Starting /dee2/code/volunteer_pipeline.sh ERR1864446 current disk space = 3093374160896 free memory = 1450174460 ERR1864446 SRAfilesize 6be62a5d0511fc09f82bd4b6e9535fa4 ERR1864446.sra ERR1864446.sra file validated ERR1864446 is paired end ERR1864446 is conventional basespace ERR1864446 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6125 34.0 31.0 34.0 30.0 34.0 2 32.0835 34.0 31.0 34.0 30.0 34.0 3 32.366 34.0 31.0 34.0 30.0 34.0 4 35.712 37.0 35.0 37.0 35.0 37.0 5 35.47775 37.0 35.0 37.0 33.0 37.0 6 35.58025 37.0 35.0 37.0 33.0 37.0 7 35.6205 37.0 35.0 37.0 35.0 37.0 8 35.52425 37.0 35.0 37.0 33.0 37.0 9 37.244 39.0 38.0 39.0 34.0 39.0 10-11 37.22225 39.0 38.0 39.0 34.0 39.0 12-13 37.038875 39.0 37.5 39.0 33.5 39.0 14-15 38.5025 41.0 38.5 41.0 34.0 41.0 16-17 38.448625 41.0 39.0 41.0 34.0 41.0 18-19 38.432375 41.0 38.5 41.0 34.0 41.0 20-21 38.351124999999996 40.5 38.5 41.0 34.0 41.0 22-23 38.238625 40.5 38.0 41.0 33.5 41.0 24-25 38.1985 40.0 38.0 41.0 33.5 41.0 26-27 38.329 41.0 39.0 41.0 34.0 41.0 28-29 38.264375 41.0 38.0 41.0 34.0 41.0 30-31 38.189499999999995 40.0 38.0 41.0 33.5 41.0 32-33 38.080375000000004 40.0 38.0 41.0 33.5 41.0 34-35 37.866625 40.0 38.0 41.0 33.0 41.0 36-37 37.953 40.0 38.0 41.0 33.0 41.0 38-39 37.917 40.0 38.0 41.0 33.0 41.0 40-41 37.761875 40.0 38.0 41.0 32.5 41.0 42-43 37.698375 40.0 38.0 41.0 33.0 41.0 44-45 37.644625000000005 40.0 38.0 41.0 33.0 41.0 46-47 37.415125 40.0 38.0 41.0 32.0 41.0 48-49 37.488375000000005 40.0 38.0 41.0 32.0 41.0 50-51 37.23975 40.0 37.0 41.0 31.5 41.0 52-53 37.079750000000004 40.0 37.0 41.0 31.0 41.0 54-55 36.887625 40.0 37.0 41.0 31.0 41.0 56-57 36.617125 40.0 36.0 41.0 30.0 41.0 58-59 36.39275 39.0 36.0 41.0 29.5 41.0 60-61 36.28075 39.0 35.5 41.0 29.5 41.0 62-63 36.283500000000004 39.0 35.5 41.0 30.0 41.0 64-65 36.112375 39.0 35.0 40.5 30.5 41.0 66-67 35.7035 38.0 35.0 40.0 29.0 41.0 68-69 35.372625 37.5 35.0 40.0 29.5 41.0 70-71 34.674 36.5 34.5 39.0 28.5 41.0 72-73 34.3 36.0 34.0 39.0 28.0 40.0 74-75 33.7035 35.5 33.5 38.0 27.0 39.5 76-77 32.03575 34.5 31.5 36.0 25.5 39.0 78-79 32.9285 35.0 33.0 37.0 26.5 39.0 80-81 32.879374999999996 35.0 33.5 36.5 27.0 38.5 82-83 32.575375 35.0 33.0 36.0 26.5 37.0 84-85 32.317625 35.0 33.0 36.0 26.0 37.0 86-87 32.052625 35.0 33.0 35.0 26.0 36.5 88-89 31.725749999999998 35.0 33.0 35.0 25.5 36.0 90-91 31.599 35.0 33.0 35.0 25.5 36.0 92-93 31.413249999999998 35.0 32.5 35.0 25.0 35.5 94-95 31.197875000000003 35.0 32.0 35.0 24.0 35.0 96-97 31.012999999999998 35.0 32.0 35.0 23.5 35.0 98-99 30.818375000000003 35.0 32.0 35.0 22.5 35.0 100-101 29.692375 33.5 30.5 34.5 10.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 17.0 4 11.0 5 9.0 6 9.0 7 4.0 8 6.0 9 2.0 10 7.0 11 4.0 12 4.0 13 12.0 14 7.0 15 8.0 16 12.0 17 15.0 18 13.0 19 7.0 20 8.0 21 10.0 22 10.0 23 12.0 24 17.0 25 16.0 26 21.0 27 27.0 28 31.0 29 45.0 30 49.0 31 79.0 32 89.0 33 106.0 34 160.0 35 238.0 36 426.0 37 888.0 38 1340.0 39 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.925831202046037 10.051150895140665 9.539641943734017 51.48337595907928 2 19.525000000000002 16.725 39.65 24.099999999999998 3 19.975 21.175 23.925 34.925 4 22.900000000000002 29.475 20.474999999999998 27.150000000000002 5 21.6 34.55 25.424999999999997 18.425 6 16.900000000000002 35.575 26.575 20.95 7 14.124999999999998 23.775 41.425 20.674999999999997 8 16.875 23.25 34.699999999999996 25.174999999999997 9 17.075000000000003 22.725 34.675 25.525 10-11 20.9125 32.6625 24.099999999999998 22.325 12-13 20.4875 26.087500000000002 28.262500000000003 25.162499999999998 14-15 19.8125 26.9625 28.1875 25.0375 16-17 21.087500000000002 27.875 27.025 24.0125 18-19 19.9625 28.499999999999996 27.3625 24.175 20-21 19.775000000000002 28.050000000000004 28.825 23.35 22-23 19.537499999999998 28.462500000000002 28.0625 23.9375 24-25 19.3375 28.000000000000004 26.937499999999996 25.724999999999998 26-27 19.287499999999998 28.1625 28.4 24.15 28-29 19.7625 28.012500000000003 28.000000000000004 24.224999999999998 30-31 20.0125 27.950000000000003 27.437499999999996 24.6 32-33 20.95 28.1625 27.450000000000003 23.4375 34-35 20.25 27.8875 28.4 23.4625 36-37 19.275000000000002 29.037499999999998 27.425 24.2625 38-39 20.075000000000003 27.575 27.900000000000002 24.45 40-41 20.349999999999998 28.537499999999998 26.8 24.3125 42-43 20.525 28.1875 27.1375 24.15 44-45 20.5875 28.999999999999996 27.025 23.3875 46-47 20.825 28.1375 27.6 23.4375 48-49 19.787499999999998 28.9375 27.224999999999998 24.05 50-51 20.1875 27.950000000000003 27.5875 24.275 52-53 20.5875 28.4375 26.6 24.375 54-55 20.6375 28.5875 26.5625 24.212500000000002 56-57 19.9125 27.975 27.6 24.5125 58-59 20.1875 28.1625 27.3875 24.2625 60-61 19.45 27.875 27.575 25.1 62-63 20.4 28.050000000000004 27.6 23.95 64-65 20.575 27.8875 28.037499999999998 23.5 66-67 20.474999999999998 28.3625 27.0625 24.099999999999998 68-69 20.5875 27.6 27.500000000000004 24.3125 70-71 21.0625 27.9125 26.9625 24.0625 72-73 20.8625 27.3125 27.2625 24.5625 74-75 20.275000000000002 27.35 28.199999999999996 24.175 76-77 21.2625 28.1 27.3375 23.3 78-79 20.575 28.000000000000004 27.737499999999997 23.6875 80-81 21.075 27.8375 27.0 24.087500000000002 82-83 20.45 28.1625 27.1625 24.224999999999998 84-85 21.05 27.8875 26.637499999999996 24.425 86-87 22.0 27.5125 27.3625 23.125 88-89 21.275 28.825 26.700000000000003 23.200000000000003 90-91 20.724999999999998 27.500000000000004 26.437500000000004 25.337500000000002 92-93 21.575 27.787499999999998 26.5 24.1375 94-95 20.8625 29.1625 26.6625 23.3125 96-97 21.337500000000002 28.5625 26.375 23.724999999999998 98-99 21.4 28.6125 26.625 23.3625 100-101 21.462500000000002 28.975 26.325 23.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 2.0 27 3.0 28 4.5 29 10.0 30 18.5 31 18.5 32 25.5 33 37.5 34 44.5 35 55.0 36 77.0 37 103.5 38 121.0 39 152.0 40 178.5 41 208.0 42 241.0 43 242.0 44 248.5 45 270.0 46 281.0 47 278.5 48 241.5 49 202.5 50 185.5 51 162.5 52 130.5 53 103.0 54 82.0 55 57.5 56 42.5 57 39.5 58 30.0 59 22.5 60 22.0 61 15.5 62 8.0 63 6.5 64 6.5 65 5.0 66 3.0 67 1.0 68 1.0 69 2.5 70 2.0 71 0.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.2875 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.6375 0.0 0.0 0.0 0.0 76-77 0.7250000000000001 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.2000000000000002 0.0 0.0 0.0 0.0 82-83 1.5750000000000002 0.0 0.0 0.0 0.0 84-85 1.8875 0.0 0.0 0.0 0.0 86-87 2.375 0.0 0.0 0.0 0.0 88-89 2.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864446 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.101 33.0 31.0 34.0 30.0 34.0 2 32.16375 34.0 31.0 34.0 30.0 34.0 3 32.094 34.0 31.0 34.0 30.0 34.0 4 35.473 37.0 35.0 37.0 33.0 37.0 5 35.526 37.0 35.0 37.0 33.0 37.0 6 35.5415 37.0 36.0 37.0 33.0 37.0 7 35.57675 37.0 36.0 37.0 33.0 37.0 8 35.4845 37.0 35.0 37.0 33.0 37.0 9 36.98575 39.0 37.0 39.0 33.0 39.0 10-11 37.15275 39.0 38.0 39.0 33.5 39.0 12-13 37.072625 39.0 37.0 39.0 33.0 39.0 14-15 38.527125 41.0 38.0 41.0 34.0 41.0 16-17 38.385625 41.0 38.0 41.0 34.0 41.0 18-19 38.41375 41.0 38.5 41.0 34.0 41.0 20-21 38.401375 41.0 38.0 41.0 34.0 41.0 22-23 38.446375 40.5 38.5 41.0 34.0 41.0 24-25 38.080124999999995 40.0 38.0 41.0 33.5 41.0 26-27 38.034375 40.0 38.0 41.0 33.0 41.0 28-29 37.9015 40.0 38.0 41.0 33.0 41.0 30-31 37.966125000000005 40.0 38.0 41.0 33.0 41.0 32-33 37.810249999999996 40.0 38.0 41.0 32.0 41.0 34-35 37.710875 40.0 38.0 41.0 32.5 41.0 36-37 37.639875 40.0 38.0 41.0 32.0 41.0 38-39 37.370625000000004 40.0 38.0 41.0 31.5 41.0 40-41 37.435500000000005 40.0 38.0 41.0 31.5 41.0 42-43 37.173 40.0 37.5 41.0 30.5 41.0 44-45 37.18325 40.0 37.0 41.0 31.0 41.0 46-47 36.93125 40.0 37.0 41.0 30.0 41.0 48-49 37.04375 40.0 37.0 41.0 31.0 41.0 50-51 36.254125 39.0 36.0 40.5 29.5 40.5 52-53 36.25675 39.0 36.0 40.0 30.0 41.0 54-55 36.468 39.0 36.0 41.0 29.5 41.0 56-57 36.291 39.0 35.5 41.0 28.5 41.0 58-59 36.099125 39.0 35.5 41.0 28.5 41.0 60-61 35.844125 39.0 35.0 40.5 28.0 41.0 62-63 35.679249999999996 38.0 35.0 40.0 28.0 41.0 64-65 35.23725 38.0 34.5 40.0 28.0 41.0 66-67 35.304 38.0 35.0 40.0 28.0 41.0 68-69 35.031875 37.0 35.0 39.5 28.0 41.0 70-71 34.407624999999996 36.5 34.0 39.0 27.0 41.0 72-73 34.079125000000005 36.0 34.0 39.0 27.0 40.5 74-75 33.020125 35.0 33.0 37.0 24.5 39.0 76-77 33.146875 35.0 33.0 37.0 26.0 39.0 78-79 32.432125 35.0 33.0 36.5 25.0 39.0 80-81 32.3705 35.0 33.0 36.0 25.5 37.0 82-83 32.106625 35.0 33.0 36.0 25.5 37.0 84-85 31.86775 35.0 33.0 35.0 25.0 36.5 86-87 31.740375 35.0 33.0 35.0 25.0 36.0 88-89 31.588124999999998 35.0 33.0 35.0 25.0 36.0 90-91 31.24675 35.0 32.0 35.0 23.5 36.0 92-93 31.1175 35.0 32.0 35.0 23.5 35.0 94-95 30.902 35.0 32.0 35.0 21.0 35.0 96-97 30.533749999999998 35.0 32.0 35.0 19.0 35.0 98-99 30.143625 34.5 31.0 35.0 9.0 35.0 100-101 29.073 33.5 30.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 4.0 4 4.0 5 6.0 6 4.0 7 6.0 8 9.0 9 8.0 10 12.0 11 12.0 12 8.0 13 10.0 14 13.0 15 11.0 16 12.0 17 13.0 18 10.0 19 16.0 20 14.0 21 10.0 22 16.0 23 19.0 24 19.0 25 24.0 26 22.0 27 33.0 28 46.0 29 48.0 30 70.0 31 68.0 32 94.0 33 139.0 34 170.0 35 257.0 36 448.0 37 870.0 38 1235.0 39 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 15.45 14.224999999999998 40.575 2 23.549999999999997 23.150000000000002 38.525 14.774999999999999 3 19.85 28.225 29.7 22.225 4 23.7 33.900000000000006 21.775 20.625 5 26.325 35.0 22.5 16.175 6 20.575 36.5 24.575 18.35 7 19.25 18.95 40.875 20.925 8 20.95 23.075000000000003 30.45 25.525 9 21.975 22.7 31.574999999999996 23.75 10-11 25.55 30.8 23.1375 20.5125 12-13 23.4875 25.0375 27.375 24.099999999999998 14-15 23.1125 27.925 27.650000000000002 21.3125 16-17 24.375 27.700000000000003 26.424999999999997 21.5 18-19 23.7125 28.225 27.775 20.2875 20-21 24.6625 28.037499999999998 27.55 19.75 22-23 23.3125 26.775 28.375 21.5375 24-25 23.0125 27.85 28.3875 20.75 26-27 23.1875 28.1625 27.375 21.275 28-29 22.725 27.875 27.787499999999998 21.6125 30-31 24.0625 27.3 27.462500000000002 21.175 32-33 23.5125 28.075 27.762500000000003 20.65 34-35 23.9375 27.6125 27.575 20.875 36-37 23.5 26.900000000000002 28.349999999999998 21.25 38-39 24.075 27.0125 27.8875 21.025 40-41 24.474999999999998 27.437499999999996 26.825 21.2625 42-43 23.400000000000002 27.737499999999997 28.1875 20.674999999999997 44-45 23.8875 27.187499999999996 28.525 20.4 46-47 24.3125 26.7125 27.8625 21.1125 48-49 24.7875 27.275 27.9375 20.0 50-51 24.625 28.1 26.7125 20.5625 52-53 24.95 27.5125 27.025 20.5125 54-55 23.9375 27.787499999999998 27.6125 20.6625 56-57 23.6875 27.6625 27.325 21.325 58-59 23.4125 27.712500000000002 27.537499999999998 21.337500000000002 60-61 24.2625 27.737499999999997 27.275 20.724999999999998 62-63 24.462500000000002 28.262500000000003 27.0 20.275000000000002 64-65 24.5125 26.8 27.700000000000003 20.9875 66-67 24.2375 27.212500000000002 27.537499999999998 21.0125 68-69 24.190523815476936 27.91598949868734 27.440930116264532 20.452556569571197 70-71 24.212500000000002 28.375 26.0625 21.349999999999998 72-73 23.5375 28.037499999999998 28.050000000000004 20.375 74-75 23.6375 28.1375 27.5625 20.6625 76-77 23.8125 27.1375 28.075 20.974999999999998 78-79 23.875 27.250000000000004 27.675 21.2 80-81 24.7 27.075 27.487499999999997 20.7375 82-83 25.35 26.974999999999998 27.025 20.65 84-85 24.4 28.725 27.212500000000002 19.662499999999998 86-87 24.625 28.050000000000004 27.450000000000003 19.875 88-89 23.8125 27.9125 27.3625 20.9125 90-91 25.087500000000002 27.325 27.6375 19.950000000000003 92-93 25.137500000000003 27.8875 26.5375 20.4375 94-95 25.35 27.8125 26.9125 19.925 96-97 25.54069258657332 28.19102387798475 26.540817602200274 19.727465933241657 98-99 25.4625 28.875 26.2875 19.375 100-101 25.8125 27.0 26.787499999999998 20.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 2.5 29 5.5 30 10.0 31 13.0 32 15.5 33 24.5 34 33.0 35 45.5 36 64.5 37 83.0 38 113.5 39 152.0 40 187.5 41 220.5 42 255.5 43 268.5 44 276.5 45 291.5 46 287.5 47 270.5 48 248.0 49 225.5 50 183.0 51 152.5 52 138.5 53 100.5 54 66.0 55 51.5 56 39.0 57 33.0 58 32.0 59 27.0 60 21.0 61 13.0 62 9.0 63 7.5 64 7.0 65 6.0 66 3.5 67 1.5 68 1.0 69 1.5 70 1.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.2875 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.55 0.0 0.0 0.0 0.0 74-75 0.6375 0.0 0.0 0.0 0.0 76-77 0.7250000000000001 0.0 0.0 0.0 0.0 78-79 0.9125000000000001 0.0 0.0 0.0 0.0 80-81 1.1625 0.0 0.0 0.0 0.0 82-83 1.55 0.0 0.0 0.0 0.0 84-85 1.9125 0.0 0.0 0.0 0.0 86-87 2.4 0.0 0.0 0.0 0.0 88-89 2.9124999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887370 spots for ERR1864446.sra Written 887370 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra Read 887360 spots for ERR1864446.sra Written 887360 spots for ERR1864446.sra SRR ids: ['ERR1864446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_isr015bp ERR1864446.sra spots: 17747210 blocks: [[1, 887360], [887361, 1774720], [1774721, 2662080], [2662081, 3549440], [3549441, 4436800], [4436801, 5324160], [5324161, 6211520], [6211521, 7098880], [7098881, 7986240], [7986241, 8873600], [8873601, 9760960], [9760961, 10648320], [10648321, 11535680], [11535681, 12423040], [12423041, 13310400], [13310401, 14197760], [14197761, 15085120], [15085121, 15972480], [15972481, 16859840], [16859841, 17747210]] ERR1864446 file size 4259120 ERR1864446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864446 ERR1864446_1.fastq ERR1864446_2.fastq Input file: ERR1864446_1.fastq Paired file: ERR1864446_2.fastq trimmed: ERR1864446-trimmed-pair1.fastq, ERR1864446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 11:33:54 2025 >> started Thu Feb 13 11:34:18 2025 >> done (24.040s) 17747210 read pairs processed; of these: 204276 ( 1.15%) short read pairs filtered out after trimming by size control 243946 ( 1.37%) empty read pairs filtered out after trimming by size control 17298988 (97.47%) read pairs available; of these: 4491165 (25.96%) trimmed read pairs available after processing 12807823 (74.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 106 0.00% 19 239 0.00% 20 350 0.00% 21 491 0.00% 22 670 0.00% 23 825 0.00% 24 926 0.01% 25 1157 0.01% 26 1360 0.01% 27 1538 0.01% 28 1738 0.01% 29 1976 0.01% 30 2444 0.01% 31 2705 0.02% 32 3092 0.02% 33 3457 0.02% 34 3796 0.02% 35 4146 0.02% 36 4517 0.03% 37 4796 0.03% 38 5271 0.03% 39 5484 0.03% 40 5987 0.03% 41 6364 0.04% 42 6810 0.04% 43 7100 0.04% 44 7650 0.04% 45 7890 0.05% 46 8459 0.05% 47 8767 0.05% 48 9096 0.05% 49 9801 0.06% 50 9976 0.06% 51 10628 0.06% 52 11350 0.07% 53 11685 0.07% 54 12646 0.07% 55 13205 0.08% 56 13839 0.08% 57 14766 0.09% 58 15603 0.09% 59 18578 0.11% 60 21549 0.12% 61 22110 0.13% 62 22917 0.13% 63 24201 0.14% 64 25083 0.14% 65 26321 0.15% 66 27337 0.16% 67 28573 0.17% 68 29928 0.17% 69 31672 0.18% 70 33322 0.19% 71 35273 0.20% 72 37520 0.22% 73 40574 0.23% 74 41913 0.24% 75 43830 0.25% 76 43923 0.25% 77 46298 0.27% 78 48361 0.28% 79 50439 0.29% 80 52811 0.31% 81 56025 0.32% 82 59837 0.35% 83 64089 0.37% 84 69134 0.40% 85 75163 0.43% 86 80055 0.46% 87 86331 0.50% 88 88085 0.51% 89 92813 0.54% 90 102653 0.59% 91 111925 0.65% 92 123288 0.71% 93 137411 0.79% 94 154656 0.89% 95 176289 1.02% 96 207201 1.20% 97 251463 1.45% 98 324736 1.88% 99 443117 2.56% 100 791655 4.58% 101 12807823 74.04% 17298988 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=25 prefix-density=0.31 prefix-fanout=2.3 sequence=CCACATTTGCAGCCACT criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=16.20 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=3.5 sequence=CCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=17 prefix-density=0.74 prefix-fanout=1.9 sequence=CTGCAAGTGCGGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=77.24 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.2 sequence=GAAGAAAGAAATACACAATGGCAGGAATCATGCACAAGATTGAGGAGACTCTGAACATTGGAGGCAAGAAAGATGAGCGCAAGGGTGAGACACAAGGTGGGTACAACCAACAAGAGCACAGGGGCGGCGCACAAGGTG ERR1864446 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 11:34:50 Started mapping on | Feb 13 11:34:50 Finished on | Feb 13 11:35:46 Mapping speed, Million of reads per hour | 1112.08 Number of input reads | 17298988 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 16538249 Uniquely mapped reads % | 95.60% Average mapped length | 195.40 Number of splices: Total | 9738851 Number of splices: Annotated (sjdb) | 9569800 Number of splices: GT/AG | 9592890 Number of splices: GC/AG | 122862 Number of splices: AT/AC | 9182 Number of splices: Non-canonical | 13917 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 477730 % of reads mapped to multiple loci | 2.76% Number of reads mapped to too many loci | 41762 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.37% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298071 298071 298071 N_multimapping 477730 477730 477730 N_noFeature 389410 16362164 496561 N_ambiguous 134223 698 64863 UnstrandedReadsAssigned:16014616 PositiveStrandReadsAssigned:175387 NegativeStrandReadsAssigned:15976825 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864446-trimmed-pair1.fastq ERR1864446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,298,988 reads, 16,216,890 reads pseudoaligned [quant] estimated average fragment length: 151.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 ERR1864446.ke.tsv 34699 ERR1864446.se.tsv 87100 total ==> ERR1864446.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1867.62 2970 100.897 Potri.005G024800.1.v4.1 1035 884.62 2135 153.128 Potri.004G059700.1.v4.1 961 810.626 21 1.64366 Potri.007G009000.2.v4.1 1416 1265.62 0 0 Potri.003G141000.2.v4.1 2943 2792.62 932.75 21.1917 Potri.016G087400.1.v4.1 270 124.499 957 487.705 Potri.015G069301.1.v4.1 564 413.654 0 0 Potri.010G195200.1.v4.1 1773 1622.62 139 5.43513 Potri.012G127500.1.v4.1 977 826.626 13171 1010.93 ==> ERR1864446.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 123 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 240 ERR1864446 completed mapping pipeline successfully