275 23.825 33.125 25.775 9 17.05 22.6 34.725 25.624999999999996 10-11 20.075000000000003 34.050000000000004 24.5125 21.3625 12-13 19.400000000000002 26.1625 28.9125 25.525 14-15 18.925 26.5375 28.962500000000002 25.575 16-17 19.8625 28.025 28.287499999999998 23.825 18-19 19.900000000000002 28.3625 26.8625 24.875 20-21 19.85 29.4125 27.487499999999997 23.25 22-23 20.0125 28.525 28.349999999999998 23.1125 24-25 19.8 28.725 27.212500000000002 24.2625 26-27 20.0125 28.849999999999998 27.787499999999998 23.35 28-29 19.725 28.075 27.8375 24.3625 30-31 19.85 28.012500000000003 27.400000000000002 24.7375 32-33 19.9625 28.299999999999997 28.175 23.5625 34-35 20.5375 27.8625 28.299999999999997 23.3 36-37 19.8 28.975 27.037499999999998 24.1875 38-39 19.425 28.537499999999998 28.65 23.3875 40-41 20.05 28.625 28.0625 23.2625 42-43 20.8125 27.9375 27.025 24.224999999999998 44-45 20.349999999999998 28.499999999999996 27.6 23.549999999999997 46-47 20.7125 27.8125 27.987499999999997 23.4875 48-49 19.400000000000002 29.099999999999998 27.1625 24.337500000000002 50-51 20.1625 28.199999999999996 27.55 24.087500000000002 52-53 20.6875 28.487499999999997 27.3625 23.4625 54-55 20.0625 28.812500000000004 27.437499999999996 23.6875 56-57 20.3625 28.299999999999997 26.775 24.5625 58-59 20.549999999999997 28.787499999999998 27.3 23.3625 60-61 20.45 29.4125 26.200000000000003 23.9375 62-63 20.8 27.6125 27.675 23.9125 64-65 20.275000000000002 28.525 27.9375 23.2625 66-67 19.4875 28.925 27.150000000000002 24.4375 68-69 19.8 28.549999999999997 27.925 23.724999999999998 70-71 19.45 28.812500000000004 28.025 23.7125 72-73 19.575 28.849999999999998 27.400000000000002 24.175 74-75 20.200000000000003 28.325 27.725 23.75 76-77 19.8125 28.3875 27.150000000000002 24.65 78-79 20.349999999999998 28.475 26.950000000000003 24.224999999999998 80-81 20.7 28.725 27.8875 22.6875 82-83 20.6625 29.475 26.900000000000002 22.9625 84-85 21.0625 28.287499999999998 26.9125 23.7375 86-87 20.375 27.5625 27.700000000000003 24.3625 88-89 20.424999999999997 28.5625 27.9125 23.1 90-91 20.3125 28.8875 26.687499999999996 24.1125 92-93 20.525 28.375 27.537499999999998 23.5625 94-95 20.549999999999997 28.962500000000002 27.3625 23.125 96-97 20.925 28.025 26.787499999999998 24.2625 98-99 20.690086260782596 28.978622327790976 26.59082385298162 23.740467558444806 100-101 21.212500000000002 29.099999999999998 26.875 22.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 2.5 25 5.5 26 7.0 27 8.0 28 10.5 29 12.0 30 19.0 31 30.0 32 35.0 33 44.0 34 55.0 35 64.0 36 84.5 37 103.0 38 121.0 39 157.5 40 196.0 41 231.5 42 239.0 43 246.0 44 271.0 45 276.0 46 272.0 47 257.0 48 232.5 49 199.0 50 158.5 51 135.5 52 115.0 53 86.5 54 72.5 55 53.5 56 41.5 57 39.5 58 30.5 59 21.0 60 15.0 61 11.5 62 7.5 63 7.5 64 7.0 65 3.5 66 2.0 67 2.0 68 1.0 69 1.0 70 1.5 71 1.0 72 1.5 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.44999999999999996 0.0 0.0 0.0 0.0 82-83 0.6499999999999999 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAACT 15 0.009962372 47.493755 74-75 >>END_MODULE ERR1864445 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864445_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.256 34.0 31.0 34.0 30.0 34.0 2 32.346 34.0 31.0 34.0 30.0 34.0 3 32.26925 34.0 31.0 34.0 30.0 34.0 4 35.6745 37.0 37.0 37.0 35.0 37.0 5 35.6895 37.0 37.0 37.0 35.0 37.0 6 35.72875 37.0 37.0 37.0 35.0 37.0 7 35.71325 37.0 37.0 37.0 35.0 37.0 8 35.70125 37.0 37.0 37.0 35.0 37.0 9 37.29875 39.0 38.0 39.0 34.0 39.0 10-11 37.326625 39.0 38.0 39.0 34.0 39.0 12-13 37.34125 39.0 38.0 39.0 34.5 39.0 14-15 38.729375000000005 41.0 39.0 41.0 34.0 41.0 16-17 38.66275 41.0 39.0 41.0 34.0 41.0 18-19 38.685249999999996 41.0 39.0 41.0 34.0 41.0 20-21 38.631125 41.0 39.0 41.0 34.0 41.0 22-23 38.545375 41.0 39.0 41.0 34.0 41.0 24-25 38.28675 40.0 38.0 41.0 34.0 41.0 26-27 38.16225 40.0 38.0 41.0 33.0 41.0 28-29 38.067499999999995 40.0 38.0 41.0 33.0 41.0 30-31 38.07525 40.0 38.0 41.0 34.0 41.0 32-33 38.006 40.0 38.0 41.0 33.0 41.0 34-35 37.85675 40.0 38.0 41.0 33.0 41.0 36-37 37.753874999999994 40.0 38.0 41.0 33.0 41.0 38-39 37.611875 40.0 38.0 41.0 32.0 41.0 40-41 37.64375 40.0 38.0 41.0 32.0 41.0 42-43 37.448125000000005 40.0 38.0 41.0 31.0 41.0 44-45 37.511624999999995 40.0 38.0 41.0 31.5 41.0 46-47 37.349125 40.0 38.0 41.0 31.0 41.0 48-49 37.319874999999996 40.0 37.5 41.0 31.5 41.0 50-51 36.497 39.0 36.0 40.5 30.5 40.5 52-53 36.444625 39.0 36.0 40.0 30.5 41.0 54-55 36.7115 40.0 36.5 41.0 30.5 41.0 56-57 36.565875 39.5 36.0 41.0 29.5 41.0 58-59 36.324 39.0 36.0 41.0 29.5 41.0 60-61 36.157875000000004 39.0 35.0 41.0 29.5 41.0 62-63 35.88475 39.0 35.0 40.5 28.5 41.0 64-65 35.509625 38.0 35.0 40.0 28.5 41.0 66-67 35.576875 38.0 35.0 40.0 29.0 41.0 68-69 35.22875 37.0 35.0 39.5 29.0 41.0 70-71 34.642250000000004 37.0 34.5 39.0 28.0 41.0 72-73 34.3735 36.0 34.0 39.0 28.0 40.5 74-75 33.35825 35.0 33.5 37.5 25.5 39.5 76-77 33.280625 35.0 34.0 37.0 26.0 39.0 78-79 32.669 35.0 33.0 37.0 26.0 39.0 80-81 32.618875 35.0 33.0 36.0 26.0 37.5 82-83 32.344625 35.0 33.5 36.0 26.0 37.0 84-85 32.167249999999996 35.0 33.0 35.5 26.0 37.0 86-87 31.956625 35.0 33.0 35.0 25.5 36.0 88-89 31.825249999999997 35.0 33.0 35.0 25.5 36.0 90-91 31.47475 35.0 32.5 35.0 24.5 36.0 92-93 31.401 35.0 33.0 35.0 24.5 35.5 94-95 31.231250000000003 35.0 33.0 35.0 24.0 35.0 96-97 30.945749999999997 35.0 32.0 35.0 22.0 35.0 98-99 30.485374999999998 35.0 32.0 35.0 18.5 35.0 100-101 29.433500000000002 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 4.0 5 6.0 6 6.0 7 7.0 8 11.0 9 9.0 10 12.0 11 9.0 12 5.0 13 6.0 14 15.0 15 9.0 16 11.0 17 5.0 18 11.0 19 13.0 20 15.0 21 17.0 22 12.0 23 17.0 24 16.0 25 17.0 26 20.0 27 38.0 28 42.0 29 52.0 30 43.0 31 84.0 32 88.0 33 100.0 34 172.0 35 259.0 36 425.0 37 893.0 38 1270.0 39 263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.6 16.625 12.775 43.0 2 21.5 24.8 39.825 13.875000000000002 3 19.5 27.525 29.95 23.025000000000002 4 24.05 34.475 21.375 20.1 5 25.624999999999996 35.425000000000004 22.75 16.2 6 19.825 37.35 23.825 19.0 7 19.125 18.2 41.825 20.849999999999998 8 20.75 22.85 30.425 25.974999999999998 9 20.825 24.5 31.775 22.900000000000002 10-11 23.724999999999998 31.6 23.8375 20.837500000000002 12-13 24.05 25.8125 26.937499999999996 23.200000000000003 14-15 22.475 29.025000000000002 27.925 20.575 16-17 23.6625 28.050000000000004 28.0625 20.225 18-19 24.0125 28.237499999999997 26.887499999999996 20.8625 20-21 23.3125 27.962500000000002 28.3375 20.3875 22-23 23.6875 27.6 28.812500000000004 19.900000000000002 24-25 23.9125 27.787499999999998 27.3125 20.9875 26-27 22.8875 28.712500000000002 28.037499999999998 20.3625 28-29 24.0625 27.200000000000003 28.4 20.3375 30-31 23.075000000000003 28.375 27.8625 20.6875 32-33 24.2625 27.212500000000002 27.575 20.95 34-35 23.0 28.4125 27.55 21.0375 36-37 24.1875 27.450000000000003 28.375 19.9875 38-39 22.787499999999998 28.075 28.462500000000002 20.674999999999997 40-41 23.0875 27.85 28.5875 20.474999999999998 42-43 23.674999999999997 27.3625 28.225 20.7375 44-45 23.175 27.775 28.3375 20.7125 46-47 23.7125 27.250000000000004 28.7375 20.3 48-49 22.7625 27.675 27.975 21.587500000000002 50-51 23.7125 27.625 28.050000000000004 20.6125 52-53 24.0375 27.5625 28.275 20.125 54-55 23.025000000000002 28.275 28.225 20.474999999999998 56-57 22.875 28.050000000000004 28.5875 20.4875 58-59 23.375 27.500000000000004 27.950000000000003 21.175 60-61 23.0 27.575 27.9375 21.4875 62-63 23.2625 27.6 28.6625 20.474999999999998 64-65 22.8125 28.512500000000003 27.925 20.75 66-67 23.7125 27.5625 28.0875 20.6375 68-69 23.393348337084273 27.35683920980245 28.119529882470616 21.13028257064266 70-71 23.7 27.775 28.125 20.4 72-73 23.6125 28.1125 27.0625 21.212500000000002 74-75 23.6625 27.400000000000002 28.7375 20.200000000000003 76-77 23.075000000000003 27.950000000000003 27.875 21.099999999999998 78-79 23.81547693461683 28.478559819977495 27.51593949243655 20.19002375296912 80-81 23.452931616452055 28.128516064508062 28.053506688336043 20.365045630703836 82-83 23.65295661957745 28.328541067633456 28.041005125640705 19.977497187148394 84-85 24.0 27.6625 28.15 20.1875 86-87 24.706176544136035 27.60690172543136 28.34458614653663 19.342335583895974 88-89 23.1375 27.487499999999997 28.287499999999998 21.087500000000002 90-91 23.068267066766694 27.431857964491122 28.632158039509875 20.86771692923231 92-93 24.9 27.750000000000004 27.450000000000003 19.900000000000002 94-95 24.0375 28.4375 27.675 19.85 96-97 24.071526822558457 28.435663373765163 27.42278354382894 20.07002625984744 98-99 24.70308788598575 26.778347293411674 28.416052006500813 20.102512814101765 100-101 24.9875 26.9625 27.537499999999998 20.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 2.0 25 2.5 26 3.0 27 4.0 28 6.0 29 7.5 30 14.5 31 27.0 32 30.0 33 31.5 34 45.5 35 68.5 36 81.0 37 101.5 38 142.0 39 169.5 40 206.0 41 245.0 42 247.0 43 266.0 44 280.5 45 284.5 46 272.0 47 225.0 48 208.5 49 208.0 50 179.5 51 140.5 52 105.0 53 78.0 54 69.0 55 50.5 56 36.5 57 34.5 58 27.0 59 20.5 60 18.5 61 13.5 62 10.0 63 8.5 64 5.5 65 4.0 66 3.5 67 2.5 68 2.5 69 1.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0125 80-81 0.0125 82-83 0.0125 84-85 0.0 86-87 0.025 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0375 98-99 0.0125 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8500000000000001 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833139 spots for ERR1864445.sra Written 833139 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra Read 833135 spots for ERR1864445.sra Written 833135 spots for ERR1864445.sra SRR ids: ['ERR1864445.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_um2m7xr7 ERR1864445.sra spots: 16662704 blocks: [[1, 833135], [833136, 1666270], [1666271, 2499405], [2499406, 3332540], [3332541, 4165675], [4165676, 4998810], [4998811, 5831945], [5831946, 6665080], [6665081, 7498215], [7498216, 8331350], [8331351, 9164485], [9164486, 9997620], [9997621, 10830755], [10830756, 11663890], [11663891, 12497025], [12497026, 13330160], [13330161, 14163295], [14163296, 14996430], [14996431, 15829565], [15829566, 16662704]] ERR1864445 file size 3997526 ERR1864445 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864445 ERR1864445_1.fastq ERR1864445_2.fastq Input file: ERR1864445_1.fastq Paired file: ERR1864445_2.fastq trimmed: ERR1864445-trimmed-pair1.fastq, ERR1864445-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:08:10 2025 >> started Thu Feb 13 11:08:32 2025 >> done (22.193s) 16662704 read pairs processed; of these: 181157 ( 1.09%) short read pairs filtered out after trimming by size control 209850 ( 1.26%) empty read pairs filtered out after trimming by size control 16271697 (97.65%) read pairs available; of these: 3865722 (23.76%) trimmed read pairs available after processing 12405975 (76.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 101 0.00% 19 208 0.00% 20 349 0.00% 21 486 0.00% 22 611 0.00% 23 716 0.00% 24 919 0.01% 25 1053 0.01% 26 1244 0.01% 27 1376 0.01% 28 1676 0.01% 29 1856 0.01% 30 2209 0.01% 31 2562 0.02% 32 2820 0.02% 33 3174 0.02% 34 3368 0.02% 35 3772 0.02% 36 3915 0.02% 37 4454 0.03% 38 4637 0.03% 39 5181 0.03% 40 5447 0.03% 41 5838 0.04% 42 6044 0.04% 43 6460 0.04% 44 6759 0.04% 45 7211 0.04% 46 7545 0.05% 47 8039 0.05% 48 8320 0.05% 49 8682 0.05% 50 9069 0.06% 51 9539 0.06% 52 9992 0.06% 53 10454 0.06% 54 10821 0.07% 55 11527 0.07% 56 11915 0.07% 57 12784 0.08% 58 13565 0.08% 59 16125 0.10% 60 18740 0.12% 61 19247 0.12% 62 20376 0.13% 63 21080 0.13% 64 21876 0.13% 65 22593 0.14% 66 23724 0.15% 67 24703 0.15% 68 25936 0.16% 69 27094 0.17% 70 28526 0.18% 71 29561 0.18% 72 31273 0.19% 73 34058 0.21% 74 34721 0.21% 75 36532 0.22% 76 35732 0.22% 77 37972 0.23% 78 39218 0.24% 79 40451 0.25% 80 42033 0.26% 81 44212 0.27% 82 46933 0.29% 83 50311 0.31% 84 53491 0.33% 85 58404 0.36% 86 61489 0.38% 87 66839 0.41% 88 67846 0.42% 89 71466 0.44% 90 79836 0.49% 91 87813 0.54% 92 96993 0.60% 93 109847 0.68% 94 123546 0.76% 95 144763 0.89% 96 173161 1.06% 97 214859 1.32% 98 288067 1.77% 99 407024 2.50% 100 770553 4.74% 101 12405975 76.24% 16271697 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=21 prefix-density=0.24 prefix-fanout=2.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=13.92 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.6 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=13 prefix-density=0.57 prefix-fanout=2.0 sequence=CTGCAAGTGCGGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=173.44 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.8 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT ERR1864445 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:09:03 Started mapping on | Feb 13 11:09:04 Finished on | Feb 13 11:09:54 Mapping speed, Million of reads per hour | 1171.56 Number of input reads | 16271697 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 15591817 Uniquely mapped reads % | 95.82% Average mapped length | 196.06 Number of splices: Total | 9118968 Number of splices: Annotated (sjdb) | 8956935 Number of splices: GT/AG | 8981115 Number of splices: GC/AG | 115406 Number of splices: AT/AC | 7919 Number of splices: Non-canonical | 14528 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424331 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 32841 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.34% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 272251 272251 272251 N_multimapping 424331 424331 424331 N_noFeature 416917 15429426 510112 N_ambiguous 134164 671 64581 UnstrandedReadsAssigned:15040736 PositiveStrandReadsAssigned:161720 NegativeStrandReadsAssigned:15017124 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864445 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864445-trimmed-pair1.fastq ERR1864445-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,271,697 reads, 15,211,095 reads pseudoaligned [quant] estimated average fragment length: 171.265 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 ERR1864445.ke.tsv 34699 ERR1864445.se.tsv 87100 total ==> ERR1864445.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1847.73 2114 77.1491 Potri.005G024800.1.v4.1 1035 864.735 2709 211.247 Potri.004G059700.1.v4.1 961 790.748 27 2.30246 Potri.007G009000.2.v4.1 1416 1245.73 0 0 Potri.003G141000.2.v4.1 2943 2772.73 892 21.6931 Potri.016G087400.1.v4.1 270 112.621 954 571.211 Potri.015G069301.1.v4.1 564 393.955 0 0 Potri.010G195200.1.v4.1 1773 1602.73 178 7.489 Potri.012G127500.1.v4.1 977 806.748 13105 1095.38 ==> ERR1864445.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 176 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 171 ERR1864445 completed mapping pipeline successfully