Starting /dee2/code/volunteer_pipeline.sh ERR1864447 current disk space = 3092482686976 free memory = 1577487484 ERR1864447 SRAfilesize cf7b8c357b6c2b81f6780298af8b8006 ERR1864447.sra ERR1864447.sra file validated ERR1864447 is paired end ERR1864447 is conventional basespace ERR1864447 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5455 34.0 31.0 34.0 30.0 34.0 2 32.036 34.0 31.0 34.0 30.0 34.0 3 32.38825 34.0 31.0 34.0 30.0 34.0 4 35.80775 37.0 35.0 37.0 35.0 37.0 5 35.54025 37.0 35.0 37.0 33.0 37.0 6 35.599 37.0 35.0 37.0 35.0 37.0 7 35.60625 37.0 35.0 37.0 35.0 37.0 8 35.5665 37.0 35.0 37.0 33.0 37.0 9 37.34475 39.0 38.0 39.0 35.0 39.0 10-11 37.252624999999995 39.0 38.0 39.0 34.0 39.0 12-13 37.089 39.0 37.5 39.0 33.5 39.0 14-15 38.54375 41.0 39.0 41.0 34.0 41.0 16-17 38.526250000000005 41.0 38.5 41.0 34.0 41.0 18-19 38.56675 41.0 39.0 41.0 34.0 41.0 20-21 38.407375 41.0 39.0 41.0 34.0 41.0 22-23 38.34525 40.0 38.0 41.0 34.0 41.0 24-25 38.168375 40.0 38.0 41.0 33.0 41.0 26-27 38.264625 41.0 38.0 41.0 33.5 41.0 28-29 38.226 40.0 38.0 41.0 33.5 41.0 30-31 38.19425 40.0 38.0 41.0 34.0 41.0 32-33 38.073 40.0 38.0 41.0 33.0 41.0 34-35 37.986875 40.0 38.0 41.0 33.0 41.0 36-37 37.945375 40.0 38.0 41.0 33.0 41.0 38-39 37.828625 40.0 38.0 41.0 33.0 41.0 40-41 37.69925 40.0 38.0 41.0 32.5 41.0 42-43 37.661874999999995 40.0 38.0 41.0 32.5 41.0 44-45 37.598124999999996 40.0 38.0 41.0 32.5 41.0 46-47 37.4225 40.0 38.0 41.0 32.0 41.0 48-49 37.389875 40.0 37.5 41.0 32.0 41.0 50-51 37.132999999999996 40.0 37.0 41.0 31.0 41.0 52-53 37.06337499999999 40.0 37.0 41.0 31.0 41.0 54-55 36.825625 40.0 36.5 41.0 30.5 41.0 56-57 36.655249999999995 39.5 36.0 41.0 30.5 41.0 58-59 36.367000000000004 39.0 35.5 41.0 30.5 41.0 60-61 36.154375 39.0 35.0 41.0 29.0 41.0 62-63 36.15975 39.0 35.0 41.0 30.0 41.0 64-65 35.96025 38.5 35.0 40.5 29.5 41.0 66-67 35.5865 38.0 35.0 40.0 29.0 41.0 68-69 35.3155 37.0 35.0 40.0 29.0 41.0 70-71 34.649125 36.5 34.0 39.0 28.5 41.0 72-73 34.236374999999995 36.0 34.0 39.0 28.0 40.0 74-75 33.58625 35.5 33.5 38.0 26.5 39.5 76-77 31.977875 34.5 31.0 36.0 25.0 39.0 78-79 32.863125 35.0 33.0 37.0 26.0 39.0 80-81 32.680625 35.0 33.0 36.0 26.0 38.0 82-83 32.451875 35.0 33.0 36.0 26.0 37.0 84-85 32.102999999999994 35.0 33.0 35.5 26.0 37.0 86-87 31.752499999999998 35.0 33.0 35.0 25.0 36.5 88-89 31.509124999999997 35.0 33.0 35.0 25.0 36.0 90-91 31.38225 35.0 33.0 35.0 24.5 36.0 92-93 31.101875 35.0 32.5 35.0 24.0 35.5 94-95 30.87525 35.0 32.0 35.0 21.5 35.0 96-97 30.557125 34.0 32.0 35.0 18.5 35.0 98-99 30.449875 34.0 32.0 35.0 18.0 35.0 100-101 29.30175 33.5 30.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 12.0 4 6.0 5 7.0 6 5.0 7 2.0 8 3.0 9 10.0 10 8.0 11 9.0 12 8.0 13 6.0 14 10.0 15 14.0 16 10.0 17 7.0 18 11.0 19 15.0 20 9.0 21 10.0 22 15.0 23 17.0 24 16.0 25 25.0 26 32.0 27 34.0 28 40.0 29 44.0 30 50.0 31 57.0 32 81.0 33 119.0 34 155.0 35 235.0 36 431.0 37 897.0 38 1351.0 39 216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.241414659149157 10.71245515120451 8.354689902614044 51.691440287032286 2 19.05 16.275000000000002 41.05 23.625 3 20.225 19.575 25.174999999999997 35.025 4 24.025 29.725 20.4 25.85 5 21.375 34.375 24.05 20.200000000000003 6 17.5 34.775 27.05 20.674999999999997 7 12.65 25.1 42.675000000000004 19.575 8 15.875 24.575 33.074999999999996 26.474999999999998 9 16.75 23.974999999999998 35.675000000000004 23.599999999999998 10-11 19.9125 33.1 24.75 22.237499999999997 12-13 19.5625 26.1125 28.9 25.424999999999997 14-15 19.25 27.725 28.9375 24.087500000000002 16-17 20.5875 28.7375 26.575 24.099999999999998 18-19 19.5 28.375 28.487499999999997 23.6375 20-21 19.4625 27.5875 28.237499999999997 24.712500000000002 22-23 18.9 29.612500000000004 28.15 23.3375 24-25 19.7375 29.037499999999998 27.462500000000002 23.7625 26-27 19.75 28.95 27.575 23.724999999999998 28-29 19.175 30.475 26.174999999999997 24.175 30-31 19.5 28.7 27.5625 24.2375 32-33 19.6125 27.750000000000004 28.3125 24.325 34-35 20.3875 28.1625 27.8625 23.5875 36-37 19.6375 28.349999999999998 27.6625 24.349999999999998 38-39 19.325 28.8875 28.537499999999998 23.25 40-41 19.925 28.475 27.525 24.075 42-43 19.9125 28.537499999999998 27.075 24.474999999999998 44-45 20.375 28.1375 28.125 23.3625 46-47 20.5 28.212500000000002 27.775 23.5125 48-49 20.962500000000002 28.175 27.6375 23.225 50-51 20.4625 27.400000000000002 28.475 23.6625 52-53 20.4 28.15 27.6125 23.8375 54-55 19.8625 28.1625 28.025 23.95 56-57 19.9875 29.262500000000003 27.6375 23.1125 58-59 19.825 28.599999999999998 28.025 23.549999999999997 60-61 20.0125 28.3375 27.650000000000002 24.0 62-63 19.975 28.1375 27.375 24.5125 64-65 19.9125 27.987499999999997 28.287499999999998 23.8125 66-67 19.9375 28.7 27.712500000000002 23.65 68-69 19.8625 28.475 27.725 23.9375 70-71 20.2375 28.749999999999996 27.425 23.5875 72-73 20.599999999999998 28.050000000000004 26.825 24.525 74-75 20.5 28.475 27.125 23.9 76-77 20.5375 29.062500000000004 27.075 23.325000000000003 78-79 20.549999999999997 28.425 26.8 24.224999999999998 80-81 20.9375 27.725 27.925 23.4125 82-83 20.525 28.487499999999997 26.75 24.2375 84-85 20.925 28.1375 26.687499999999996 24.25 86-87 19.925 28.3375 27.237499999999997 24.5 88-89 20.25 28.7 27.6375 23.4125 90-91 21.075 28.625 27.462500000000002 22.8375 92-93 20.5875 28.65 26.737499999999997 24.025 94-95 20.599999999999998 28.537499999999998 27.762500000000003 23.1 96-97 20.65 28.275 27.9375 23.1375 98-99 20.599999999999998 27.2625 28.025 24.1125 100-101 20.7 27.762500000000003 27.200000000000003 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 1.5 25 3.0 26 4.0 27 5.5 28 12.0 29 17.5 30 16.0 31 24.5 32 39.0 33 43.5 34 53.5 35 71.5 36 90.0 37 108.5 38 133.0 39 165.5 40 187.0 41 207.0 42 245.5 43 255.0 44 247.5 45 264.5 46 262.5 47 244.5 48 224.5 49 205.0 50 195.5 51 158.0 52 114.5 53 90.0 54 71.0 55 53.0 56 39.0 57 33.5 58 25.0 59 18.0 60 17.0 61 13.0 62 6.0 63 6.0 64 6.5 65 4.0 66 3.0 67 3.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.9625 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1864447 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1864447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10725 33.0 31.0 34.0 30.0 34.0 2 32.14675 34.0 31.0 34.0 30.0 34.0 3 32.0705 34.0 31.0 34.0 30.0 34.0 4 35.5645 37.0 35.0 37.0 33.0 37.0 5 35.556 37.0 35.0 37.0 33.0 37.0 6 35.551 37.0 36.0 37.0 33.0 37.0 7 35.616 37.0 36.0 37.0 33.0 37.0 8 35.51075 37.0 35.0 37.0 33.0 37.0 9 36.97075 39.0 37.0 39.0 33.0 39.0 10-11 37.197 39.0 37.5 39.0 33.5 39.0 12-13 37.098375000000004 39.0 37.5 39.0 33.0 39.0 14-15 38.49925 41.0 38.5 41.0 34.0 41.0 16-17 38.45975 41.0 38.0 41.0 33.5 41.0 18-19 38.52525 41.0 38.5 41.0 34.0 41.0 20-21 38.412875 40.5 38.0 41.0 34.0 41.0 22-23 38.388625000000005 40.0 38.5 41.0 34.0 41.0 24-25 38.024875 40.0 38.0 41.0 33.0 41.0 26-27 37.942875 40.0 38.0 41.0 32.5 41.0 28-29 37.882625 40.0 38.0 41.0 32.5 41.0 30-31 37.889875 40.0 38.0 41.0 33.0 41.0 32-33 37.72125 40.0 38.0 41.0 32.5 41.0 34-35 37.6815 40.0 38.0 41.0 32.0 41.0 36-37 37.544250000000005 40.0 38.0 41.0 31.5 41.0 38-39 37.393125 40.0 38.0 41.0 31.0 41.0 40-41 37.46625 40.0 38.0 41.0 31.5 41.0 42-43 37.179874999999996 40.0 37.0 41.0 30.5 41.0 44-45 37.2885 40.0 37.0 41.0 30.5 41.0 46-47 37.072125 40.0 37.0 41.0 30.5 41.0 48-49 37.144375 40.0 37.0 41.0 31.0 41.0 50-51 36.255125 39.0 36.0 40.5 29.0 40.5 52-53 36.320875 39.0 36.0 40.0 30.0 41.0 54-55 36.354875 39.0 36.0 41.0 29.0 41.0 56-57 36.124875 39.0 35.5 41.0 28.5 41.0 58-59 35.91475 39.0 35.0 41.0 28.0 41.0 60-61 35.75025 39.0 35.0 40.5 28.0 41.0 62-63 35.454375 38.0 35.0 40.0 28.0 41.0 64-65 35.122249999999994 37.5 34.5 40.0 28.0 41.0 66-67 35.122749999999996 37.5 35.0 40.0 28.0 41.0 68-69 34.7975 37.0 34.5 39.5 28.0 41.0 70-71 34.146125 36.0 34.0 39.0 26.5 41.0 72-73 33.84075 36.0 34.0 39.0 26.5 40.0 74-75 32.772375 35.0 32.5 37.0 23.5 39.0 76-77 32.945875 35.0 33.0 37.0 26.0 39.0 78-79 32.24975 35.0 32.5 36.5 24.0 38.5 80-81 32.122 35.0 33.0 36.0 25.0 37.0 82-83 31.839 35.0 32.5 36.0 24.5 37.0 84-85 31.700375 35.0 32.5 35.0 24.5 36.5 86-87 31.560125 35.0 33.0 35.0 24.5 36.0 88-89 31.368625 35.0 32.0 35.0 24.0 36.0 90-91 30.961374999999997 35.0 32.0 35.0 20.0 36.0 92-93 30.837 35.0 32.0 35.0 20.0 35.5 94-95 30.661625 35.0 32.0 35.0 19.5 35.0 96-97 30.281625 35.0 31.0 35.0 14.0 35.0 98-99 29.901625 34.0 31.0 35.0 2.0 35.0 100-101 28.801375 33.5 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 4.0 5 4.0 6 6.0 7 6.0 8 8.0 9 6.0 10 11.0 11 10.0 12 10.0 13 10.0 14 7.0 15 18.0 16 8.0 17 11.0 18 11.0 19 12.0 20 19.0 21 19.0 22 15.0 23 15.0 24 29.0 25 31.0 26 28.0 27 44.0 28 42.0 29 46.0 30 75.0 31 84.0 32 96.0 33 136.0 34 166.0 35 262.0 36 443.0 37 936.0 38 1154.0 39 196.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.425 16.35 13.925 40.300000000000004 2 21.8 25.0 37.55 15.65 3 19.7 28.525 29.625 22.15 4 24.3 33.35 21.325 21.025 5 25.25 35.9 22.05 16.8 6 18.625 38.675 24.224999999999998 18.475 7 20.200000000000003 18.675 39.0 22.125 8 21.349999999999998 22.400000000000002 31.1 25.15 9 21.25 22.900000000000002 33.175 22.675 10-11 24.4375 31.2125 22.787499999999998 21.5625 12-13 23.974999999999998 25.924999999999997 27.3125 22.787499999999998 14-15 23.45 27.8625 28.037499999999998 20.65 16-17 23.150000000000002 27.6875 27.287499999999998 21.875 18-19 23.2375 28.762500000000003 27.487499999999997 20.5125 20-21 23.549999999999997 27.987499999999997 27.450000000000003 21.0125 22-23 23.6875 28.537499999999998 27.05 20.724999999999998 24-25 23.075000000000003 28.6875 27.0 21.2375 26-27 23.1125 29.4375 27.525 19.925 28-29 23.849999999999998 28.287499999999998 26.7625 21.099999999999998 30-31 23.0625 28.512500000000003 28.1625 20.2625 32-33 22.8625 27.462500000000002 28.3875 21.2875 34-35 23.7625 27.187499999999996 27.900000000000002 21.15 36-37 23.9 27.3875 27.6375 21.075 38-39 23.175 28.475 27.537499999999998 20.8125 40-41 23.8625 27.8125 28.0625 20.2625 42-43 23.75 27.200000000000003 28.025 21.025 44-45 23.549999999999997 28.9875 26.950000000000003 20.5125 46-47 23.849999999999998 27.025 28.075 21.05 48-49 23.225 27.9125 27.9375 20.925 50-51 22.775000000000002 28.6375 28.7 19.8875 52-53 23.7 27.650000000000002 27.962500000000002 20.6875 54-55 23.849999999999998 28.3875 27.5625 20.200000000000003 56-57 22.7 28.525 27.700000000000003 21.075 58-59 23.6125 27.900000000000002 27.275 21.212500000000002 60-61 23.1375 28.1875 28.287499999999998 20.3875 62-63 23.5875 27.8875 28.025 20.5 64-65 24.2375 28.025 27.287499999999998 20.45 66-67 23.7875 28.3875 27.6 20.225 68-69 24.781195298824706 27.506876719179797 27.219304826206553 20.492623155788948 70-71 22.675 28.3125 27.9375 21.075 72-73 24.6625 27.474999999999998 27.5875 20.275000000000002 74-75 24.625 27.6 27.500000000000004 20.275000000000002 76-77 23.125 28.475 27.925 20.474999999999998 78-79 24.212500000000002 27.525 28.6375 19.625 80-81 23.549999999999997 28.8375 27.462500000000002 20.150000000000002 82-83 24.7 26.6625 28.0625 20.575 84-85 24.55 27.6 26.974999999999998 20.875 86-87 23.8625 28.762500000000003 27.224999999999998 20.150000000000002 88-89 22.8125 28.212500000000002 28.675 20.3 90-91 23.3 28.499999999999996 27.6375 20.5625 92-93 24.8 27.800000000000004 27.975 19.425 94-95 24.0 27.725 27.487499999999997 20.7875 96-97 24.093523380845213 28.28207051762941 27.53188297074269 20.0925231307827 98-99 24.5625 28.749999999999996 27.0125 19.675 100-101 25.4875 27.8875 27.3875 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 1.5 25 1.0 26 1.5 27 5.0 28 8.0 29 7.5 30 8.0 31 19.0 32 29.5 33 40.5 34 47.0 35 58.0 36 76.0 37 96.0 38 123.0 39 158.0 40 190.5 41 223.5 42 265.5 43 281.5 44 283.0 45 287.5 46 269.5 47 242.0 48 221.0 49 196.0 50 174.0 51 148.5 52 123.0 53 106.5 54 80.5 55 51.0 56 40.5 57 33.0 58 23.5 59 17.0 60 14.5 61 14.0 62 9.0 63 5.0 64 4.0 65 3.5 66 3.0 67 2.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.025 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 1.0499999999999998 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849291 spots for ERR1864447.sra Written 849291 spots for ERR1864447.sra Read 849306 spots for ERR1864447.sra Written 849306 spots for ERR1864447.sra SRR ids: ['ERR1864447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pcna_80y ERR1864447.sra spots: 16985835 blocks: [[1, 849291], [849292, 1698582], [1698583, 2547873], [2547874, 3397164], [3397165, 4246455], [4246456, 5095746], [5095747, 5945037], [5945038, 6794328], [6794329, 7643619], [7643620, 8492910], [8492911, 9342201], [9342202, 10191492], [10191493, 11040783], [11040784, 11890074], [11890075, 12739365], [12739366, 13588656], [13588657, 14437947], [14437948, 15287238], [15287239, 16136529], [16136530, 16985835]] ERR1864447 file size 4075468 ERR1864447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1864447 ERR1864447_1.fastq ERR1864447_2.fastq Input file: ERR1864447_1.fastq Paired file: ERR1864447_2.fastq trimmed: ERR1864447-trimmed-pair1.fastq, ERR1864447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:18:13 2025 >> started Thu Feb 13 12:18:30 2025 >> done (17.254s) 16985835 read pairs processed; of these: 189914 ( 1.12%) short read pairs filtered out after trimming by size control 219978 ( 1.30%) empty read pairs filtered out after trimming by size control 16575943 (97.59%) read pairs available; of these: 4096358 (24.71%) trimmed read pairs available after processing 12479585 (75.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 101 0.00% 19 211 0.00% 20 364 0.00% 21 486 0.00% 22 648 0.00% 23 758 0.00% 24 932 0.01% 25 1119 0.01% 26 1262 0.01% 27 1514 0.01% 28 1760 0.01% 29 2010 0.01% 30 2348 0.01% 31 2647 0.02% 32 2982 0.02% 33 3328 0.02% 34 3682 0.02% 35 4006 0.02% 36 4267 0.03% 37 4662 0.03% 38 5079 0.03% 39 5360 0.03% 40 5825 0.04% 41 6213 0.04% 42 6600 0.04% 43 7132 0.04% 44 7474 0.05% 45 7796 0.05% 46 8188 0.05% 47 8612 0.05% 48 8958 0.05% 49 9486 0.06% 50 10117 0.06% 51 10436 0.06% 52 10817 0.07% 53 11532 0.07% 54 12015 0.07% 55 12598 0.08% 56 13111 0.08% 57 13867 0.08% 58 14667 0.09% 59 17634 0.11% 60 20492 0.12% 61 20845 0.13% 62 21827 0.13% 63 22712 0.14% 64 23532 0.14% 65 24557 0.15% 66 25688 0.15% 67 26633 0.16% 68 28299 0.17% 69 29490 0.18% 70 30084 0.18% 71 31983 0.19% 72 33727 0.20% 73 36221 0.22% 74 37603 0.23% 75 38492 0.23% 76 38462 0.23% 77 40669 0.25% 78 42510 0.26% 79 43737 0.26% 80 45503 0.27% 81 48012 0.29% 82 50570 0.31% 83 53936 0.33% 84 57776 0.35% 85 62053 0.37% 86 66598 0.40% 87 72264 0.44% 88 72926 0.44% 89 76092 0.46% 90 84304 0.51% 91 93868 0.57% 92 103885 0.63% 93 115798 0.70% 94 131728 0.79% 95 153794 0.93% 96 183485 1.11% 97 228296 1.38% 98 305707 1.84% 99 427621 2.58% 100 791975 4.78% 101 12479585 75.29% 16575943 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=24 prefix-density=0.25 prefix-fanout=2.8 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=322.27 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=27.7 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=22 prefix-density=0.25 prefix-fanout=3.2 sequence=GGTGCTGAGAATGGCTGCAAGTGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGGACACATGGACATGGTTCCAACAAAGCAGTAGTTAATCTATCAGTTGGTCAGCTCATGTTTGTATAATGGTGCTTGTTGTTAAATAATAATAAACAGCAAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=398.48 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=30.8 sequence=AAGAAGAAGAAG ERR1864447 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:19:18 Started mapping on | Feb 13 12:19:18 Finished on | Feb 13 12:20:11 Mapping speed, Million of reads per hour | 1125.91 Number of input reads | 16575943 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 15855979 Uniquely mapped reads % | 95.66% Average mapped length | 195.75 Number of splices: Total | 9182128 Number of splices: Annotated (sjdb) | 8979066 Number of splices: GT/AG | 9030184 Number of splices: GC/AG | 124259 Number of splices: AT/AC | 13783 Number of splices: Non-canonical | 13902 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410501 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 53383 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 326556 326556 326556 N_multimapping 410501 410501 410501 N_noFeature 464313 15679952 571912 N_ambiguous 131324 873 62273 UnstrandedReadsAssigned:15260342 PositiveStrandReadsAssigned:175154 NegativeStrandReadsAssigned:15221794 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR1864447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: ERR1864447-trimmed-pair1.fastq ERR1864447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,575,943 reads, 15,414,915 reads pseudoaligned [quant] estimated average fragment length: 169.03 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 ERR1864447.ke.tsv 34699 ERR1864447.se.tsv 87100 total ==> ERR1864447.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1849.97 1359 48.399 Potri.005G024800.1.v4.1 1035 866.97 541 41.1126 Potri.004G059700.1.v4.1 961 792.97 69 5.7329 Potri.007G009000.2.v4.1 1416 1247.97 0 0 Potri.003G141000.2.v4.1 2943 2774.97 1012.3 24.0343 Potri.016G087400.1.v4.1 270 113.54 1376.83 798.937 Potri.015G069301.1.v4.1 564 396.14 0 0 Potri.010G195200.1.v4.1 1773 1604.97 110 4.51552 Potri.012G127500.1.v4.1 977 808.97 6837 556.82 ==> ERR1864447.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 102 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 47 ERR1864447 completed mapping pipeline successfully